ID: 1143747291

View in Genome Browser
Species Human (GRCh38)
Location 17:9003632-9003654
Sequence AGCGAGGGGTGCAGCGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143747291_1143747301 17 Left 1143747291 17:9003632-9003654 CCCTCGGCGCTGCACCCCTCGCT No data
Right 1143747301 17:9003672-9003694 CTCGCTATTTTCACACCTCCCGG No data
1143747291_1143747302 25 Left 1143747291 17:9003632-9003654 CCCTCGGCGCTGCACCCCTCGCT No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143747291 Original CRISPR AGCGAGGGGTGCAGCGCCGA GGG (reversed) Intergenic