ID: 1143747291 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:9003632-9003654 |
Sequence | AGCGAGGGGTGCAGCGCCGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1143747291_1143747301 | 17 | Left | 1143747291 | 17:9003632-9003654 | CCCTCGGCGCTGCACCCCTCGCT | No data | ||
Right | 1143747301 | 17:9003672-9003694 | CTCGCTATTTTCACACCTCCCGG | No data | ||||
1143747291_1143747302 | 25 | Left | 1143747291 | 17:9003632-9003654 | CCCTCGGCGCTGCACCCCTCGCT | No data | ||
Right | 1143747302 | 17:9003680-9003702 | TTTCACACCTCCCGGTGCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1143747291 | Original CRISPR | AGCGAGGGGTGCAGCGCCGA GGG (reversed) | Intergenic | ||