ID: 1143747302

View in Genome Browser
Species Human (GRCh38)
Location 17:9003680-9003702
Sequence TTTCACACCTCCCGGTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143747298_1143747302 -2 Left 1143747298 17:9003659-9003681 CCATCTCCAGCCGCTCGCTATTT No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747295_1143747302 9 Left 1143747295 17:9003648-9003670 CCTCGCTTTCCCCATCTCCAGCC No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747293_1143747302 11 Left 1143747293 17:9003646-9003668 CCCCTCGCTTTCCCCATCTCCAG No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747292_1143747302 24 Left 1143747292 17:9003633-9003655 CCTCGGCGCTGCACCCCTCGCTT No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747289_1143747302 27 Left 1143747289 17:9003630-9003652 CCCCCTCGGCGCTGCACCCCTCG No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747296_1143747302 0 Left 1143747296 17:9003657-9003679 CCCCATCTCCAGCCGCTCGCTAT No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747290_1143747302 26 Left 1143747290 17:9003631-9003653 CCCCTCGGCGCTGCACCCCTCGC No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747294_1143747302 10 Left 1143747294 17:9003647-9003669 CCCTCGCTTTCCCCATCTCCAGC No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747297_1143747302 -1 Left 1143747297 17:9003658-9003680 CCCATCTCCAGCCGCTCGCTATT No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747299_1143747302 -8 Left 1143747299 17:9003665-9003687 CCAGCCGCTCGCTATTTTCACAC No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data
1143747291_1143747302 25 Left 1143747291 17:9003632-9003654 CCCTCGGCGCTGCACCCCTCGCT No data
Right 1143747302 17:9003680-9003702 TTTCACACCTCCCGGTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143747302 Original CRISPR TTTCACACCTCCCGGTGCCC CGG Intergenic