ID: 1143749921

View in Genome Browser
Species Human (GRCh38)
Location 17:9021033-9021055
Sequence CGGTGCCACCGGGGGCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143749912_1143749921 1 Left 1143749912 17:9021009-9021031 CCCACAGGGGCACAGCCCTGTGC No data
Right 1143749921 17:9021033-9021055 CGGTGCCACCGGGGGCCATCAGG No data
1143749906_1143749921 23 Left 1143749906 17:9020987-9021009 CCTCACGCTCCCGGGCTGCGTGC No data
Right 1143749921 17:9021033-9021055 CGGTGCCACCGGGGGCCATCAGG No data
1143749909_1143749921 14 Left 1143749909 17:9020996-9021018 CCCGGGCTGCGTGCCCACAGGGG No data
Right 1143749921 17:9021033-9021055 CGGTGCCACCGGGGGCCATCAGG No data
1143749905_1143749921 29 Left 1143749905 17:9020981-9021003 CCTCTTCCTCACGCTCCCGGGCT No data
Right 1143749921 17:9021033-9021055 CGGTGCCACCGGGGGCCATCAGG No data
1143749913_1143749921 0 Left 1143749913 17:9021010-9021032 CCACAGGGGCACAGCCCTGTGCG No data
Right 1143749921 17:9021033-9021055 CGGTGCCACCGGGGGCCATCAGG No data
1143749911_1143749921 13 Left 1143749911 17:9020997-9021019 CCGGGCTGCGTGCCCACAGGGGC No data
Right 1143749921 17:9021033-9021055 CGGTGCCACCGGGGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143749921 Original CRISPR CGGTGCCACCGGGGGCCATC AGG Intergenic
No off target data available for this crispr