ID: 1143752488

View in Genome Browser
Species Human (GRCh38)
Location 17:9038685-9038707
Sequence CTCATGATCACTGGGGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 165}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143752477_1143752488 -3 Left 1143752477 17:9038665-9038687 CCCTCCCTCCTCCCACACACCTC 0: 1
1: 0
2: 24
3: 278
4: 2387
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752480_1143752488 -8 Left 1143752480 17:9038670-9038692 CCTCCTCCCACACACCTCATGAT 0: 1
1: 1
2: 4
3: 25
4: 337
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752473_1143752488 21 Left 1143752473 17:9038641-9038663 CCTTTCTCTATCCTCCCTGCTGT 0: 1
1: 0
2: 8
3: 68
4: 671
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752479_1143752488 -7 Left 1143752479 17:9038669-9038691 CCCTCCTCCCACACACCTCATGA 0: 1
1: 0
2: 0
3: 44
4: 394
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752478_1143752488 -4 Left 1143752478 17:9038666-9038688 CCTCCCTCCTCCCACACACCTCA 0: 1
1: 0
2: 11
3: 180
4: 1707
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752472_1143752488 22 Left 1143752472 17:9038640-9038662 CCCTTTCTCTATCCTCCCTGCTG 0: 1
1: 1
2: 12
3: 88
4: 763
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752471_1143752488 23 Left 1143752471 17:9038639-9038661 CCCCTTTCTCTATCCTCCCTGCT 0: 1
1: 1
2: 8
3: 121
4: 1089
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752474_1143752488 10 Left 1143752474 17:9038652-9038674 CCTCCCTGCTGTTCCCTCCCTCC 0: 1
1: 0
2: 28
3: 242
4: 1871
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752475_1143752488 7 Left 1143752475 17:9038655-9038677 CCCTGCTGTTCCCTCCCTCCTCC 0: 1
1: 1
2: 22
3: 189
4: 1446
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165
1143752476_1143752488 6 Left 1143752476 17:9038656-9038678 CCTGCTGTTCCCTCCCTCCTCCC 0: 1
1: 2
2: 18
3: 189
4: 1679
Right 1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG 0: 1
1: 0
2: 1
3: 9
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143752488 Original CRISPR CTCATGATCACTGGGGTCTC AGG Intronic
901798624 1:11694386-11694408 CTCAGTATCACAGGGGTTTCCGG - Intronic
902991643 1:20191656-20191678 GTCATGATCACTGCTGTTTCAGG - Exonic
903324483 1:22562376-22562398 CTCATGGTCACTGGGGGGTGAGG - Intergenic
905025316 1:34845663-34845685 CTGATTATCCCTGTGGTCTCTGG - Intronic
909263593 1:73527221-73527243 CTCATGGCCACTGGGGATTCAGG + Intergenic
912243759 1:107939478-107939500 CTCATGATCACTTGGCTGACTGG - Intronic
916585034 1:166142974-166142996 CTCATAACCACTGGGCTCTATGG - Intronic
917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG + Intergenic
918314989 1:183316165-183316187 CTCAGGGTCAGTGGGGACTCTGG - Intronic
1063001299 10:1925875-1925897 CTCATGATCAAGTTGGTCTCTGG - Intergenic
1063721259 10:8583989-8584011 CTCATGTTCACTCTGGACTCTGG + Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1065966396 10:30774514-30774536 CTGATGCTCCCTGGGGTCTGTGG - Intergenic
1067495542 10:46757277-46757299 CTCATGCTCACTGTGGCCCCAGG - Intergenic
1067599111 10:47583111-47583133 CTCATGCTCACTGTGGCCCCAGG + Intergenic
1067948772 10:50709696-50709718 CTCATGCTCACTGTGGCCCCAGG + Intergenic
1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG + Intergenic
1070629133 10:78072041-78072063 CTCATGACCACAGGGGTAGCTGG + Intergenic
1070884092 10:79874689-79874711 CTCATGCTCACTGTGGCCCCAGG + Intergenic
1071265617 10:83962135-83962157 CTCATGATTACTGAGTTCTTAGG + Intergenic
1071650646 10:87390989-87391011 CTCATGCTCACTGTGGCCCCAGG + Intergenic
1074507915 10:114087587-114087609 CTCATGATCCCTTCTGTCTCTGG - Intergenic
1075033387 10:119042310-119042332 CTGATGATGACCGGGGTCCCAGG - Exonic
1075713782 10:124544367-124544389 CTCCTGACCCCTGGGGACTCTGG - Intronic
1076805585 10:132857042-132857064 CTCATGATCCCTGGGGCATCGGG - Intronic
1077104518 11:836377-836399 GTCATGGTGACTGGGGTCTTGGG + Exonic
1080728404 11:34920111-34920133 ATAATGATCACTCTGGTCTCTGG - Intronic
1081588953 11:44407578-44407600 CTCATGGGAACAGGGGTCTCTGG + Intergenic
1082863076 11:57873778-57873800 CTCTTGATCTCTGGTGGCTCTGG + Intergenic
1083302459 11:61746097-61746119 CTCATGATCACTGGTACCTGGGG + Exonic
1085688636 11:78648172-78648194 CTCCTGAGCTCTGTGGTCTCAGG + Intergenic
1088045852 11:105449540-105449562 CTCATGATCACTCAGGGCCCTGG - Intergenic
1091237334 11:134031093-134031115 CTTATGAACACTGGGGGCGCTGG - Intergenic
1096528698 12:52230103-52230125 TTCATGCTCACTGTGGACTCTGG - Intergenic
1100265460 12:92971583-92971605 CTGATCATCACTGAGGTATCAGG + Intergenic
1104589687 12:130074453-130074475 GTCATGAACACGGGGGTCCCAGG + Intergenic
1108539185 13:51421261-51421283 CTCATGATGACTGGTGCCTCAGG - Intronic
1110828140 13:79997234-79997256 CTGATGATCGCTGAGATCTCTGG - Intergenic
1116345345 14:43786232-43786254 CGCATGCCCACTGGGGCCTCAGG - Intergenic
1117418980 14:55524721-55524743 ATCATGATAAATGGGGTATCTGG - Intergenic
1118774660 14:68966312-68966334 CAGATGATCTCTGGGGTCTGCGG - Intronic
1119044401 14:71305158-71305180 TTCATGTTCTCTTGGGTCTCTGG - Intergenic
1121838385 14:97112476-97112498 CTCAGGCTGTCTGGGGTCTCAGG - Intergenic
1122910411 14:104825151-104825173 ATCTTGATCACAGGGGTCTGTGG + Intergenic
1127347647 15:58116606-58116628 CTCATGAACAGTGGGGCCTCAGG - Intronic
1127378192 15:58404300-58404322 CTGATGCTCACTGGGGTCAGAGG + Intronic
1128350216 15:66883465-66883487 CTCATGATCTTTGGGGACTTGGG - Intergenic
1128855430 15:71008475-71008497 CTCAGGAGCACTGGAATCTCTGG + Exonic
1129028924 15:72604754-72604776 CTCCTGAGCCCTGGGGTCTGAGG + Intergenic
1130305820 15:82711508-82711530 CTCAGGGTCCCTGAGGTCTCAGG - Intergenic
1136922865 16:34346136-34346158 CTCCTGGGCCCTGGGGTCTCAGG + Intergenic
1136981708 16:35065670-35065692 CTCCTGGGCCCTGGGGTCTCAGG - Intergenic
1141010424 16:80391857-80391879 CTCGTGATCACTGGGGGCTCTGG - Intergenic
1142185474 16:88692866-88692888 CTAATTATCAGTGGGCTCTCGGG - Intergenic
1143752488 17:9038685-9038707 CTCATGATCACTGGGGTCTCAGG + Intronic
1147260838 17:39209133-39209155 CTCTTGATCCCTGGAGCCTCTGG + Intergenic
1148567330 17:48641464-48641486 CTGATGATCTCTGGGCTCCCGGG - Intergenic
1148811626 17:50296572-50296594 CTATTGACCACTGTGGTCTCAGG + Intergenic
1148862390 17:50611409-50611431 GTCATGATCTGTGGGGCCTCAGG + Intronic
1149296020 17:55263745-55263767 CTCCTGATCTCTGGGGTTTCAGG + Intergenic
1150415498 17:64984998-64985020 CTCAGGGTGACTGGGTTCTCAGG - Intergenic
1150668402 17:67167737-67167759 TTCATGCTCACTGGTGTTTCTGG - Exonic
1151381928 17:73731755-73731777 CTGAAGATCTCTGGGGCCTCGGG + Intergenic
1152209019 17:78993162-78993184 CTCATGCTCACTGCGTTCTCAGG + Exonic
1152310747 17:79548270-79548292 CACCAGAGCACTGGGGTCTCGGG + Intergenic
1153056681 18:952555-952577 CTCATCATCACTGGCATCACTGG - Intergenic
1153105059 18:1516928-1516950 CTCATCATCACTGGCATCACTGG - Intergenic
1153114080 18:1633416-1633438 CTCATCATCACTGGCATCACTGG + Intergenic
1153121592 18:1734023-1734045 CTCATCATCACTGGCATCACTGG - Intergenic
1155703530 18:28779207-28779229 CACATGTGCACTGGGGCCTCAGG + Intergenic
1156332635 18:36138655-36138677 CACATGGTCAGTGGGGGCTCAGG + Intronic
1157909324 18:51600478-51600500 GTGATGATGACTGGGGTCCCTGG + Intergenic
1160022656 18:75192537-75192559 CTGAGGAGCCCTGGGGTCTCTGG - Intergenic
1161445610 19:4317331-4317353 CTCATGGTCTCTGGGGGCTGTGG - Intronic
1162569796 19:11465409-11465431 CTCAATGTCACTGGGGTCTGGGG + Intronic
926633793 2:15160240-15160262 CAGATGAACACCGGGGTCTCAGG + Intergenic
927667728 2:25043660-25043682 CTGCTGACCACTGGGGACTCTGG + Intronic
933942002 2:87252851-87252873 CTCATCATCACTGGGGTGAGGGG - Intergenic
936428332 2:112437219-112437241 CACATGAGCTCGGGGGTCTCTGG + Intergenic
936457792 2:112688690-112688712 GTCTTGATCACTGGGGCCTGGGG - Intergenic
938408531 2:131045850-131045872 CTCAGGCTGCCTGGGGTCTCTGG - Intronic
941125235 2:161576536-161576558 CACATGCCCACTGGGGCCTCAGG + Intronic
942489916 2:176479473-176479495 TTCTTGATTACTTGGGTCTCTGG + Intergenic
945853229 2:215035058-215035080 TTCAACAGCACTGGGGTCTCTGG - Intronic
947597917 2:231425672-231425694 CTGAACATCACTGGGGTCTGGGG + Intergenic
1169144998 20:3246674-3246696 CCCATGATCACTGGTATCCCTGG + Intergenic
1170092664 20:12608401-12608423 TTCTTGATCTCTGGGGTGTCGGG + Intergenic
1172121408 20:32601085-32601107 CTCATGATCACTGAGCAGTCTGG - Intronic
1172854040 20:37987532-37987554 CTCTTGATAACTGTGCTCTCTGG - Intronic
1173166928 20:40692044-40692066 CTTCTCATCTCTGGGGTCTCTGG + Intergenic
1176247901 20:64105945-64105967 CTGATGACCAGTGGGGTCTGGGG + Exonic
1176373917 21:6077992-6078014 CACATGAGCTCGGGGGTCTCTGG - Intergenic
1179749560 21:43460251-43460273 CACATGAGCTCGGGGGTCTCTGG + Intergenic
1180876268 22:19176645-19176667 CCTCTGATCACTGGGGTCTTCGG - Exonic
1182418678 22:30237983-30238005 CTCATGGTAACTTGAGTCTCAGG - Intergenic
1182482362 22:30617359-30617381 CTGATGATCTCTTGGGTCTGAGG - Exonic
1183645983 22:39126950-39126972 CTCATGAGCACTGGGGAGGCTGG - Intronic
1184114810 22:42416338-42416360 CTCATGATCTCTGTGGTTTTGGG - Intronic
1184411196 22:44327458-44327480 CTCATGATAACTGGGGTGGGGGG + Intergenic
1185163496 22:49243859-49243881 CTCAGGACCACTTGGGACTCTGG - Intergenic
949616982 3:5764601-5764623 ATCATGATCTTTGGGGTCTAAGG + Intergenic
950106190 3:10390543-10390565 CTCTTGGTCTCTGGGGTCTCAGG + Intronic
953584595 3:44188289-44188311 CTCCTGGTCTCTAGGGTCTCTGG - Intergenic
954573580 3:51662524-51662546 CTGATGATCTCTGGGCTGTCAGG - Exonic
954864520 3:53717571-53717593 CTCAGTATGACTAGGGTCTCTGG - Intronic
959583472 3:108004678-108004700 CACATGCCCACTGGGGCCTCAGG + Intergenic
961716273 3:128859575-128859597 CTGATGGTCCCTGGGGTCACAGG + Intergenic
962212667 3:133491912-133491934 CTCATGACCTCTGGGGCCTCTGG - Intergenic
963432843 3:145231459-145231481 CTCAAGAAGCCTGGGGTCTCTGG + Intergenic
965809422 3:172576776-172576798 CTCTTGAACACTGGGGACACTGG + Intergenic
967731878 3:192914760-192914782 CTGGTGGTCACTGTGGTCTCTGG - Intronic
969468931 4:7375015-7375037 CCACTGATCACTGGGGTCCCTGG + Intronic
976811446 4:89105020-89105042 CCCAGGATCACTGGGGGCTGAGG - Intronic
977444742 4:97116505-97116527 GTCATGAAGTCTGGGGTCTCCGG - Intergenic
979832448 4:125318002-125318024 CTCGTGACCACTGGGTCCTCTGG + Exonic
980337882 4:131499796-131499818 CACATGCCCACTGGGGCCTCAGG - Intergenic
981941840 4:150289496-150289518 CTTATGATCATTAGGTTCTCAGG + Intronic
982357473 4:154486796-154486818 CTCTTAGTCACTGGGCTCTCTGG - Intronic
983884369 4:172963769-172963791 CTCATGAACAGTCGGGTCTGTGG + Intronic
988773862 5:34457866-34457888 CCCAAGATAACTGGGGGCTCTGG + Intergenic
990992662 5:61700844-61700866 CTGATGCTCACTCGGTTCTCAGG + Intronic
996885317 5:128347002-128347024 CTCATTATCACAGGGCTCTGAGG + Intronic
999194658 5:149773861-149773883 CTCATGAGAACTGGGGACTGTGG + Intronic
1001588524 5:172849892-172849914 CTCAGCATCTCTGGGGTATCAGG + Intronic
1005386353 6:25289020-25289042 CCCATGGTCATTAGGGTCTCTGG - Intronic
1006339895 6:33441047-33441069 CTCAGGATCTCTGGGGACTCAGG - Intronic
1007891769 6:45301077-45301099 CTTAAGATCTCTGGGGTTTCTGG + Intronic
1009735749 6:67674313-67674335 CCCATGATAACGGGGGTCTAAGG + Intergenic
1009864762 6:69383397-69383419 CACATCAACACTGGGGACTCTGG + Intronic
1010187240 6:73157843-73157865 CTCATGATCTGTGGGTTTTCGGG + Intronic
1010532741 6:76988971-76988993 CACATGCCCACTGGGGCCTCAGG + Intergenic
1010981512 6:82375221-82375243 CTCATGCCTCCTGGGGTCTCTGG - Intergenic
1012254697 6:97017900-97017922 CACATGATCACTTGGGGCCCAGG - Intronic
1012423610 6:99091273-99091295 CTGATGATCACTGAGCTCACAGG + Intergenic
1014017275 6:116547541-116547563 CTCATCATCACAGGGGACACTGG + Intronic
1015925954 6:138310879-138310901 CTGATGATAAATGAGGTCTCTGG - Intronic
1018258028 6:161941647-161941669 CACATGCCCACTGGGGTTTCAGG + Intronic
1019605484 7:1907973-1907995 CTCCTGAGCTCTGGGGTCACGGG - Intronic
1022356715 7:29622615-29622637 CTCCAAATCTCTGGGGTCTCGGG + Intergenic
1022517271 7:30983998-30984020 TTCATCAACACTGGGGTCTGGGG - Intronic
1023098635 7:36689946-36689968 TTTATGATCACTGGGGTCATAGG - Intronic
1024724428 7:52176540-52176562 CCCATATTCACAGGGGTCTCAGG - Intergenic
1024979152 7:55143079-55143101 CTCATTATCACAGGGGTCAAAGG + Intronic
1025261009 7:57417297-57417319 CTCAGGATCCATGGGGGCTCAGG + Intergenic
1025738324 7:64174506-64174528 CTCAGGATCCATGGGGGCTCAGG + Intronic
1029251614 7:99240858-99240880 GTTCTGATCACTGAGGTCTCTGG - Intergenic
1034970084 7:155413359-155413381 CTGATGATGACGAGGGTCTCTGG + Intergenic
1040502911 8:48021002-48021024 CTCCAGAGCACTGGGGTTTCAGG + Intronic
1041604063 8:59759532-59759554 CTCATGATGCATAGGGTCTCTGG - Intergenic
1045248713 8:100465591-100465613 AACATGTTCACTGGGGTCTGGGG + Intergenic
1046229480 8:111334920-111334942 CACATGCCCACTGGGGTTTCAGG - Intergenic
1046862204 8:119106073-119106095 CTCATGACCATAGGGGTCGCTGG - Exonic
1046870130 8:119196901-119196923 CGCATGCCCACTGGGGTTTCAGG - Intronic
1047079290 8:121442438-121442460 CACATGCCCACTGGGGTTTCAGG - Intergenic
1048493067 8:134912595-134912617 GTCATCATCACTGGGGTGTGTGG + Intergenic
1049455328 8:142683608-142683630 CTCCTGAACACTGGGGGCCCAGG + Intergenic
1050876896 9:10650842-10650864 CCCATGATTTCTTGGGTCTCGGG - Intergenic
1052566499 9:30160303-30160325 CACATGCTCACTGGGGCCTCGGG - Intergenic
1056250781 9:84745902-84745924 CACATGATCCCAGGGGTCTATGG + Intronic
1056574323 9:87843348-87843370 CTCATGCTCACTGTGGCCCCAGG - Intergenic
1056886510 9:90448681-90448703 CTCATGACCACTGGGGTTGGGGG - Intergenic
1059420928 9:114191931-114191953 ATCATCATCACTGGTCTCTCTGG + Intronic
1059911062 9:119044707-119044729 CTCAGGATCCCTGGGGCCTGAGG - Intergenic
1061028145 9:128063798-128063820 ATCATGTCCACAGGGGTCTCTGG + Exonic
1061787152 9:133036511-133036533 CTCAAGAACACGGGGGTCACTGG - Intronic
1062036971 9:134386711-134386733 GCCAGGACCACTGGGGTCTCTGG + Intronic
1062043258 9:134413821-134413843 CCCAGCATCACTGGGGTCCCAGG - Intronic
1062564426 9:137157637-137157659 CAGATGTTCACTTGGGTCTCTGG - Intronic
1188186928 X:27127888-27127910 CACATGCCCACTGGGGTTTCAGG - Intergenic
1189642234 X:43085567-43085589 CACATGTCCACTGGGGCCTCAGG - Intergenic
1193656210 X:84201111-84201133 CTTATGATCACTTGGGCCTGTGG + Intergenic
1195792665 X:108606104-108606126 CTCATGAGAACTGGTGTCACGGG - Intronic
1197744567 X:129923096-129923118 CTCATTTTCACTGGGGTCCGTGG - Intronic
1198676179 X:139133636-139133658 CTCATATTCACTGGGGGCTGTGG + Intronic
1201968749 Y:19768461-19768483 CTCCTGATCCCTTGGGTCACAGG + Intergenic
1202084143 Y:21118148-21118170 CACATGCTCACTGGGGCTTCAGG - Intergenic