ID: 1143754469

View in Genome Browser
Species Human (GRCh38)
Location 17:9056393-9056415
Sequence TCCTCACCGTGCCCACAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143754469_1143754471 3 Left 1143754469 17:9056393-9056415 CCATCTTGTGGGCACGGTGAGGA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1143754471 17:9056419-9056441 AGATTTAATTTTGAGGTCTATGG 0: 1
1: 0
2: 0
3: 21
4: 254
1143754469_1143754473 29 Left 1143754469 17:9056393-9056415 CCATCTTGTGGGCACGGTGAGGA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1143754473 17:9056445-9056467 GCCATGAGAGAATTTTAGATAGG 0: 1
1: 0
2: 1
3: 11
4: 153
1143754469_1143754472 4 Left 1143754469 17:9056393-9056415 CCATCTTGTGGGCACGGTGAGGA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1143754472 17:9056420-9056442 GATTTAATTTTGAGGTCTATGGG 0: 1
1: 0
2: 0
3: 15
4: 231
1143754469_1143754470 -4 Left 1143754469 17:9056393-9056415 CCATCTTGTGGGCACGGTGAGGA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1143754470 17:9056412-9056434 AGGAGTTAGATTTAATTTTGAGG 0: 1
1: 0
2: 4
3: 28
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143754469 Original CRISPR TCCTCACCGTGCCCACAAGA TGG (reversed) Intronic
900379017 1:2374425-2374447 ACCTCACAGTGCCCACAGGAAGG + Intronic
902148926 1:14426599-14426621 ACCTCAGTGTGGCCACAAGATGG - Intergenic
910035054 1:82779067-82779089 TCCTAACTGTTCCCACTAGAAGG + Intergenic
910211260 1:84795841-84795863 TCCTCTCCGTGCTCACAATATGG + Intergenic
912513046 1:110201397-110201419 TCCACACAGTGCCCACCAGAAGG + Exonic
913015764 1:114733087-114733109 TCCTCACCTTCCCCACAAACTGG + Intronic
913593602 1:120352655-120352677 ACCGCACCCTGCCCACAAGCAGG - Intergenic
914093653 1:144526329-144526351 ACCGCACCCTGCCCACAAGCAGG + Intergenic
914304873 1:146407572-146407594 ACCGCACCCTGCCCACAAGCAGG - Intergenic
914597182 1:149165257-149165279 ACCGCACCCTGCCCACAAGCAGG + Intergenic
914948602 1:152089422-152089444 TCCTCTGTCTGCCCACAAGATGG + Intergenic
916817989 1:168371959-168371981 TCATCACTGTGGCCAAAAGATGG + Intergenic
922467473 1:225854044-225854066 TGCTCACCGTCCCCAGCAGATGG - Intronic
922603214 1:226872200-226872222 TGCTCACCGTCCCCCCAAGGGGG + Intronic
1062979327 10:1708721-1708743 TCCTCACTGTGACCCCAGGAGGG - Intronic
1068120780 10:52780286-52780308 TCCTAAGCATGGCCACAAGATGG - Intergenic
1071813640 10:89208877-89208899 TCCTCACCCTGCCAAGAAGTAGG + Intergenic
1072949101 10:99836803-99836825 TGCTCACCCTGTTCACAAGACGG - Intronic
1074971673 10:118544262-118544284 TCCTCAACATGGCCAGAAGATGG - Intergenic
1075287409 10:121198924-121198946 TCCTCACCCTGGCCATAAGCTGG - Intergenic
1076681271 10:132172724-132172746 TCCTCTCTGTCCCCACAAGGCGG + Intronic
1077292247 11:1803269-1803291 TCCTGGCCCTGCCCACAGGAAGG - Intergenic
1077421553 11:2452499-2452521 TCCCCACCCTGCCCCAAAGAGGG + Intronic
1078191740 11:9096760-9096782 TCCTTCCCTTGCCCAAAAGAGGG + Intronic
1078912397 11:15745194-15745216 TCCTCTTCCTGCTCACAAGATGG + Intergenic
1078986932 11:16606381-16606403 TGCCCTCCGTGCCCACAAGAGGG - Intronic
1079403893 11:20128417-20128439 ACCTCACAGTGGCCACAAGAGGG + Intergenic
1089246697 11:117126351-117126373 GACTCAGAGTGCCCACAAGAGGG + Intergenic
1090424079 11:126595008-126595030 TCCTGAGCGTGCCCTGAAGATGG + Intronic
1104753382 12:131254051-131254073 TCCTCACCGTGCCCCACACATGG + Intergenic
1107239514 13:38215121-38215143 TCATCACCATACCCAGAAGAAGG + Intergenic
1115945143 14:38651600-38651622 TCCTCAACATTCCTACAAGATGG + Intergenic
1117192476 14:53306379-53306401 TCCTCAGAGTGCCCAGCAGATGG - Intergenic
1118471931 14:66082285-66082307 TCATCCTCCTGCCCACAAGAAGG + Intergenic
1118833713 14:69460302-69460324 TCCTCACTGTGGCCAGCAGAGGG - Exonic
1121089782 14:91173327-91173349 GCCTCATCGTGACCACCAGAGGG - Exonic
1121781048 14:96622692-96622714 TCTTCACTGTGCCAACAAGATGG + Intergenic
1124966543 15:34436802-34436824 TCCGCACCGTGCCCCCAACCCGG + Intronic
1125442955 15:39722813-39722835 ACCTCACCGTCCCCAGAAGCTGG - Intronic
1130363271 15:83209487-83209509 TCCACCCCGTGCCCACAGGGAGG - Intergenic
1131259218 15:90879969-90879991 TCCTCACCGAGCCCAAGTGAGGG + Exonic
1133790986 16:9008947-9008969 TTCTCCCCGTGGCCACTAGAGGG - Intergenic
1137297229 16:47106894-47106916 GCCTCACCCTGCCCAGTAGATGG + Intronic
1137693929 16:50448641-50448663 TCCCAACAGTGGCCACAAGAAGG - Intergenic
1137758501 16:50921315-50921337 TCCTCACAATGACCCCAAGAGGG - Intergenic
1141708745 16:85685170-85685192 GCCTCACTGTTCCCACAATATGG + Intronic
1141968943 16:87466876-87466898 ATCTAACCGTGCCCACCAGAGGG + Intronic
1142424091 16:89991642-89991664 TCCTGACGGTGCCCACAGGGTGG + Intergenic
1143754469 17:9056393-9056415 TCCTCACCGTGCCCACAAGATGG - Intronic
1144792172 17:17866615-17866637 TCCTCCCCGTCCCCACTAGAAGG + Intronic
1146133127 17:30295349-30295371 TCCTCACCATGCCCATATGGGGG - Intergenic
1148156596 17:45428218-45428240 TCCCCACCCTGGCCACAAGGCGG + Intronic
1150239622 17:63621769-63621791 TCCTCCCCGTGCCCAGCACAGGG - Intergenic
1151315660 17:73320591-73320613 TCCTCACTCTCCCCACAAGAAGG - Intergenic
1151975200 17:77480533-77480555 TCCTCACTCTGCCCAGAAGGTGG - Intronic
1152624524 17:81382134-81382156 TCCTCTCCGGGCCCACCGGACGG - Intergenic
1156361623 18:36388957-36388979 TGCTCACGGTGCCCCCCAGAGGG - Intronic
1156493536 18:37511013-37511035 TCATCACCATCCCCACCAGAAGG + Intronic
1161712538 19:5857394-5857416 TCCTCCCCCTGCCCTTAAGAAGG + Intergenic
1168141531 19:54391177-54391199 TCTCCACTGTGGCCACAAGAGGG - Intergenic
925124067 2:1441261-1441283 GCCACACCGTACCAACAAGAAGG - Intronic
931668305 2:64625574-64625596 TCCTCAGAGTCACCACAAGAGGG - Intergenic
932592448 2:73075495-73075517 TCCTCACCCTACCCCCAGGAGGG - Exonic
936719499 2:115233738-115233760 TCCTGTCCACGCCCACAAGAGGG - Intronic
937043481 2:118838265-118838287 TCCTCACTGTGCCGTCAAGTGGG - Intergenic
938671385 2:133589666-133589688 TCCTCCTCATGCCCACCAGATGG + Intergenic
948668173 2:239549265-239549287 CCATCACTCTGCCCACAAGAAGG + Intergenic
1169072766 20:2743263-2743285 TCCTCTCCTTGCCCACCAGGGGG - Intronic
1169255271 20:4092039-4092061 TTCTCAGCGGGCCCACGAGAGGG - Intergenic
1170966020 20:21072312-21072334 TCCTCACTGTGCCCAGACCAGGG + Intergenic
1171164606 20:22958903-22958925 TCCTCACAGGTCCCACAGGAGGG + Intergenic
1172015132 20:31869033-31869055 TCATGACCCTGCTCACAAGAAGG + Intronic
1173908055 20:46642991-46643013 TCCTCACCATGACCCCAAGAAGG - Intronic
1176063284 20:63181532-63181554 TCCTGGCCGTGCCCATAAGCCGG + Intergenic
1179077118 21:38132919-38132941 TCCTCACCCTGCCAAAAATAAGG - Intronic
1180085568 21:45506593-45506615 TCCTCACCTTTGCCACACGAAGG - Intronic
1180674106 22:17575369-17575391 TCCTGACCTTGACCACAAAAAGG - Intronic
1180711167 22:17840735-17840757 TCCCCACTGTGCCCAGATGAGGG - Intronic
1181630602 22:24149193-24149215 TCCTCACCGGGCTCACAGGTGGG - Intronic
1181669700 22:24420400-24420422 GCCTCCCCGTGCCCACCAAAGGG + Intronic
1181728474 22:24827700-24827722 TCCTCACCTTACCCCTAAGAGGG + Intronic
1183607175 22:38872489-38872511 GCCGCAGCGTGCCCACAAGCCGG - Intergenic
949995152 3:9610927-9610949 TCTTCATCGTGGTCACAAGATGG + Intergenic
950497668 3:13343664-13343686 TCCTCACTCTGCCCTCAAGTTGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
954415859 3:50392989-50393011 GCCTCACCTTGCCCACACCATGG - Intronic
956453964 3:69402284-69402306 TCCTCATTGTGGCAACAAGATGG - Intronic
962209422 3:133464721-133464743 GCCTCACAGTGACCACAGGAGGG + Intronic
965788808 3:172365386-172365408 TTCTCACCTTGGCCACAAGCGGG - Intronic
969237588 4:5876938-5876960 TCCTCACCATGCCCCAAAGTGGG + Intronic
969353127 4:6609705-6609727 TGCCCACCCTGCCCACATGAAGG + Intronic
973960000 4:56100236-56100258 TCCCCCCCGTCCCCGCAAGATGG - Intergenic
980683995 4:136201712-136201734 TGCTCACAGTGCTCCCAAGATGG - Intergenic
986799870 5:11247439-11247461 TCCCCACAGTCCCCACAAGGTGG - Intronic
992881057 5:81110736-81110758 TCATCACCCTGTCCAGAAGATGG - Intronic
996702095 5:126460569-126460591 GCCTCACAGTGACCAAAAGAAGG - Intronic
1002316403 5:178347031-178347053 GCCTCACCCTGCTCACCAGATGG - Intronic
1004198572 6:13527305-13527327 TCCTGACCCTGCCCACACAAGGG + Intergenic
1013669893 6:112389278-112389300 TCCTCACCTTTCCCAGAAAAAGG - Intergenic
1018972099 6:168536810-168536832 GCCTCACCGTGGCCACAGGTTGG - Intronic
1019283381 7:211473-211495 TCCCCAGCGTGGCCACATGAGGG + Intronic
1019496689 7:1343863-1343885 TCTCCACCGTGCCCTCAACAAGG - Intergenic
1022102430 7:27176451-27176473 TCCTTACCCTGCTCACCAGAAGG + Intronic
1023840782 7:44096435-44096457 TCCTCCCTCTGCCCACAAGTTGG + Intergenic
1030615693 7:111735867-111735889 TTCTCAACATGCCCACCAGATGG - Intronic
1032466462 7:132148687-132148709 TCCTCAGCTTCCCCACAAGAGGG - Intronic
1034338475 7:150338210-150338232 TGCTCACCCTGCCCACAGGAAGG + Intergenic
1034400594 7:150859033-150859055 TCCTCACCTTGCCCAGGTGATGG - Exonic
1037726146 8:21484021-21484043 ACCTCACTGTGCTCTCAAGAGGG - Intergenic
1039894482 8:41706739-41706761 TCCTCACCTTGCCCCTGAGATGG - Intronic
1040435160 8:47383095-47383117 TCCTCACCCTACCCACCACAGGG + Intronic
1040877266 8:52166601-52166623 TCCTCACAGTGTCCAGAGGAAGG - Intronic
1040942073 8:52844230-52844252 TCCTCACTGTGACCACGGGAGGG + Intergenic
1049210700 8:141385181-141385203 TCCCCACCAGGCCCAGAAGAGGG - Intergenic
1049695502 8:143982593-143982615 TCCTCAAAATGACCACAAGATGG + Intronic
1053351150 9:37414232-37414254 TCCTAACAGTGCCCACTTGAAGG + Intergenic
1056497927 9:87178302-87178324 TCCTCACTGAGCCCTCAAGCTGG - Intergenic
1060372028 9:123083038-123083060 TCCTCACAGTGACCATATGAGGG + Intronic
1061385356 9:130286343-130286365 TCCTCACCGTGCCCGAGTGATGG - Intronic
1062147257 9:134996546-134996568 TCCTTACACTGCCCAGAAGAGGG - Intergenic
1187121164 X:16407684-16407706 TCCTCACTGTGCCCACATTGTGG - Intergenic
1187724995 X:22192882-22192904 TCCTAACAGTGGCCACACGAGGG - Intronic
1190455805 X:50626879-50626901 TTCTCACCTTGCCCAGAAAAAGG + Intronic