ID: 1143754911

View in Genome Browser
Species Human (GRCh38)
Location 17:9059733-9059755
Sequence GGTGATGGTTGTACAGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 3, 2: 4, 3: 54, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143754907_1143754911 15 Left 1143754907 17:9059695-9059717 CCTTTAGGGAAGATGAAAACATT 0: 1
1: 1
2: 10
3: 80
4: 491
Right 1143754911 17:9059733-9059755 GGTGATGGTTGTACAGCTTTGGG 0: 1
1: 3
2: 4
3: 54
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143754911 Original CRISPR GGTGATGGTTGTACAGCTTT GGG Intronic
905261807 1:36724535-36724557 GTTGATGTTTGTCGAGCTTTGGG + Intergenic
906849425 1:49232152-49232174 AGTGATGGTTGCACAACTCTGGG + Intronic
908698842 1:66875704-66875726 GGTAAAGCTTGGACAGCTTTAGG + Intronic
908935067 1:69365323-69365345 AGTGATGGTTGCTCAGGTTTAGG - Intergenic
911225728 1:95303759-95303781 GGTGATGGTTGCACAACAATGGG - Intergenic
912286131 1:108371536-108371558 GGTGATGGTTGCAAAACCTTCGG + Intergenic
913350688 1:117855406-117855428 GGTGATGGTTATACAACTCTTGG + Intergenic
913639784 1:120801366-120801388 GGTGATGGTTGCAGAACTTTTGG + Intergenic
913704695 1:121407735-121407757 GGTGATGGTTGTACAACTTTGGG - Intergenic
914212716 1:145595162-145595184 GGTGATGGTTGCAGAACTTTTGG - Intergenic
914278693 1:146148975-146148997 GGTGATGGTTGCAGAACTTTTGG - Intronic
914382652 1:147131720-147131742 GGTGATGGTTGCAAAACCTTTGG - Intergenic
914539740 1:148599917-148599939 GGTGATGGTTGCAGAACTTTTGG - Intronic
914626934 1:149471701-149471723 GGTGATGGTTGCAGAACTTTTGG + Intergenic
914866668 1:151435904-151435926 GATGATGGTTGCACAGCCTTGGG - Intronic
917781032 1:178397550-178397572 GGTGATGGTTGCACAGCTTTGGG + Intronic
918123585 1:181561157-181561179 AGTGATGGTTGTACAACAATAGG + Intronic
918213923 1:182376408-182376430 GATGATGGTTATATAGCTTTAGG + Intergenic
919272291 1:195363451-195363473 TGTGATGGTTTCATAGCTTTTGG - Intergenic
920853730 1:209647003-209647025 GGTGATGGGACTACAGCTTCAGG + Intronic
922228030 1:223662586-223662608 GGTGATGGTTGCATAGCAATGGG + Intronic
922917048 1:229267143-229267165 GGTGATGGTTGCACAACAATGGG + Intergenic
1063460870 10:6214345-6214367 GGTTGTGGGTGTACGGCTTTGGG - Intronic
1063475622 10:6326296-6326318 GGTGGTGGTGGTAAAGCATTAGG + Intergenic
1064106098 10:12502215-12502237 TGTGATGGATGCAGAGCTTTAGG + Intronic
1065250905 10:23812593-23812615 GGTGATGGTTGCACAACTCTGGG - Intronic
1065400247 10:25291914-25291936 TCTGATGTTTGTGCAGCTTTAGG + Intronic
1066220608 10:33334484-33334506 GCTGAGGATTGTACAGCTCTAGG - Exonic
1066347166 10:34599070-34599092 GGTGATGGTTGTAGAGAATGGGG - Intronic
1066575689 10:36821933-36821955 GGAGATGCTTGTAGAGATTTGGG + Intergenic
1067224265 10:44365148-44365170 GGAGCTGGGTGTACAGGTTTGGG + Intergenic
1067274502 10:44821863-44821885 GGGGATGTTTGTCCAGCTTTGGG - Intergenic
1069799063 10:71071032-71071054 GGTGATGGTTACACAGCTGGGGG - Intergenic
1069817602 10:71208501-71208523 GGTGATGGCTGCACAACATTGGG + Intergenic
1071596692 10:86933036-86933058 GGTGATGGTTGAACTGTTTTAGG + Intergenic
1072809545 10:98448360-98448382 GGTGATGGCTGCATAGCATTAGG - Intergenic
1073176060 10:101558465-101558487 GCTGATGGTGGCACAGCTATAGG - Intergenic
1074285443 10:112093471-112093493 GGGGATGCTTGTGCAGCTCTAGG - Intergenic
1075071543 10:119323225-119323247 GGTGATGGTTCCACAGCAATGGG + Intronic
1075113431 10:119606477-119606499 GGTGATGGTTGCACAGCAGTGGG + Intergenic
1075303532 10:121347136-121347158 GGTGATGATGGCACAGCATTGGG - Intergenic
1075558717 10:123452153-123452175 GGTCGTGGTAGTACAACTTTGGG + Intergenic
1076002396 10:126922712-126922734 GGTGGTGGTTGCACAACATTAGG + Intronic
1080040612 11:27755845-27755867 GGTAATGGTTGTACAACAATGGG - Intergenic
1080177453 11:29382610-29382632 GGTGATGGTTGCACAACCTGAGG + Intergenic
1082263176 11:50093138-50093160 GGTGATTGATGCACAGCTCTGGG + Intergenic
1083208937 11:61170659-61170681 CGTGATTGTTATAAAGCTTTCGG + Intergenic
1085229180 11:74949778-74949800 GGTGATGGTGGTAGAGAGTTTGG - Intronic
1086964517 11:93014001-93014023 GGTGGTGGTTGTACAACATTGGG - Intergenic
1087166857 11:95013462-95013484 GTTGATGGTTGTACAACGATGGG - Intergenic
1089906944 11:122049694-122049716 GGTGATGGTTGCACAACAATGGG - Intergenic
1091709566 12:2729085-2729107 GGTGGTAGTTTGACAGCTTTGGG + Intergenic
1099488833 12:83262066-83262088 GGTGATGGTTGTAAATGTGTAGG + Intergenic
1101699040 12:107154404-107154426 GGTGATGGTTGCACAACAATGGG - Intergenic
1102974049 12:117193337-117193359 GGTGGTGGTTGCACAGCATTGGG + Intergenic
1103438601 12:120946514-120946536 GGTGATGGTTTCACAGGTGTAGG - Intergenic
1103464834 12:121133638-121133660 GGGGATGGTTGCACAACTCTGGG - Intronic
1103652953 12:122447324-122447346 GGTGATGGCTTTACAACTCTGGG + Intergenic
1103950362 12:124547575-124547597 GGTGATGGTCGCACAGCACTGGG - Intronic
1104588847 12:130068481-130068503 GGTGCTGGTTGTACAGATGCAGG - Intergenic
1105950058 13:25222142-25222164 GGTGATGGTTGCACAACTTGTGG + Intergenic
1109654266 13:65368829-65368851 GGTGAAGGGTGTCCAGGTTTTGG - Intergenic
1110306351 13:73991894-73991916 AGTGATGGTTGTGTAGCTTGTGG - Intronic
1110503532 13:76258077-76258099 GTTGATCATTGTACAGCATTAGG + Intergenic
1111125489 13:83907786-83907808 GGTGAAGGTTGTACAGACATGGG + Intergenic
1115057605 14:29149772-29149794 TGTGATTGTTGTAAAGCATTAGG - Intergenic
1119706397 14:76785335-76785357 TGTGATAGTTGTACATATTTTGG - Intergenic
1122996790 14:105269468-105269490 GGTGGTGGTTGCTCAGCTCTGGG - Intronic
1123505055 15:20933623-20933645 GGTAATGGTTGCACAACTCTGGG + Intergenic
1123598545 15:21944605-21944627 GGTAATGGTTGCACAACTCTGGG + Intergenic
1123913984 15:25002065-25002087 TCTGATGTTTGTACAGCTTTAGG - Intergenic
1124547940 15:30649987-30650009 GGTGATGGTTATACAACAATGGG - Intronic
1125997846 15:44181567-44181589 GGTGAGGGTTGCACAACTCTGGG - Intronic
1127209101 15:56753219-56753241 GGTGATGGTTGCACAACAATGGG + Intronic
1128483668 15:68063117-68063139 GGTAAGGGTTGTATAGCTTGAGG + Intronic
1128794272 15:70453412-70453434 GCTGATGGTTGCACAACATTTGG - Intergenic
1130380422 15:83367518-83367540 AGTGATGGCTTTGCAGCTTTTGG + Intergenic
1131193898 15:90339642-90339664 GGTGATGATTGCACAACATTAGG + Intergenic
1132349562 15:101131108-101131130 GGTGATGGTTGCACAACAGTGGG + Intergenic
1202970645 15_KI270727v1_random:234459-234481 GGTAATGGTTGCACAACTCTGGG + Intergenic
1133899359 16:9959022-9959044 GGAGATGGTTGTAAAAATTTGGG - Intronic
1134558685 16:15188465-15188487 GGTGATGGTTTTACAGACTGGGG - Intergenic
1134919216 16:18100067-18100089 GGTGATGGTTTTACAGACTGGGG - Intergenic
1137658657 16:50183961-50183983 GGTGATGGTTGCACAACTCTAGG - Intronic
1142067390 16:88070595-88070617 GGGGATGGGTTTTCAGCTTTGGG + Intronic
1142468671 17:149906-149928 GGTGATGGATGTACAACTCTGGG - Intronic
1142468875 17:151503-151525 GGTTTTGGATTTACAGCTTTGGG + Intronic
1143754911 17:9059733-9059755 GGTGATGGTTGTACAGCTTTGGG + Intronic
1145122228 17:20270190-20270212 GGTGATGGTTGCACAACATTGGG + Intronic
1146825050 17:36014498-36014520 GGTGGTGGTGGTCCAGCTTCAGG - Intronic
1147248923 17:39140926-39140948 GGTGATGGTCATACAACATTAGG - Intronic
1150189493 17:63223182-63223204 GGTGATGGTTGCACAACATTGGG + Intronic
1151086943 17:71390987-71391009 TCTGATGTTTGCACAGCTTTAGG + Intergenic
1152552643 17:81037478-81037500 GGTACTGGTTGGGCAGCTTTTGG + Intronic
1153503859 18:5774990-5775012 GGTGATGGATGCACAGCTCTTGG - Intergenic
1154192203 18:12239660-12239682 GGTGATGATTGCACAGCAATGGG - Intergenic
1155954439 18:31945215-31945237 AGTAATGGTTGCACAACTTTTGG - Intronic
1157423705 18:47567410-47567432 GGTGGTGGTAGTACAGAATTAGG - Intergenic
1157594595 18:48856829-48856851 GGTGATGGTTGCACAATTCTGGG + Intronic
1158923221 18:62218029-62218051 GGTGATGATAGTACTGCCTTAGG + Intronic
1160216534 18:76937556-76937578 GGTGGTGGGATTACAGCTTTGGG - Intronic
1160896378 19:1404054-1404076 GGTGATGGTTGCACAACAATGGG + Intergenic
1161334165 19:3703199-3703221 GGTGATGTTTGCACAGCCATGGG + Intergenic
1161556589 19:4946095-4946117 GGTGATGGTTGCATAGCAATGGG - Intronic
1161935783 19:7371328-7371350 GGTGATGGTTGCACAGCAATGGG + Intronic
1164757478 19:30700878-30700900 GGCGCTGGTTGTGCAGCTCTGGG + Intronic
1165190018 19:34055073-34055095 TCTGATGTTTGTACAGTTTTAGG - Intergenic
1165437641 19:35805155-35805177 GGTGATGGTTGCACAATTTTGGG + Intronic
925778567 2:7358072-7358094 GGTGATGATTGTACAACCTTAGG - Intergenic
927465809 2:23335666-23335688 GGTGATGCTGATACTGCTTTGGG + Intergenic
927501486 2:23586244-23586266 GGTGATGGTCCCACAGCCTTAGG - Intronic
927688887 2:25193447-25193469 GGTGATGGTTGCACAGCCTTGGG + Intergenic
927859033 2:26548393-26548415 GGTGATGGGTGTACAACCTTGGG - Intronic
928043153 2:27898856-27898878 GGTGAAGGTTGCATAGCTTTGGG + Intronic
930990164 2:57644821-57644843 GGTGATGGTTGCACAATTCTGGG - Intergenic
932883330 2:75524472-75524494 GGTGAGGGTTGGAGTGCTTTGGG - Intronic
934099496 2:88639541-88639563 GGTGATGGTTGTATGACTCTAGG + Intergenic
934116883 2:88807265-88807287 GGTGTTGGTCGAACAGCTGTTGG + Intergenic
934658480 2:96130358-96130380 GGTGATGGTTGGCCAGCCATGGG - Intronic
934898130 2:98136300-98136322 GGTGATGGGTGTACAACAATGGG - Intronic
936001472 2:108834667-108834689 GATGATGGTTGTACAGCATTGGG - Intronic
939417029 2:141913136-141913158 GGTGATGGTTGCACAACAGTAGG + Intronic
941778204 2:169415452-169415474 GGTGATGTCAGTTCAGCTTTTGG - Intergenic
942247087 2:174017924-174017946 GGTGATGATTGTACATCATTAGG + Intergenic
943498313 2:188652609-188652631 GGTGGTGGCTGTTCAGCTTATGG + Intergenic
944200450 2:197101506-197101528 AGTGATGGTTGTACAACAGTAGG + Intronic
947534901 2:230934299-230934321 GGTGCTCGTTCCACAGCTTTTGG - Intronic
948192412 2:236070134-236070156 GGTCATGGCTGCACAGCTTTCGG - Intronic
948448506 2:238052799-238052821 GGTGATGGTTGCACAACCTTGGG + Intronic
1171949941 20:31412531-31412553 GGTGATGCTTGTAAAGCTCAGGG + Intronic
1172955991 20:38759607-38759629 AGAGATGATTGTAAAGCTTTGGG - Intronic
1174038696 20:47684066-47684088 GGTGATGGTTATACAACTCTGGG + Intronic
1176155241 20:63616711-63616733 GGTGAGGGTGGGACATCTTTTGG - Intronic
1177543336 21:22523939-22523961 GTTGCTGGTTTTATAGCTTTAGG - Intergenic
1178574436 21:33772443-33772465 GACGATGGTTGCACAACTTTGGG - Intronic
1179815441 21:43903329-43903351 GGTGATGATTGCACAGCAGTGGG + Intronic
1180134152 21:45850299-45850321 GGTTGTGGTTGAACACCTTTGGG + Intronic
1180726825 22:17952571-17952593 GGTGTTTGTTTTATAGCTTTTGG - Intronic
1181265133 22:21626666-21626688 GCAGCTGGTTGTGCAGCTTTAGG - Intergenic
1181828581 22:25540189-25540211 GGTGCTGGTTCTACTACTTTGGG + Intergenic
949324610 3:2849336-2849358 GGTGATAGTTGCACAACATTGGG + Intronic
950090700 3:10292206-10292228 CCTGATGGCTGTATAGCTTTGGG - Intronic
952866581 3:37859599-37859621 GGATATGGTTCTACAGTTTTTGG - Intergenic
954356522 3:50086527-50086549 GGTGCTTGTTGAACTGCTTTGGG + Intronic
954495135 3:50951284-50951306 GTTGATGGATGTACAAATTTGGG + Intronic
955167737 3:56530856-56530878 GGTGATGGTTGCACAATATTGGG + Intergenic
956854737 3:73264759-73264781 GGTCATGGTGGATCAGCTTTCGG - Intergenic
956951634 3:74290467-74290489 GGTGGTTGTTGAACAGCTTAAGG - Intronic
957411138 3:79841745-79841767 GCTGATGGTTGTAAAGTTTGTGG + Intergenic
960717009 3:120585856-120585878 GGTGAGTGTAGTATAGCTTTTGG - Intergenic
961525122 3:127491876-127491898 GGTGATGGTAGTACAACAATGGG + Intergenic
963057789 3:141201552-141201574 GGAGATGTTTATACAGGTTTAGG + Intergenic
964753052 3:160069586-160069608 GCTTATGTTTTTACAGCTTTGGG + Intergenic
964883401 3:161450389-161450411 GGTGATGGTTGCACAGCTCGTGG - Intergenic
966406918 3:179607648-179607670 GGTGATGGTTGCATAGCATTAGG - Intronic
968020733 3:195386308-195386330 GGTGATAGTTGTACAACACTGGG + Intronic
968526982 4:1064710-1064732 TGTGATGGTTGCACAGCATCAGG - Intronic
969414297 4:7048649-7048671 GGTGATGGCTGTACAACACTGGG - Intronic
970010332 4:11451778-11451800 GCTGAGTGTTGTTCAGCTTTGGG + Intergenic
970492283 4:16586425-16586447 GGTGGTGTTTTTACAGCTTGGGG + Intronic
971910841 4:32795475-32795497 GGTGCTAGCTGTGCAGCTTTGGG - Intergenic
976304445 4:83545911-83545933 GGTGATTGTGGTACATGTTTTGG + Intronic
977563366 4:98556230-98556252 GATGATTGTTATACAACTTTAGG + Intronic
977577185 4:98687591-98687613 GGTGATGATTGTACATATCTGGG - Intergenic
979032988 4:115676228-115676250 TCTGATGTTTGTACAGCTTTAGG + Intergenic
979507816 4:121518157-121518179 GATGATGGTTGCACAACTGTGGG - Intergenic
979524347 4:121701751-121701773 GGTGACGGTTTTACAGTTGTTGG - Intergenic
979837537 4:125390422-125390444 CGTGATGGTTGTACTGATATTGG + Intronic
981771322 4:148311889-148311911 GGAGATAGTTGTACAACTTCTGG - Intronic
984757821 4:183340311-183340333 GGTGATGATTGCACAGCTCTGGG - Intergenic
985479992 5:103598-103620 TGTGATAGTTGTACATATTTTGG + Intergenic
989397507 5:40974129-40974151 GGTGATGGTTGCACAACAATGGG - Intronic
989705604 5:44326742-44326764 GGTGCTGGTAGTACAGCATCAGG - Intronic
990134863 5:52632708-52632730 GGTGATGGCTGCACAACTTTTGG + Intergenic
990540366 5:56766445-56766467 GGTGGTGGTTGTACAACAATGGG - Intergenic
990543117 5:56794186-56794208 GGTGATGGTTGTGCAATTCTGGG - Intergenic
990863722 5:60356994-60357016 GGTGATGTTTTTACAGGTTAGGG + Intronic
992838027 5:80659312-80659334 GATGATGGTTGCACAACTCTGGG - Intronic
993113982 5:83696957-83696979 GGTAATGGTTGCACAACTTGAGG - Intronic
993306176 5:86278296-86278318 GGTGATGGTTGCAAAACCTTTGG + Intergenic
997843297 5:137262317-137262339 AGTGTTGGTTGTACAGCATCAGG + Intronic
997999623 5:138614607-138614629 GCTGATGTTTGGACATCTTTGGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998568337 5:143235727-143235749 TGGGATGGTTGAACAGGTTTGGG - Intergenic
999958897 5:156732885-156732907 TGTGATGGTTGTATTTCTTTGGG + Intronic
1001176349 5:169472377-169472399 GGTGACCGTTTTTCAGCTTTTGG - Intergenic
1004361831 6:14978123-14978145 GGTGATAGTTGCACAACTTTGGG - Intergenic
1004445175 6:15691434-15691456 GGTGATGGTTCTGCAGCCTCAGG - Intergenic
1005174761 6:23032115-23032137 GGTGATGGTTGCACAACATTGGG + Intergenic
1005880183 6:30051381-30051403 AGTGATGGTTGCACATATTTGGG + Intergenic
1006593401 6:35174774-35174796 GGTGATAGTTGCACAACTTTGGG + Intergenic
1007047761 6:38795175-38795197 TGTGATGGTTATACAACATTGGG - Intronic
1010370885 6:75105954-75105976 GGTGATGGATTTGAAGCTTTTGG - Intronic
1012049704 6:94325898-94325920 TCTGATGTTTGTATAGCTTTAGG - Intergenic
1013179501 6:107706329-107706351 GGTTATGCTTGGACAGATTTGGG - Intronic
1014788365 6:125643792-125643814 GGTGATGGTTGTATAGCCTTGGG + Intergenic
1017297465 6:152815122-152815144 GGTGATGGTTAAACATGTTTTGG - Intergenic
1020436671 7:8170959-8170981 GGTGATGATTACACAGCTCTGGG - Intronic
1025185357 7:56853619-56853641 GGTGATCGATGTACAGCTCTGGG + Intergenic
1025686574 7:63723340-63723362 GGTGATCGATGTACAGCTCTGGG - Intergenic
1027472137 7:78586640-78586662 GGTGATGGTTGCACAACAATGGG - Intronic
1028249011 7:88517711-88517733 GATGATGGCTGTACGGTTTTAGG + Intergenic
1028877438 7:95839584-95839606 GGTGGTGGGTAAACAGCTTTTGG - Intronic
1029235915 7:99118714-99118736 GGTGATGGTTGTACAACACTGGG + Intronic
1029470968 7:100753887-100753909 GATGATGGTTGCACAACCTTAGG - Intronic
1032503826 7:132420645-132420667 GGTGATGGTTGCACAACAATGGG - Intronic
1033030882 7:137825227-137825249 TGTGAGGGTTGGCCAGCTTTTGG - Intronic
1041064700 8:54070925-54070947 GGTGATGGTTGCAAAACTTACGG + Intronic
1041101978 8:54405294-54405316 GGTGATGGTTGCACATCATCAGG + Intergenic
1041336674 8:56793194-56793216 GGTGATGGCTGTCCAACTCTGGG + Intergenic
1041899153 8:62961914-62961936 TCTGATGTTTGTACAGCTTTAGG + Intronic
1044513145 8:93107417-93107439 GGTGATGATTGCACAACGTTGGG + Intergenic
1045944250 8:107777549-107777571 GGTGATGGTTGCATAACTGTGGG - Intergenic
1046140101 8:110080261-110080283 GGTGATGCTTTCACAGCTTTAGG - Intergenic
1046531939 8:115457535-115457557 GGTGATGGTTGCACAACATTAGG + Intronic
1049935931 9:502257-502279 GGTGATGGTTGTGTGACTTTGGG + Intronic
1050895742 9:10884815-10884837 TGCGATGATTGTATAGCTTTCGG - Intergenic
1051222308 9:14862573-14862595 CATGATGGTTGTACAACCTTGGG - Intronic
1051789803 9:20788380-20788402 GATGATGGTTGCACAGCTCTAGG + Intronic
1052481811 9:29039074-29039096 GCCGCTGGTTGTACAGCTGTTGG - Intergenic
1053030737 9:34775463-34775485 GGTGATGGTTGTACAGCAGTGGG + Intergenic
1056568721 9:87797589-87797611 GGTGATGGTGGCACAGCAATGGG - Intergenic
1056855066 9:90120222-90120244 GGTGAAGGTTGTGCAAATTTTGG - Intergenic
1057070744 9:92097742-92097764 GGTGATAGTTGTATAACTCTGGG + Intronic
1058043177 9:100327251-100327273 GGTGATAGTTGCACAACCTTAGG + Intronic
1058191844 9:101926721-101926743 GGTGATGCTTGCACAACTCTGGG - Intergenic
1058928670 9:109696128-109696150 TGTGATAGTTGTACATATTTTGG - Intronic
1058992346 9:110266693-110266715 GGTGATAGTTGCATAACTTTGGG + Intergenic
1059129287 9:111728742-111728764 GGTGATGATTGCACAACTCTGGG + Intronic
1059166104 9:112077916-112077938 GGTGTTGGTTGTATAGCTTCTGG - Intronic
1061230164 9:129311218-129311240 GGTGATGGTTTTGGAGATTTGGG + Intergenic
1061948917 9:133925126-133925148 GGGGATGGTTGTACAACACTGGG + Intronic
1062140171 9:134951893-134951915 GCTGATGGTTGCACAGCTCGTGG - Intergenic
1062729718 9:138102129-138102151 GGTTTTGGCTGTACAGCTTCAGG + Intronic
1185808069 X:3078847-3078869 GGTGATGGTTGTACAATATTGGG - Intronic
1185944522 X:4359991-4360013 GGTGATTGTTGTATACCATTGGG + Intergenic
1186501747 X:10056437-10056459 GGTGATGGCTGTACAACCTTGGG - Intronic
1187546233 X:20255406-20255428 GGTGATGGCTGCACAACCTTGGG + Intronic
1187910333 X:24105400-24105422 GGTGGTGGTTGCATAACTTTGGG - Intergenic
1189136682 X:38557808-38557830 GGTGATGGTTGTGCAACAGTGGG - Intronic
1190427485 X:50346435-50346457 GGTGGTGGTGGTACAGTTTTGGG + Intronic
1190452188 X:50593473-50593495 AGTGTTGGTTGTACAGCTGTTGG - Exonic
1192522074 X:71811343-71811365 GGTGACGGTTGTACAGCAATGGG - Intergenic
1192524142 X:71827118-71827140 GGTGATGGTTGCACAGCAATGGG + Intergenic
1192938874 X:75892225-75892247 GGTGATATCTGTCCAGCTTTTGG + Intergenic
1193787354 X:85775425-85775447 GGTGATGGTTGCACAACAATGGG - Intergenic
1195474280 X:105266401-105266423 ACTGATGTTTGTACAGCATTCGG + Intronic
1195805433 X:108760336-108760358 GGTGATGGTTGTACAGCTCTGGG - Intergenic
1197322425 X:125049157-125049179 GGTAATGGTTGCACAGTTCTGGG - Intergenic
1197359964 X:125489038-125489060 GGAAATGATTCTACAGCTTTTGG + Intergenic
1197752100 X:129971804-129971826 GGTAGTGGTTGTACAGCACTGGG + Intergenic
1197799354 X:130333498-130333520 GGTGATGGTTGCACAACATTGGG + Intergenic
1198447898 X:136736930-136736952 GGTGAGGGTTGTATGGCTTTGGG + Intronic
1198812239 X:140547584-140547606 GGGGAAGGATGGACAGCTTTGGG + Intergenic