ID: 1143755918

View in Genome Browser
Species Human (GRCh38)
Location 17:9067512-9067534
Sequence CTGTGTAAATTAATGTATCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143755918 Original CRISPR CTGTGTAAATTAATGTATCC CGG (reversed) Intronic
905073036 1:35244634-35244656 CTGTGTAAAGTCATGTACACAGG + Intergenic
906268460 1:44454347-44454369 ATTTGTAAATTTATGTATACTGG + Intronic
906320989 1:44815348-44815370 TTGTATAAATTCATTTATCCTGG + Intronic
908432055 1:64068570-64068592 CTTTATAAATTAAGGTATCATGG - Intronic
909218348 1:72921106-72921128 GTTTGTAAATTAATGAAGCCAGG - Intergenic
910047037 1:82930351-82930373 CTGTGATAATTAAGATATCCAGG + Intergenic
911761492 1:101622361-101622383 CTGTGAAAAATAATGTATCAAGG + Intergenic
917900943 1:179542802-179542824 CTGTGTAAATTACTGTTTGCAGG - Intronic
918916832 1:190651985-190652007 CTGTCTAATTTAATGTAACAAGG - Intergenic
1070303529 10:75223462-75223484 CTGTGTCATTTAATGACTCCTGG + Intronic
1071404168 10:85313108-85313130 ATCTGTAAATGAATATATCCAGG + Intergenic
1072050040 10:91694269-91694291 CTGTGTACATTCAGGTGTCCAGG + Intergenic
1073982416 10:109169556-109169578 CTGTGTAAGTTAATGTAAGTTGG - Intergenic
1075507806 10:123040585-123040607 GTGTGTTAATTAATGTGTTCTGG - Exonic
1077931223 11:6734991-6735013 CTGTATAAATTACTGTGTCTTGG + Intergenic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1082570993 11:54739951-54739973 CTTTATAAATTAATGAATCTGGG + Intergenic
1082758075 11:57097673-57097695 CTGTTTAATTTAATTAATCCTGG - Intergenic
1085720943 11:78911939-78911961 ATGTGTAAATTGTTGTATCCTGG - Intronic
1088024200 11:105157871-105157893 CTGTGTATCCTAATGAATCCAGG - Intergenic
1088774089 11:113065266-113065288 CTGAATAAATTAATTTATTCAGG + Intronic
1092605945 12:10119067-10119089 CTGTATATTTTAATGTATCCTGG + Intronic
1094659754 12:32457674-32457696 ATGTGTAAATAAATGTTTACTGG + Intronic
1095414046 12:41955885-41955907 ATGTGTAAATTAGTTTATTCTGG + Intergenic
1095659138 12:44708751-44708773 CTGTGAAAAATAATTTATCAGGG + Intronic
1097860110 12:64510362-64510384 CTGTGTAGATTAATGGATTGTGG + Intergenic
1098865344 12:75756159-75756181 GTGTGTAAATTAATGTCTCATGG - Intergenic
1104256095 12:127140255-127140277 CTCTAAAAATTAATGAATCCAGG - Intergenic
1105570402 13:21597361-21597383 GTGTGTAATTTAATATATCTGGG + Intronic
1105707749 13:22978892-22978914 CTGTGTGACTGAAGGTATCCAGG + Intergenic
1106888650 13:34218055-34218077 CTCTGTAAATTAATTGTTCCAGG + Intergenic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1110100255 13:71591792-71591814 TTTAGTAAATTAATGTAACCTGG - Intronic
1111212066 13:85092284-85092306 CTGGGTAAATTAATATGTCGTGG - Intergenic
1112068453 13:95820295-95820317 CTGTGGAAATTAATCTGTTCAGG - Intronic
1113862224 13:113494550-113494572 CAATGTATATTAATTTATCCTGG - Intronic
1114403771 14:22434887-22434909 CTGAGTTAATTACTGTATCTAGG - Intergenic
1115080150 14:29440715-29440737 GTGTGAAAATTAAAGGATCCAGG + Intergenic
1115592535 14:34878170-34878192 CAATGTAAATAAATGTATCCTGG + Intergenic
1115807655 14:37070084-37070106 CTGGGTAATTTAACGAATCCAGG + Intronic
1115840800 14:37468375-37468397 CTTCATGAATTAATGTATCCTGG - Intronic
1115887794 14:37993226-37993248 GTATATAAATTAATGTATCCAGG + Intronic
1116473523 14:45313082-45313104 CAGTTTAAATTAGGGTATCCTGG + Intergenic
1118908514 14:70041837-70041859 GTGTGTCAATTAAGGTAGCCAGG + Intergenic
1119314830 14:73684541-73684563 CTGTATAAAGTAATGAATCCAGG - Intronic
1122038205 14:98963681-98963703 CTGTGTGAATTGCTGTATGCAGG - Intergenic
1124242869 15:28045726-28045748 CTCTGTAAAATACTGTAGCCTGG - Intronic
1125819614 15:42617556-42617578 CTGTGTATATTTATGTACACAGG - Intronic
1129143048 15:73619561-73619583 CTTTTAACATTAATGTATCCAGG - Intronic
1130361365 15:83189590-83189612 ATATGTAATTTAATGTAGCCAGG - Intronic
1133703949 16:8335517-8335539 ATGTTTAAATTTATGTATCAAGG + Intergenic
1134826058 16:17285335-17285357 GTGTGTAATTTAAAGCATCCCGG + Intronic
1135151876 16:20014693-20014715 ATGTTTAAATAAATGTATCATGG + Intergenic
1135338614 16:21627227-21627249 CTGTGTAGATTCATGAATGCTGG + Intronic
1138075109 16:54034530-54034552 CTGTGTACAGTAGTGTGTCCTGG + Intronic
1143755918 17:9067512-9067534 CTGTGTAAATTAATGTATCCCGG - Intronic
1147208270 17:38854608-38854630 GTATGTGAATTAATGTATCGTGG - Intergenic
1148208953 17:45796610-45796632 CTGGGTAAGTTACTGTCTCCGGG + Intronic
1149472471 17:56928960-56928982 CTATTTAAAAAAATGTATCCTGG + Intergenic
1150437125 17:65162767-65162789 TTGTAAAAATAAATGTATCCCGG - Intronic
1150455807 17:65305512-65305534 CTGAATAAATGAATGTCTCCAGG - Intergenic
1150846503 17:68664129-68664151 AAGTGTAATTTAATGTAACCTGG - Intergenic
1155195183 18:23467577-23467599 CTGTGTAAATTCATTAATCTTGG - Intronic
1156286554 18:35701936-35701958 CTATGTAAGACAATGTATCCAGG - Intronic
1165549375 19:36570891-36570913 ATGTCCATATTAATGTATCCAGG + Intronic
1166404151 19:42507379-42507401 CTGTGTTATTTAATTTTTCCTGG - Exonic
1167287414 19:48606441-48606463 CTGGGGAAAGTGATGTATCCAGG - Intronic
926323618 2:11765904-11765926 CTGTGTAAATTAAAGTGCCGTGG + Intronic
926445177 2:12932742-12932764 CTGTGTAATGTAGTATATCCTGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929370478 2:41218141-41218163 CTATTTAAATTAATATATCCAGG + Intergenic
929611123 2:43271311-43271333 CTGTTTGAATTAATGTCTCTAGG + Intronic
930261194 2:49148274-49148296 CTGTATAAATTAATGGATTCTGG + Intronic
930807486 2:55505580-55505602 TTTTTTAAATTAATGTAGCCAGG - Intergenic
932587904 2:73043653-73043675 CTTTGGAAATGAACGTATCCGGG - Intronic
937948336 2:127363013-127363035 CTGTGTAAATTATTGTTACACGG - Intronic
943159801 2:184232910-184232932 CTTCAAAAATTAATGTATCCAGG - Intergenic
943199713 2:184804721-184804743 GTGAGTAGTTTAATGTATCCAGG + Intronic
944380172 2:199099916-199099938 ATGTGAAGATTAATATATCCTGG - Intergenic
944448354 2:199815379-199815401 CTGTGCAAATTAATTTGTCCTGG + Intronic
947816251 2:233039553-233039575 CTGTTTTACTAAATGTATCCTGG - Intergenic
1170992167 20:21312902-21312924 CTGTGTTATTTAATTTATCTAGG - Intronic
1183583834 22:38740753-38740775 CTGTGTCTATAAATGAATCCCGG + Intronic
949606691 3:5661282-5661304 GTGTGTAAATTAATATATGCTGG + Intergenic
951427673 3:22566665-22566687 CTGTGTTAATTAACCTCTCCAGG + Intergenic
952451401 3:33437198-33437220 TTGTGTAAAATAATGTAGGCTGG - Intronic
952455831 3:33471127-33471149 CTGTGTGTATTAATATATTCAGG + Intergenic
956488464 3:69746346-69746368 CAGTGTAAAAAAATGTATCTTGG + Intronic
957747390 3:84363230-84363252 CTTTAAAAATTAATGAATCCAGG - Intergenic
958218421 3:90625363-90625385 CTTCAAAAATTAATGTATCCAGG + Intergenic
958896018 3:99830374-99830396 TTCTGTAGATGAATGTATCCAGG + Intronic
959304785 3:104648337-104648359 CTGAGTAAATTCAAATATCCTGG + Intergenic
960017572 3:112909682-112909704 CTGTTTTAATTACTGTAGCCTGG + Intergenic
960027262 3:113023407-113023429 CAGTGAAAATTAATGTGTTCAGG + Intergenic
960354978 3:116640478-116640500 GTGTGTAAATTAATGTGTGTAGG - Intronic
965371412 3:167866748-167866770 GTTTGTACATTAATGTATCCTGG - Intergenic
967763805 3:193255320-193255342 CTGTGTAAGTTATATTATCCAGG + Intronic
970777528 4:19693969-19693991 ATTTGTAAATTAAAGTATTCTGG - Intergenic
972150459 4:36083104-36083126 CTGTGTAAAGTAAGAAATCCCGG - Intronic
976101815 4:81572330-81572352 ATATGAAAAATAATGTATCCTGG - Intronic
977347568 4:95836903-95836925 CTCTTTGAATTAATCTATCCTGG + Intergenic
978566617 4:110089434-110089456 CTGTGCAAATTTTAGTATCCTGG + Intronic
980676100 4:136083614-136083636 CTGTGTAAATATCTGTATCAAGG + Intergenic
981510485 4:145551801-145551823 CAGTGTAAATTGATGCATTCTGG + Intronic
981808378 4:148744387-148744409 CTCAGTAAAATACTGTATCCAGG + Intergenic
982329621 4:154166536-154166558 CTATGTAAATTAATGTTGTCTGG - Intergenic
984551685 4:181167995-181168017 ATGTGTAAATTACAGTATTCTGG + Intergenic
985158055 4:187013762-187013784 CTGTTTATATTAATGTAACAAGG + Intergenic
986089141 5:4486500-4486522 CTGTGAAAATAAATTTATACTGG - Intergenic
986156570 5:5182542-5182564 CTGTGTCATTTAATCTACCCAGG - Intronic
987432475 5:17853032-17853054 CTGTAGAAATTAAAGTTTCCAGG + Intergenic
987628283 5:20432041-20432063 CTGTGTCATTTAATGGTTCCAGG - Intronic
989173185 5:38493979-38494001 CTGTGTTAATCTATGTATACAGG - Intronic
990363605 5:55047092-55047114 CTGAATAAATTGATGAATCCAGG + Intergenic
994885503 5:105556141-105556163 CTGTATATATTAATGTAGTCAGG + Intergenic
999032192 5:148306372-148306394 CTGTATAAATTAGTGTACCATGG + Intergenic
999508976 5:152227839-152227861 CTGAGTAAATTAGTCTATCCAGG + Intergenic
999851098 5:155540290-155540312 CAGGGTAAATTATTGTATTCTGG + Intergenic
1000170505 5:158698435-158698457 CTGTGTAAATAAATGCAGCCTGG - Exonic
1000691446 5:164326692-164326714 CTGAGTAAATCATTGTACCCAGG - Intergenic
1004511991 6:16290709-16290731 CTGTGTATATTAAAGTACCGTGG + Intronic
1004841014 6:19585335-19585357 CTGTGTGAATTAGTCTATTCAGG - Intergenic
1005058322 6:21752100-21752122 CTGTGGACATTCTTGTATCCTGG + Intergenic
1006748664 6:36363067-36363089 CTGTCGAAATGAATTTATCCAGG - Intronic
1008247692 6:49198848-49198870 CTGTGCAAATAAATCTATCAGGG - Intergenic
1008292473 6:49734128-49734150 ATGTGTAAATAAATGAATCCAGG - Intronic
1008459722 6:51754008-51754030 CTGTCTAAATCAATGTTCCCAGG - Intronic
1011393104 6:86876006-86876028 CTTTAAAAATTAATGAATCCAGG + Intergenic
1014425795 6:121304174-121304196 CTATGTGAATTACTGTATACAGG - Intronic
1015683062 6:135829379-135829401 CATTGAAAATTAATGTATTCAGG + Intergenic
1022506898 7:30913194-30913216 CTGTGGAAAAGAATGTCTCCTGG + Intronic
1023627947 7:42135454-42135476 CTGTATAAAGTAATGTTTCAGGG - Intronic
1024808118 7:53172553-53172575 CTGCTTAAATTTATATATCCAGG + Intergenic
1025876509 7:65485024-65485046 CTGTTTTAGTTACTGTATCCTGG - Intergenic
1030434859 7:109503733-109503755 CTTTGTAAATTAACTTATCTAGG + Intergenic
1031753327 7:125605880-125605902 ATATGTGAATTAATGGATCCTGG - Intergenic
1034065667 7:148134374-148134396 ATGTTTAAACTAATGTATACAGG - Intronic
1037210898 8:16386109-16386131 CTGTTTAAATTACTGTAACTTGG + Intronic
1038776177 8:30532883-30532905 CTGTTTAACTGAATGTATCCTGG - Intronic
1043100311 8:76037049-76037071 TTGTGTAAATTGATTTCTCCTGG - Intergenic
1043288208 8:78561804-78561826 ATGTGTAAATTCATGTAACATGG + Intronic
1044083705 8:87917048-87917070 CTGTGGAAATGAATTTATCATGG - Intergenic
1045162252 8:99561259-99561281 CTGTATGAATTTATGTATTCTGG + Intronic
1045951791 8:107859968-107859990 CTGTGAAAAATAAGATATCCAGG + Intergenic
1046273692 8:111928821-111928843 CTGTGTAAGTGTATTTATCCTGG - Intergenic
1046921801 8:119738356-119738378 CTGTGTAAATGTTTGTATCAAGG - Intronic
1047320459 8:123775664-123775686 CTGAGAAAATTAATGTATTTAGG + Intronic
1047662350 8:127051285-127051307 CTGCATAAATAAATGTAACCTGG + Intergenic
1048595447 8:135861164-135861186 CTGTGTAAAGCAAAGTGTCCAGG + Intergenic
1048729037 8:137417801-137417823 CTTTGTAAATTACTATATCGTGG - Intergenic
1049409904 8:142468274-142468296 CGGTGTGAATGTATGTATCCAGG + Intronic
1052034252 9:23662153-23662175 CTGTGTTATTCACTGTATCCTGG + Intergenic
1052895185 9:33741070-33741092 CTGTGTTTTTTATTGTATCCAGG - Intergenic
1055832978 9:80404959-80404981 AGGTGAAACTTAATGTATCCTGG + Intergenic
1056025231 9:82487395-82487417 ATGTGTAAATTTATTTATCTAGG - Intergenic
1056112913 9:83413585-83413607 CTGTGAAAATTACTGTAATCTGG + Intronic
1058398108 9:104579556-104579578 CTGAATAATTTAATGTATTCTGG - Intergenic
1062154758 9:135040839-135040861 CTGAGTAAAATAATGCATTCAGG + Intergenic
1189954759 X:46266158-46266180 ATATGTTAATTAATGTATACAGG - Intergenic
1196424285 X:115554553-115554575 CTGTCAAAATTACTGTAACCTGG + Intergenic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1197685787 X:129438241-129438263 ATGACTAAATTAATGTATCTGGG - Intergenic
1198782000 X:140247921-140247943 CTGTGTCATTTAAGATATCCTGG - Intergenic
1198972306 X:142296021-142296043 CTGAGTAAATTAATACATCATGG + Intergenic
1199195849 X:145029546-145029568 CTGTGTTAATTAATGTATTTTGG - Intergenic
1199343755 X:146714014-146714036 CTGTGAAAATAAATGTAACACGG - Intergenic
1202365883 Y:24164394-24164416 CTGTGGCAGTAAATGTATCCTGG + Intergenic
1202504899 Y:25505728-25505750 CTGTGGCAGTAAATGTATCCTGG - Intergenic