ID: 1143756522

View in Genome Browser
Species Human (GRCh38)
Location 17:9071862-9071884
Sequence TGCAGTATGAATGGAGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143756515_1143756522 2 Left 1143756515 17:9071837-9071859 CCTAAAGACACTCTGAGTCCCAG 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 276
1143756511_1143756522 27 Left 1143756511 17:9071812-9071834 CCAGGGTTTCTTTCCCTCCAGAA 0: 1
1: 0
2: 3
3: 35
4: 283
Right 1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 276
1143756514_1143756522 10 Left 1143756514 17:9071829-9071851 CCAGAATTCCTAAAGACACTCTG 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 276
1143756513_1143756522 13 Left 1143756513 17:9071826-9071848 CCTCCAGAATTCCTAAAGACACT 0: 1
1: 0
2: 2
3: 10
4: 186
Right 1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 276
1143756510_1143756522 28 Left 1143756510 17:9071811-9071833 CCCAGGGTTTCTTTCCCTCCAGA 0: 1
1: 0
2: 2
3: 21
4: 274
Right 1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 276
1143756512_1143756522 14 Left 1143756512 17:9071825-9071847 CCCTCCAGAATTCCTAAAGACAC 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143756522 Original CRISPR TGCAGTATGAATGGAGGCTG GGG Intronic
900514746 1:3076285-3076307 TGCTGGATGAAGGGAGGGTGTGG + Intronic
900831214 1:4967105-4967127 AGCAGTGGGAATGGAGGTTGGGG - Intergenic
901973584 1:12927239-12927261 TGCTTCTTGAATGGAGGCTGAGG + Intronic
902011594 1:13274528-13274550 TGCTTCTTGAATGGAGGCTGAGG - Intergenic
902797323 1:18808060-18808082 TCCCCTGTGAATGGAGGCTGGGG - Intergenic
904219664 1:28955804-28955826 TACAGTATATATGCAGGCTGTGG - Intronic
904324852 1:29721782-29721804 TGCCCCATGACTGGAGGCTGGGG + Intergenic
904958482 1:34309915-34309937 TTCAGTATGGATGTTGGCTGTGG - Intergenic
906808113 1:48799607-48799629 TTCAGTATAAATGTTGGCTGTGG + Intronic
907786413 1:57617300-57617322 TGCAGTGTGAATTGAGGCAGGGG - Intronic
908605346 1:65792422-65792444 GGGATTATGAATGGGGGCTGGGG + Intergenic
908874338 1:68653354-68653376 TGCAGTAAGAATGGACTCAGTGG + Intergenic
910356214 1:86359370-86359392 TGAGGTAGGAATGGAGGTTGTGG - Intronic
912651452 1:111443181-111443203 TGAATTATGAATTGAGGGTGGGG - Intronic
913505232 1:119510832-119510854 GGGAGGATAAATGGAGGCTGGGG - Intronic
916166181 1:161969207-161969229 AGCAGCAGGGATGGAGGCTGTGG - Intergenic
917488909 1:175480750-175480772 GGCAGTATGAATAGTGGCTTTGG - Intronic
918237163 1:182591877-182591899 TTCAGTAAGAATGGGGGCAGGGG - Intergenic
918591688 1:186247708-186247730 TTCAGCATGGAAGGAGGCTGGGG + Intergenic
918971013 1:191419021-191419043 TGAAGAATAAATGGACGCTGAGG - Intergenic
919468020 1:197945689-197945711 TGAAGTGGGAATGGAGGCTCTGG + Intergenic
920242427 1:204562715-204562737 TGCTGTATGGCTGGAGGCTCTGG - Intergenic
920251333 1:204624325-204624347 TGCCTTCTGAATGGGGGCTGGGG + Intronic
922103536 1:222493347-222493369 TCCAGAATTTATGGAGGCTGAGG + Intergenic
922263849 1:223965861-223965883 TCCAGAATTTATGGAGGCTGAGG + Intergenic
922991273 1:229914084-229914106 TGGAGTATGAATGGAGATTGTGG + Intergenic
923371160 1:233314644-233314666 TTCTGTATAAATGGAAGCTGTGG + Intergenic
923645605 1:235817563-235817585 AGCAATATGGATGGACGCTGAGG + Intronic
924951747 1:248890863-248890885 TGCAGTGTGATGGGGGGCTGTGG - Intergenic
1064271472 10:13870108-13870130 TGCAGTCTGAACAGAGGCAGAGG + Intronic
1065786826 10:29223641-29223663 TGATTTATTAATGGAGGCTGGGG + Intergenic
1066078544 10:31906177-31906199 TGCAGTCCTAATGAAGGCTGGGG - Intronic
1066212994 10:33258042-33258064 TGCAGTTTGGATGCAGGATGCGG + Intronic
1067053566 10:43038752-43038774 TGCAGCATCCCTGGAGGCTGTGG + Intergenic
1067121237 10:43473907-43473929 TGCAGTATTTTGGGAGGCTGAGG + Intronic
1067750770 10:48969712-48969734 TGGAGTAGGAATGGGGCCTGAGG - Intronic
1068605381 10:58999561-58999583 TGCAGTCTGATAGGAGGATGGGG + Intergenic
1069611530 10:69775822-69775844 TGAAGGATGCATGGAAGCTGGGG + Intergenic
1069621799 10:69841823-69841845 TGCAGTGGGAAGGGAGGATGAGG + Intronic
1069678654 10:70267760-70267782 TGGAGGCTCAATGGAGGCTGGGG + Intronic
1070414371 10:76175838-76175860 TGCAGTGTGAATGGAGACCTGGG + Intronic
1072347782 10:94525542-94525564 TGCAGTAAGTCAGGAGGCTGAGG + Intronic
1075214613 10:120521076-120521098 TACAGGAGGAATGGATGCTGGGG - Exonic
1076022852 10:127088935-127088957 TGCACTAAGTAGGGAGGCTGGGG - Intronic
1076102911 10:127797440-127797462 TGAAGGATGGATGGAGGGTGAGG - Intergenic
1076102929 10:127797493-127797515 TGAGGGATGAATGGAGGGTGGGG - Intergenic
1076102974 10:127797637-127797659 TGCAGGATGGAGGGAGACTGTGG - Intergenic
1076378028 10:130004589-130004611 TGAAACATGAATGCAGGCTGTGG - Intergenic
1076540784 10:131213509-131213531 TGGAATCTGAACGGAGGCTGTGG - Intronic
1078254751 11:9648567-9648589 TGCTGCATGGATGAAGGCTGAGG - Intergenic
1078363090 11:10685194-10685216 AGCACTTTGAAAGGAGGCTGAGG + Intronic
1078478841 11:11658612-11658634 TATAGTTTGAATGGAGGGTGTGG - Intergenic
1078955995 11:16195871-16195893 TGCAGTGTATATGTAGGCTGAGG + Intronic
1079398643 11:20087328-20087350 TCCAGTGTGCATGGATGCTGTGG - Intronic
1079486745 11:20942850-20942872 TCCATTTTGAATGGAAGCTGTGG + Intronic
1081759233 11:45565414-45565436 AGCAGTGTGAATGGAGCCGGGGG - Intergenic
1083040279 11:59679365-59679387 TGCAGTCTGAATGTTGGCTGGGG + Intergenic
1083638636 11:64133624-64133646 TGCACTGGGAAGGGAGGCTGGGG - Intronic
1084954812 11:72685519-72685541 TGCAGTCAGGATGGAGGATGTGG + Exonic
1085336525 11:75700981-75701003 TGGGGAATGAATGGAGGCTATGG - Intergenic
1086137770 11:83459598-83459620 TGCAGTATGAAGGAAGGCTTTGG - Exonic
1090462689 11:126906077-126906099 TGCAGTGTGATTGGAGCCTGGGG - Intronic
1090765654 11:129873943-129873965 TGCAGTCTGGCTGGAAGCTGGGG + Exonic
1090824420 11:130374255-130374277 CGCAGTGGGAATGGAGGGTGTGG + Intergenic
1091556058 12:1574374-1574396 AGCGGTGTGGATGGAGGCTGGGG + Intronic
1091556099 12:1574496-1574518 AGCGGTGTGGATGGAGGCTGGGG + Intronic
1092640203 12:10498423-10498445 TGCAGAATGAATAGATGCTCTGG - Intergenic
1093386743 12:18566283-18566305 AGCAGTATGATTGGAGTCAGAGG + Intronic
1094070043 12:26403007-26403029 TGCAGTATCACAGGATGCTGCGG + Intronic
1094255556 12:28421501-28421523 TGCAGCATGGATGGAGCCGGAGG - Intronic
1096495866 12:52038905-52038927 TGCTCTCTGGATGGAGGCTGTGG + Intronic
1099476504 12:83113903-83113925 TGCTGTGTGCATGAAGGCTGTGG + Intronic
1101734153 12:107450454-107450476 TGCAGAAAGAATGGGGGCTTGGG + Intronic
1101735146 12:107457846-107457868 TACAGTAAGAATGGAGACTTTGG + Intronic
1103289952 12:119837287-119837309 TCTAGTATGAATGGAGGCCATGG + Intronic
1103361335 12:120356131-120356153 TACAGAGTGACTGGAGGCTGTGG - Intronic
1104492896 12:129209741-129209763 TGCTGTTTGCAGGGAGGCTGAGG - Intronic
1105356146 13:19661810-19661832 TGCAGCATGAATGAGGGCGGTGG - Exonic
1105805070 13:23947765-23947787 GGCAGGGTGAAGGGAGGCTGAGG - Intergenic
1105810847 13:23993807-23993829 GGCAGTATTTATGCAGGCTGAGG + Intronic
1107401663 13:40075259-40075281 TGCAGGATGAATGGGCCCTGTGG - Intergenic
1108258913 13:48637687-48637709 TCCAGTGGGACTGGAGGCTGGGG + Intergenic
1109955754 13:69563654-69563676 AGCAGCATGAATGGAGGTGGAGG + Intergenic
1110517947 13:76438790-76438812 TCCAGTCTGAATGGAGGCTCGGG + Intergenic
1113076442 13:106472218-106472240 TGCAGTTTAAATGGAGCCTGGGG - Intergenic
1113508805 13:110835146-110835168 TGCCTTATGAATGGTGGCAGGGG - Intergenic
1114974617 14:28079205-28079227 TGCAGTATGAGTATATGCTGTGG - Intergenic
1115012037 14:28559891-28559913 TGGAGTGTGGATGGAGGATGTGG + Intergenic
1115012166 14:28562091-28562113 TGGTGTATGAATGCAGTCTGTGG + Intergenic
1115357844 14:32467810-32467832 TGCATCCTGAATGGAAGCTGAGG - Intronic
1116728636 14:48594116-48594138 TGTAGAATGAATTGAGGCTTTGG - Intergenic
1121197839 14:92090356-92090378 TCCAGCATGTAGGGAGGCTGAGG - Intronic
1121722682 14:96121745-96121767 TGCAGCTGTAATGGAGGCTGTGG - Intergenic
1125685724 15:41562123-41562145 TGCAGTAAGAGAGGAGACTGGGG - Intronic
1126021532 15:44406868-44406890 TGTATTATGAATTGAGGCTTTGG + Intronic
1126107306 15:45155110-45155132 TGCTGAATGAATGGATGCAGAGG - Intronic
1126182405 15:45798338-45798360 TCCAGCATTTATGGAGGCTGAGG - Intergenic
1127191471 15:56535634-56535656 TTTACCATGAATGGAGGCTGTGG - Intergenic
1128725546 15:69985831-69985853 GGAAGTAGGACTGGAGGCTGGGG + Intergenic
1129607249 15:77030945-77030967 TGCAGCCTGAAGGGAGGCTGGGG + Intronic
1134669170 16:16041844-16041866 TGCAGTACGTTGGGAGGCTGAGG + Intronic
1134867091 16:17618193-17618215 TCCTGTATGATTGGAGGCTGGGG - Intergenic
1135758567 16:25118229-25118251 TGTGGTATGAAGTGAGGCTGGGG - Intronic
1137006203 16:35276240-35276262 TGGAGTGTGTATGGAGTCTGAGG + Intergenic
1137011353 16:35323941-35323963 TGCAGCATTATGGGAGGCTGAGG + Intergenic
1137701022 16:50497780-50497802 TGCAGTATGACTAGCGGCGGGGG + Intergenic
1137807265 16:51319260-51319282 TCCAGTAGGAATGCAGGCCGAGG + Intergenic
1137912720 16:52394561-52394583 TACAGTATGAATGGATCTTGAGG + Intergenic
1139224255 16:65218657-65218679 CTCCATATGAATGGAGGCTGAGG - Intergenic
1139631543 16:68234702-68234724 TCCAGCAAGGATGGAGGCTGGGG - Intronic
1141021503 16:80501041-80501063 TGGAGCCTGATTGGAGGCTGTGG - Intergenic
1141348683 16:83272997-83273019 TGCAGTGTGACTGGTGCCTGTGG + Intronic
1141460658 16:84176888-84176910 TGCAGTATGAGGGGAGGCCCCGG - Intronic
1142492811 17:289630-289652 TGCCGTATGAAGTGAGGCGGTGG - Intronic
1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG + Intronic
1144220424 17:13094913-13094935 GGCCTTATGAATGGAGGGTGGGG + Intergenic
1147178631 17:38671934-38671956 TGAGGTATGAAGGGAAGCTGGGG - Exonic
1148750380 17:49942124-49942146 TGCAGGTTGAATGGAGGTGGTGG - Intergenic
1151163905 17:72188069-72188091 TGGAGTTTGAATTGAGGTTGGGG + Intergenic
1151328450 17:73392992-73393014 TGCAGCATGTTGGGAGGCTGAGG + Intronic
1151355101 17:73553626-73553648 TGCAGGTGGGATGGAGGCTGTGG - Intronic
1153756917 18:8293455-8293477 TTCTGTATGAGTTGAGGCTGTGG + Intronic
1154257632 18:12797846-12797868 TGTAGTCTTAAGGGAGGCTGAGG - Intronic
1155210524 18:23596672-23596694 TACTGTCTGAAGGGAGGCTGAGG - Intergenic
1155378004 18:25182725-25182747 TGCAGTTTGAATGAATACTGTGG + Intronic
1156696397 18:39773292-39773314 TACAATAGGAATGGAGACTGTGG - Intergenic
1161901204 19:7120889-7120911 TCCAGTAAGAATGGATTCTGAGG + Intronic
1162195497 19:8981304-8981326 TGCCGTATGTATGGAGGTTGGGG + Exonic
1163678349 19:18666622-18666644 TGGGGTCTCAATGGAGGCTGGGG + Intronic
1164933851 19:32196193-32196215 TGCCTGGTGAATGGAGGCTGTGG + Intergenic
1166104578 19:40590970-40590992 TGGAGGCTGAGTGGAGGCTGAGG - Exonic
1166763252 19:45237644-45237666 TGGAGTAGGAATGGGGACTGAGG + Intronic
1167153438 19:47723223-47723245 TGCTGTGTGTGTGGAGGCTGAGG - Intronic
1167586158 19:50376994-50377016 TGCAGTAGGAAGGGAGGAGGCGG + Intronic
1167648684 19:50718712-50718734 GGGAGAATGAATGGAGGCGGAGG + Intronic
926110549 2:10180444-10180466 TGCATAATGCATGAAGGCTGCGG + Intronic
927155295 2:20217800-20217822 AGCAGCAGGAATGAAGGCTGTGG - Intronic
928106787 2:28475672-28475694 TGCAGAATGAAGGGAGCTTGAGG - Intronic
928379313 2:30803990-30804012 TGCAGTATAAGGGAAGGCTGTGG - Intronic
928908322 2:36391835-36391857 TTTAGTATGAATAGAGGTTGTGG + Intronic
930191247 2:48462595-48462617 TCCAGTATGACAGGAGGCTTAGG + Intronic
930344126 2:50157142-50157164 TGCAATATGAATGGATATTGTGG + Intronic
933866471 2:86522734-86522756 TGCAGTGTGATTGGAGGCAGTGG - Intronic
935241823 2:101185473-101185495 TGCTGTATTAATTGTGGCTGAGG + Intronic
935565261 2:104599487-104599509 TGCATTAGAAATGGAAGCTGTGG + Intergenic
936578514 2:113675206-113675228 GGCAGCATGAATGAAGGCTGAGG - Intergenic
937545053 2:123005864-123005886 TGCAGTGCTAGTGGAGGCTGTGG - Intergenic
938209979 2:129459199-129459221 TTCAGTATAAATGCAGGGTGGGG + Intergenic
938837392 2:135119882-135119904 AGCATTATGAAGGGAAGCTGAGG + Intronic
939663574 2:144921113-144921135 TCAAGAATGAATTGAGGCTGAGG + Intergenic
940256540 2:151736885-151736907 TTCATTATGAATGGAGTTTGAGG - Intergenic
941028776 2:160488326-160488348 AGCACTTTGAAAGGAGGCTGAGG + Intronic
942848258 2:180452642-180452664 TGCATAATGAAGGGAGGCAGAGG + Intergenic
946153434 2:217791375-217791397 TGCAGTATGACTGGAGGAAGTGG + Intergenic
947408097 2:229802317-229802339 TGCAGCATGAGTGGCAGCTGTGG + Exonic
947861941 2:233366698-233366720 TGCTGCATGACTGGGGGCTGGGG - Intronic
949007659 2:241658866-241658888 CTCTCTATGAATGGAGGCTGGGG + Intronic
1169750152 20:8983548-8983570 TGGAAAATGAAGGGAGGCTGTGG + Intergenic
1170170287 20:13403364-13403386 TGCAGTGTAAATGGGGCCTGTGG + Intronic
1171196327 20:23202270-23202292 GCCAGTATGTATTGAGGCTGTGG + Intergenic
1172057519 20:32164878-32164900 AGAGGAATGAATGGAGGCTGAGG + Intronic
1174865043 20:54127722-54127744 TGCAGCATTAGTGGAGGTTGTGG + Intergenic
1175362533 20:58424713-58424735 TCCAGTATCAATGGAAGATGAGG - Intronic
1177361275 21:20075437-20075459 TGCAGTAGGAAGTGAGGATGAGG + Intergenic
1178799853 21:35783224-35783246 TGCAGTATGTATGGAGTTGGGGG - Intronic
1179071582 21:38076245-38076267 TGTAGTAGGAAGGGAAGCTGGGG + Intronic
1180650434 22:17371618-17371640 TGCAGTCAAAATGGTGGCTGTGG + Intronic
1181667186 22:24406436-24406458 AGCAGTCTGGAAGGAGGCTGAGG + Intronic
1181891412 22:26066888-26066910 AGGAGGATGAAAGGAGGCTGGGG + Intergenic
1182432495 22:30308262-30308284 TGCAGGCTGTGTGGAGGCTGAGG - Intronic
1182761616 22:32726832-32726854 GATAGTAAGAATGGAGGCTGAGG - Intronic
1183069206 22:35384507-35384529 TGCAGTGTGACTGGAGACAGTGG + Intronic
1183349477 22:37326871-37326893 AGCAGGATGAATGGGGGCAGGGG - Intergenic
1184246150 22:43236728-43236750 TTCAGTATGGCAGGAGGCTGGGG - Intronic
1184379700 22:44137649-44137671 TGAAGGCTGGATGGAGGCTGGGG + Intronic
1184467949 22:44679942-44679964 TGCAGTGTGGCTGGAGGCTTAGG + Intronic
952226740 3:31384605-31384627 TGTAGTATGAATCAAGGCAGAGG + Intergenic
953277323 3:41515002-41515024 TGCAGCATGTTGGGAGGCTGGGG + Intronic
955702276 3:61693753-61693775 TGCAGCATGTTTGGAGGCTGAGG + Intronic
956040891 3:65143815-65143837 TGAGTGATGAATGGAGGCTGCGG - Intergenic
956277008 3:67513144-67513166 TGCAGTATGGATGGGGCTTGAGG - Intronic
956398377 3:68849765-68849787 TACAATGTGAATGAAGGCTGGGG - Intronic
957108607 3:75924369-75924391 TGCTGTGTGGATGGAGGCAGAGG + Intronic
960042768 3:113167225-113167247 TGCAGGATGAAAGGAGGGGGAGG - Intergenic
960864833 3:122188902-122188924 TGCCTTATGAATGGATACTGTGG - Intronic
966572953 3:181467538-181467560 TTCAGTATGATTGAGGGCTGGGG + Intergenic
967757815 3:193189939-193189961 TGAAGTTGGAATGGAGTCTGAGG + Intergenic
968148065 3:196316275-196316297 TGCGGTATGAAGGTAAGCTGGGG - Intronic
968573403 4:1353989-1354011 TGGGGTGTGAGTGGAGGCTGGGG + Intronic
972350935 4:38235752-38235774 TGCAGTTTGTCTGGAGGCAGAGG + Intergenic
973909337 4:55563715-55563737 TACAGAAAGAATGGAGGCTCTGG + Intronic
975043298 4:69770868-69770890 TGTAGTATGTATGGAGCCTAGGG - Intronic
976361966 4:84190263-84190285 TGCATCATGAGTGGAGGCTGAGG + Intergenic
977149512 4:93492410-93492432 TGCAGTTAGAATGTAGGCTCAGG - Intronic
978359181 4:107910100-107910122 TCCAGTAAGAATGGAGACTCTGG - Intronic
979670998 4:123360066-123360088 TGCAGTGTGAATTGAGGTAGTGG + Intergenic
979720210 4:123891131-123891153 TCCATTTTGAATAGAGGCTGAGG + Intergenic
980106963 4:128597170-128597192 TACAATATTAATGGAGACTGTGG - Intergenic
980894745 4:138851370-138851392 GGCAGTAGGAATGGGGGCCGGGG - Intergenic
981810933 4:148773437-148773459 TCTATTTTGAATGGAGGCTGAGG + Intergenic
981998647 4:151001929-151001951 CGGACTATTAATGGAGGCTGTGG - Intronic
982114051 4:152082447-152082469 TGCAGGAGGAATGGGGGCTTAGG + Intergenic
985659108 5:1147056-1147078 TGCCACATGGATGGAGGCTGAGG - Intergenic
985834692 5:2261703-2261725 GGCAGACTGAATGGAGACTGTGG + Intergenic
986160513 5:5224122-5224144 TCCAGAATGAATGGTGGCTGGGG - Intronic
987018636 5:13847041-13847063 ACCAGTATGGAAGGAGGCTGTGG + Intronic
987407753 5:17587320-17587342 TGCAGGAGGAGTTGAGGCTGAGG + Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
989500370 5:42159409-42159431 TGCATTATGAATGGATGGTTTGG - Intergenic
990440337 5:55838637-55838659 TCCAGTATGAGTGGTGGATGGGG - Intergenic
990718567 5:58667225-58667247 TGCAGCTTTAAAGGAGGCTGAGG - Intronic
992571480 5:78063498-78063520 TCCATCATGAATGCAGGCTGTGG - Intronic
993588193 5:89759157-89759179 TGCAGTAGGGAGGGAGGGTGGGG - Intergenic
994415232 5:99461400-99461422 TTAAGTATGAATTAAGGCTGTGG + Intergenic
996240429 5:121193419-121193441 TGAAGTATGAATGTTGGCAGGGG + Intergenic
998281566 5:140813550-140813572 TACCCTATGAATGGAGACTGCGG + Intronic
998453984 5:142256299-142256321 TGCAGTCTAAATGCTGGCTGGGG - Intergenic
998638668 5:143985296-143985318 TACAGCAAGAATGGAGGCAGGGG - Intergenic
999853280 5:155565800-155565822 TTCAGTATGATTGCTGGCTGTGG - Intergenic
1001381294 5:171308410-171308432 TGCAGGATGGAAGGGGGCTGTGG - Exonic
1002496337 5:179614848-179614870 TCCAGTATGAGTGGTGGATGGGG - Exonic
1002770635 6:287920-287942 TGCAGTATTGATGGAGTCTCTGG + Intergenic
1003339274 6:5204214-5204236 AGCAGGATGAAAGGAGACTGTGG - Intronic
1004679920 6:17883523-17883545 TGAAGTAAAAATGGAGGCTTTGG - Intronic
1005379612 6:25219519-25219541 TTCAATATGAATGGAGGTTTAGG - Intergenic
1005416499 6:25605540-25605562 AGCAGTATGGATGGAGGTGGGGG + Intronic
1006323000 6:33331542-33331564 TCCAGAATGATGGGAGGCTGAGG - Intergenic
1006904540 6:37524280-37524302 TGCAGTATGGAGGGGGGGTGCGG - Intergenic
1007850466 6:44798001-44798023 TGTAGGATGAAAGGAGGCAGTGG + Intergenic
1007950699 6:45869645-45869667 TGCAGGATGAATGGGGCCTTGGG - Intergenic
1008251508 6:49245463-49245485 TGTGCTATGAATAGAGGCTGGGG + Intergenic
1010003127 6:70968260-70968282 TGGAGTATGAAGGGATGTTGGGG + Intergenic
1010060282 6:71614845-71614867 TGGAGTAGAAATGGAGGATGGGG - Intergenic
1011234190 6:85197738-85197760 TGCAGAAAGAATGGAAACTGAGG + Intergenic
1012326714 6:97928685-97928707 AGCAGTTTGAATTAAGGCTGAGG + Intergenic
1012548617 6:100448270-100448292 TGCAGGATGAATGCAGGCGCGGG + Intronic
1013521571 6:110938370-110938392 TCCAGTATGTTGGGAGGCTGAGG - Intergenic
1013576647 6:111489866-111489888 TGAAGTATGAATGTTGGCGGGGG - Intergenic
1015753064 6:136580698-136580720 TGCAGAATGGATGGAGGGAGGGG + Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016988955 6:149916375-149916397 TGCAGTGTGAGGAGAGGCTGAGG - Intergenic
1017988992 6:159470039-159470061 GTCAGTGTGAATGGAGGCAGGGG - Intergenic
1018425852 6:163679668-163679690 TGCATTCAGAATGGATGCTGAGG + Intergenic
1019155297 6:170034425-170034447 TGCAGCATGTAGGGAGGGTGAGG + Intergenic
1019209851 6:170396322-170396344 TGGAGTCTGCATGGAGGCTGCGG + Intronic
1019805267 7:3118969-3118991 TGCTGTCTGTATGGATGCTGGGG + Intergenic
1021145585 7:17084825-17084847 TCAGGTATCAATGGAGGCTGAGG - Intergenic
1022531585 7:31070192-31070214 TGCAGAAGGAACGGAGCCTGGGG - Intronic
1022638838 7:32162370-32162392 TGCAGTGTGATGGGAGACTGTGG + Intronic
1024282249 7:47728962-47728984 TGCAGTGGCAGTGGAGGCTGGGG - Intronic
1028604378 7:92639722-92639744 AGCAGGAGGAATAGAGGCTGTGG - Intronic
1029834131 7:103291339-103291361 TGTAGAATGAATGGAAGTTGGGG + Intergenic
1031181861 7:118429473-118429495 TGCATTATCAATGGGGGCCGTGG - Intergenic
1031895068 7:127338945-127338967 TGCATTATGGACGGAGGCTGGGG - Intergenic
1032387191 7:131533179-131533201 TGGAGCATGACTGGAGTCTGTGG - Intronic
1032429912 7:131852304-131852326 TGCAGTCTGCATGGGGCCTGGGG - Intergenic
1034434632 7:151057494-151057516 TGCAGCAAGAAACGAGGCTGGGG + Intronic
1034980182 7:155470893-155470915 TCAGGTATGAATGGAGTCTGTGG + Intergenic
1035646810 8:1229899-1229921 TTCAGTATTAATGTTGGCTGTGG - Intergenic
1035777453 8:2199261-2199283 TGCATGATGGCTGGAGGCTGGGG + Intergenic
1036270902 8:7301919-7301941 TCCAGGATGAATTGAGGCTCTGG - Intergenic
1036350447 8:8008425-8008447 TCCAGGATGAATTGAGGCTCTGG + Intergenic
1036451255 8:8869945-8869967 TGGAGTAAGAATGGAGTCAGAGG - Intronic
1036540052 8:9698099-9698121 AGCAATATGAATGGAGCCAGAGG + Intronic
1036837975 8:12091452-12091474 TTCATTGTTAATGGAGGCTGTGG + Intergenic
1036859765 8:12337699-12337721 TTCATTGTTAATGGAGGCTGTGG + Intergenic
1037444515 8:18951483-18951505 TGTTGTAGGAATGGTGGCTGTGG - Intronic
1037866909 8:22451435-22451457 TGTAGTATTAAAGGAGGCTGGGG - Intronic
1039516913 8:38141367-38141389 TCGAGTGTGATTGGAGGCTGAGG + Intronic
1040991950 8:53361717-53361739 TGAACAATGAATGGAGGCTTTGG - Intergenic
1042019655 8:64357998-64358020 TGAAGGATGAATAGAGGGTGAGG + Intergenic
1044002233 8:86897433-86897455 TGGAGTATGAAAAGAGGCTCTGG + Intronic
1044215922 8:89610196-89610218 TGATGTATGAATGGAGCCAGGGG - Intergenic
1044218147 8:89637120-89637142 TGGTGTATGAATGGGGTCTGGGG + Intergenic
1044836444 8:96300132-96300154 GGGAGTCTGAATGAAGGCTGAGG - Intronic
1045091583 8:98751132-98751154 TTCAGTATGATTGTTGGCTGTGG - Intronic
1046751863 8:117934714-117934736 TGCATTGTGAAAGGAGCCTGAGG - Intronic
1047199402 8:122752210-122752232 TGCAGAATGATTAGATGCTGGGG + Intergenic
1047555338 8:125923306-125923328 TGCAGTGAGGATGGAGACTGGGG + Intergenic
1047874087 8:129116004-129116026 TGAACTAAGAATGGAGGATGGGG - Intergenic
1048838757 8:138546586-138546608 TGCAGGCTGAATGGGGCCTGGGG + Intergenic
1049446504 8:142633922-142633944 GGCAGGATGAATGGAGGCCATGG - Intergenic
1053449299 9:38179912-38179934 TGCAGGAGGAACGGAGGCTCTGG + Intergenic
1053587678 9:39477591-39477613 TGTAATAACAATGGAGGCTGAGG + Intergenic
1055409497 9:76013671-76013693 TGCAGAATGAATGAAGGTTTGGG + Intronic
1057952819 9:99383608-99383630 TGCAGTGTGAATGGAGGGGTAGG - Intergenic
1058029034 9:100175661-100175683 GGCAGGAAGAATAGAGGCTGGGG - Intronic
1059749498 9:117234642-117234664 TCCAGTCTAAATGGAGGTTGGGG + Intronic
1187592772 X:20736557-20736579 TGCAGTTTCAATGGAGGTAGGGG + Intergenic
1190635796 X:52432608-52432630 TCCAGCATTATTGGAGGCTGAGG - Intergenic
1193427836 X:81361489-81361511 AGCAGCATGAATGGAGTTTGAGG + Intergenic
1195967546 X:110442400-110442422 TGCAGTCTGAATTTAGCCTGTGG + Intronic
1196915855 X:120534117-120534139 TGCAGTACTTAGGGAGGCTGAGG + Intronic
1198488274 X:137110322-137110344 AGCAGTATGAAGGGAGGCAAAGG - Intergenic
1198821633 X:140654221-140654243 TGCAGTAAGAATTGAGGCTGAGG + Intergenic
1199560042 X:149152071-149152093 GGCTGTATGAGTGGGGGCTGTGG + Intergenic
1200633781 Y:5623585-5623607 AGCAGTATGAATGGAGCTAGAGG - Intronic