ID: 1143756791

View in Genome Browser
Species Human (GRCh38)
Location 17:9073227-9073249
Sequence AGTCTCGGCGCTCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143756791_1143756801 -6 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756801 17:9073244-9073266 GAGACTTGGGGGTGGAAGGTGGG 0: 1
1: 0
2: 5
3: 55
4: 730
1143756791_1143756798 -10 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756798 17:9073240-9073262 CGCCGAGACTTGGGGGTGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 138
1143756791_1143756802 8 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756802 17:9073258-9073280 GAAGGTGGGAATCAAAGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 150
1143756791_1143756804 15 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756804 17:9073265-9073287 GGAATCAAAGCCGCGGGTGAAGG 0: 1
1: 0
2: 0
3: 5
4: 55
1143756791_1143756808 26 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756808 17:9073276-9073298 CGCGGGTGAAGGTGGGTGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 208
1143756791_1143756803 9 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756803 17:9073259-9073281 AAGGTGGGAATCAAAGCCGCGGG 0: 1
1: 0
2: 2
3: 9
4: 111
1143756791_1143756806 19 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756806 17:9073269-9073291 TCAAAGCCGCGGGTGAAGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1143756791_1143756800 -7 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756800 17:9073243-9073265 CGAGACTTGGGGGTGGAAGGTGG 0: 1
1: 0
2: 3
3: 35
4: 381
1143756791_1143756805 18 Left 1143756791 17:9073227-9073249 CCTGTCTCCTGAGCGCCGAGACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1143756805 17:9073268-9073290 ATCAAAGCCGCGGGTGAAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143756791 Original CRISPR AGTCTCGGCGCTCAGGAGAC AGG (reversed) Intronic
901209060 1:7514346-7514368 AGTCTCTCTGCTCAGGAGCCAGG + Intronic
904036586 1:27562242-27562264 AGGCTCGGGGGTCAGGAGGCGGG - Intronic
904548604 1:31296760-31296782 AGTGGCGGCGCTGAAGAGACCGG - Exonic
905268382 1:36770669-36770691 TGTCTCCCTGCTCAGGAGACAGG + Intergenic
914214069 1:145608346-145608368 AGCCCCGGCTGTCAGGAGACTGG + Intronic
915895622 1:159808992-159809014 CCTCTCGGGGCTCAGGAGAGGGG - Exonic
916788715 1:168105699-168105721 AGTCCCTGCCCTCAGGAAACTGG + Intronic
917551819 1:176040433-176040455 AGTCTCAGCGCTTGGGAAACTGG - Intronic
921114836 1:212079823-212079845 AGTCTTGGCCCCCAAGAGACTGG - Intronic
923003089 1:230023690-230023712 AGTTAGGGCCCTCAGGAGACTGG - Intergenic
924560025 1:245150602-245150624 AGTCACAGTGCTCAGCAGACTGG - Intergenic
1063109104 10:3019622-3019644 AATCTCAGCTCTCAGGTGACAGG - Intergenic
1065221007 10:23495909-23495931 ATTCCCTGCCCTCAGGAGACTGG - Intergenic
1069042690 10:63711517-63711539 GGTCTCTGTGCTCAGGAAACTGG - Intergenic
1069806990 10:71132334-71132356 AGTCTCAGAGCTCAGAAGACAGG - Intergenic
1074465755 10:113679860-113679882 AGTCTCGGCGCTGCGGAGGGAGG - Intronic
1076516341 10:131046819-131046841 AGACTCGGCACCCAGGACACAGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1079332837 11:19547708-19547730 AGTCTTAGAGCTCAGGAGAATGG - Intronic
1083611800 11:64007885-64007907 AGCCTCGGCCCTCTGGAGGCGGG - Intronic
1084847423 11:71911414-71911436 AGCCTTGGCCATCAGGAGACTGG + Intronic
1088882546 11:113983077-113983099 AGTTTGGGAGCTCAAGAGACAGG - Intronic
1091214832 11:133894325-133894347 AGGCTGGGGGCACAGGAGACTGG + Intergenic
1091325731 11:134685821-134685843 AGTCTGGGGGATAAGGAGACTGG - Intergenic
1103188771 12:118982598-118982620 AGACTCTGAGCTCAGGAGTCAGG + Intronic
1103954435 12:124568283-124568305 AATCTCTGCCCTCAGGAAACTGG - Intergenic
1104363266 12:128153644-128153666 AGACTCGGAGCACAGGAGATAGG + Intergenic
1104863886 12:131941409-131941431 CGTCTCGGCGCTCAGGCGGTAGG - Exonic
1112504865 13:99969636-99969658 AGTCTCCGCGCTCCGAGGACCGG - Intronic
1113950780 13:114069890-114069912 AGACTCAGGGGTCAGGAGACTGG + Intronic
1117680702 14:58200146-58200168 AGTCTCGGCGCTCGCGGGGCGGG - Exonic
1120835799 14:89037467-89037489 AGGGTGAGCGCTCAGGAGACAGG + Intergenic
1123466772 15:20522691-20522713 AGTCTGGGCAAGCAGGAGACGGG - Intergenic
1123651341 15:22478350-22478372 AGTCTGGGCAAGCAGGAGACGGG + Intergenic
1123741750 15:23287193-23287215 AGTCTGGGCAAGCAGGAGACGGG + Intergenic
1123745246 15:23315365-23315387 AGTCTGGGCAAGCAGGAGACGGG - Intergenic
1124277518 15:28338685-28338707 AGTCTGGGCAAGCAGGAGACGGG - Intergenic
1124305182 15:28572921-28572943 AGTCTGGGCAAGCAGGAGACGGG + Intergenic
1124346281 15:28923591-28923613 GGCCTCAGCGCTCAGCAGACAGG + Intronic
1132618900 16:855211-855233 AGGCTCCGCCCTCAGGAAACAGG - Intronic
1143756791 17:9073227-9073249 AGTCTCGGCGCTCAGGAGACAGG - Intronic
1154000935 18:10481943-10481965 CGTCTCGGAGCTCAGGACCCCGG + Intronic
1161852521 19:6745072-6745094 AGACTCGGCGTTCAGGCGGCTGG - Intronic
1164477228 19:28585151-28585173 AGTCTAGGAGCTGAGGAGAGGGG - Intergenic
1167271022 19:48506350-48506372 AGTCTAGGCACTGAGGACACAGG - Intronic
927469249 2:23360080-23360102 TGTCTCAGCGCCCAGGACACAGG + Intergenic
927652528 2:24920713-24920735 AGGCCCGGCGCTCCGGAGTCTGG - Intergenic
927973841 2:27323044-27323066 AGGCTCGGCGCTCAGGTGAGTGG - Exonic
938061880 2:128261261-128261283 AGTCTCGGGGCACAGGTGAAAGG + Intronic
940830290 2:158457855-158457877 AGGCTCGGCGCTGGGGAGCCGGG - Intronic
948462917 2:238138920-238138942 AGGGTGGGGGCTCAGGAGACAGG + Intronic
948630557 2:239299899-239299921 AGTCCTGGGGCTCGGGAGACAGG + Intronic
950399549 3:12759704-12759726 GGCCTGGGGGCTCAGGAGACTGG + Intronic
954374685 3:50188049-50188071 GGTCCTGGGGCTCAGGAGACCGG - Exonic
956408869 3:68957854-68957876 AGTCTTGGAGCTCAGGAGAATGG - Intergenic
961516653 3:127442153-127442175 AGTCACTGGGCACAGGAGACAGG + Intergenic
962302677 3:134256871-134256893 AGTCTGGCCTCTCAGAAGACAGG + Intergenic
969117268 4:4878479-4878501 AGTCTGGGGGCTCAGGAGCCAGG + Intergenic
978167056 4:105622054-105622076 ATTCACCCCGCTCAGGAGACTGG - Intronic
993935566 5:93997007-93997029 GGTGTCTGCTCTCAGGAGACAGG + Intronic
998105396 5:139465729-139465751 AGTCCCAGCACTCAGGAGGCTGG + Intergenic
999521683 5:152357489-152357511 TGTCTGAGAGCTCAGGAGACAGG + Intergenic
1002494985 5:179605671-179605693 AGCCTCAGCCCTCAGCAGACGGG + Intronic
1006946393 6:37787205-37787227 TGTCTCGGGGCTCAGAAGAAAGG + Intergenic
1007812570 6:44496804-44496826 CGTCTCTGGGCTCAGGAGCCCGG - Intergenic
1008712322 6:54242905-54242927 AGTCTAGGAACTCAGGAGTCTGG + Intronic
1015895044 6:138008834-138008856 ATGCTAGGCGCTCAGGAAACAGG + Intergenic
1017040494 6:150304717-150304739 AGACTATGCGCTCAGGAGAATGG + Intergenic
1018774300 6:166999193-166999215 AGTTTCGGCGCTCAGTGGTCCGG + Exonic
1021827868 7:24573116-24573138 AGTCTGGGCGCTCAGAAGCTGGG + Intergenic
1023307802 7:38849528-38849550 AGTCTGGCCGCTCAGTAGCCCGG + Intronic
1032993267 7:137417523-137417545 AGTCTGGGCTCTCAAGAGTCTGG + Intronic
1034972361 7:155427267-155427289 AGTCTCGGTGCTGTGGAGACTGG + Intergenic
1049216987 8:141412824-141412846 GGTCTGGGAGCTCAGGAGAGGGG + Intronic
1056809348 9:89752326-89752348 AGTCTAGGCGCTGAGGGGGCTGG + Intergenic
1062008128 9:134251841-134251863 AGTCACAGCTCTCAGGAGGCTGG + Intergenic
1193384669 X:80856213-80856235 AGTCTGGGCTTTCAGGTGACAGG + Intergenic
1196832199 X:119784512-119784534 AGTCTAGGGGTTCAGGAGATAGG + Intergenic
1200386195 X:155893288-155893310 AGTCCTGGAGCTCAGGAGATAGG + Intronic