ID: 1143761596

View in Genome Browser
Species Human (GRCh38)
Location 17:9108245-9108267
Sequence TCACCAAGGCTGCTACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143761589_1143761596 -1 Left 1143761589 17:9108223-9108245 CCCAACCTGCTCCCCAGACAGAT 0: 1
1: 0
2: 1
3: 18
4: 208
Right 1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG 0: 1
1: 0
2: 0
3: 11
4: 72
1143761588_1143761596 0 Left 1143761588 17:9108222-9108244 CCCCAACCTGCTCCCCAGACAGA 0: 1
1: 0
2: 7
3: 36
4: 352
Right 1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG 0: 1
1: 0
2: 0
3: 11
4: 72
1143761590_1143761596 -2 Left 1143761590 17:9108224-9108246 CCAACCTGCTCCCCAGACAGATC 0: 1
1: 0
2: 3
3: 33
4: 301
Right 1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG 0: 1
1: 0
2: 0
3: 11
4: 72
1143761591_1143761596 -6 Left 1143761591 17:9108228-9108250 CCTGCTCCCCAGACAGATCACCA 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG 0: 1
1: 0
2: 0
3: 11
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143761596 Original CRISPR TCACCAAGGCTGCTACAATC AGG Intronic
915994432 1:160549314-160549336 TCCTCACTGCTGCTACAATCAGG - Intronic
917413857 1:174787825-174787847 TAACCAAGGCTGCAACAATAGGG + Intronic
919904643 1:202069827-202069849 TTACAATGTCTGCTACAATCTGG - Intergenic
921875713 1:220193347-220193369 TCACCATGGCGTCTAGAATCTGG + Exonic
924304099 1:242669384-242669406 TCACAAAGCCTGCTAAAATTAGG + Intergenic
1064322552 10:14319532-14319554 TCACCAAGACTTCTTCAATGGGG + Intronic
1067090113 10:43262148-43262170 CCACCAAGGCTGCCCAAATCTGG - Intronic
1069063677 10:63920212-63920234 TCACCTACGCAGCTAGAATCTGG + Intergenic
1069944109 10:71974278-71974300 TCACCAAGCCCCCTACAACCCGG + Intronic
1072281000 10:93865378-93865400 TCACCAGGACTGCTACAGGCAGG - Intergenic
1075323530 10:121511505-121511527 TCACAAAGGCTGCTTCACACTGG + Intronic
1081197658 11:40181010-40181032 TCACCAAGGTAGGCACAATCTGG + Intronic
1081655156 11:44852251-44852273 TCACCAAGGCCTCTTTAATCAGG - Intronic
1081904926 11:46662620-46662642 TGATCAAGGCTGGTACAATTTGG + Intronic
1089051342 11:115548732-115548754 TCACCCAGGCTCCTAGAATCTGG - Intergenic
1096997138 12:55845590-55845612 TCACCAAGGCTGATGCACCCAGG + Intergenic
1100699264 12:97128968-97128990 ACACCAAGTCTGCCTCAATCAGG + Intergenic
1102108023 12:110342528-110342550 AGACCAAAGCTGCTGCAATCTGG - Intronic
1106841699 13:33691183-33691205 TCACAAAGGATTCTACAATACGG - Intergenic
1113411339 13:110093042-110093064 ACACAAAGGCTGCTTCAGTCAGG - Intergenic
1113781396 13:112979633-112979655 TCACAAAGGCTGCTACAAAGCGG - Intronic
1125579439 15:40775209-40775231 CCTCCAAGGCTCCTGCAATCTGG + Intronic
1127561341 15:60139503-60139525 TCACCCAGGCTGCTGGAATACGG - Intergenic
1128332326 15:66763720-66763742 TCACCAAGGAAGCCACAAACAGG + Intronic
1131652960 15:94422142-94422164 TCCCCAAGGCTGCTAGTATACGG + Intronic
1131824358 15:96306145-96306167 TCTCCAAGGCTGCTACTACTGGG - Intergenic
1133057825 16:3155620-3155642 TCACCTGTGCTGCAACAATCAGG + Intergenic
1134260718 16:12648825-12648847 AAACCAAGGCTGGTACAATGTGG - Intergenic
1141444490 16:84049316-84049338 TCTCAAAGGCTCCTGCAATCGGG + Intergenic
1143761596 17:9108245-9108267 TCACCAAGGCTGCTACAATCAGG + Intronic
1158623742 18:59054138-59054160 TCACCCAGGCTGCTATAGTGCGG + Intergenic
1165110074 19:33497267-33497289 TCACCAAGTCTGCTACAGGCAGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
935067215 2:99659647-99659669 CCACCAAGGCTGGAACTATCTGG - Intronic
935720633 2:105976028-105976050 TCACCCAGGCTGGTGCAGTCTGG + Intergenic
938181685 2:129190286-129190308 TCTCCAAGGGTGCTACATTCAGG - Intergenic
940222081 2:151363264-151363286 TCGCCCAGGCTGGTGCAATCTGG - Intronic
941926122 2:170896811-170896833 ACAGCCAGGCTGCTACAATGGGG - Intergenic
948357906 2:237394885-237394907 TCACCAAGGCTGCTGGAAGCCGG - Exonic
948541708 2:238695824-238695846 TCACCAGGGCTGCTCCACTGTGG - Intergenic
1179306296 21:40156379-40156401 TGACAAAGGCTGCAACAACCCGG - Intronic
1179899068 21:44379583-44379605 TCACCTATGAGGCTACAATCTGG - Intronic
953048042 3:39313425-39313447 TCACCCAGGCTGGCACAATCTGG - Intergenic
956385670 3:68715962-68715984 TCAGCAAGACTGCTAAAATGAGG - Intergenic
964602706 3:158519623-158519645 TTACGAAGGCTGGTATAATCTGG - Intronic
972328211 4:38038604-38038626 TGACCACTGCTGCTACATTCAGG + Intronic
973682757 4:53338096-53338118 TCAGCAAGGCTGGTTCATTCTGG - Intronic
980733924 4:136857727-136857749 TCAGCAAGGTTTCTACCATCTGG + Intergenic
984609511 4:181821555-181821577 ACAGCAAGGCTGCTACAAACAGG - Intergenic
988502661 5:31796566-31796588 TCACCCACGCTGGGACAATCAGG - Intronic
991660529 5:68946225-68946247 TCTACAAGGCTGCTACAAGACGG - Intergenic
994302231 5:98159595-98159617 TGACCAAGGCAGCTTGAATCTGG - Intergenic
999237226 5:150106163-150106185 TCACCAAGGCTTCCTCAGTCAGG - Intronic
1006540394 6:34735278-34735300 TCACCAAATCTGGGACAATCTGG - Intergenic
1006784920 6:36660141-36660163 TCACCAAGGCTGGAAGAATGAGG - Intergenic
1007719308 6:43875936-43875958 TGCCCAAGGCTGCTACCTTCAGG + Intergenic
1008141149 6:47833811-47833833 TCTCCAAGACTGCTACAAAAGGG + Intergenic
1012290916 6:97454376-97454398 CCACCAAGAAGGCTACAATCTGG - Intergenic
1020240918 7:6394478-6394500 CCACCAATGCTGGTACAAGCAGG - Intronic
1021595583 7:22312879-22312901 TCCCCATGTCTGCTACAATATGG + Intronic
1025013951 7:55423830-55423852 TCACAAAGGCTGCTAAGATGTGG - Intronic
1032420220 7:131772963-131772985 TGACTAAGGCTGCCACAAGCAGG + Intergenic
1032516843 7:132512727-132512749 TGTCTAAGGCTGCTCCAATCTGG + Intronic
1045853644 8:106735442-106735464 TCAGCAATGCTGATACAATTAGG + Intronic
1046260127 8:111757756-111757778 TCACCAAGTCAGCTAAGATCAGG + Intergenic
1048790817 8:138101628-138101650 TAGCCAAGGCTGGAACAATCAGG + Intergenic
1057891195 9:98871270-98871292 TGACCAAAGCTGGTCCAATCAGG + Intergenic
1059412900 9:114144415-114144437 TCACCAAGGTAGCTTCAAACAGG - Intergenic
1185589458 X:1264720-1264742 TCACCAAGGCTGCTGGAAGTGGG - Intergenic
1186128482 X:6441520-6441542 TCACCTAGGCTGGCACAATCAGG - Intergenic
1186141254 X:6576666-6576688 TAATCAAGGTTGCTAAAATCAGG + Intergenic
1188531909 X:31151353-31151375 ACACCATGGCTGCCCCAATCTGG - Intronic
1191141006 X:57116871-57116893 TCACCATGTCTACTACCATCAGG + Intergenic
1191895385 X:65987170-65987192 ACACAAAGGCTGCCACAATCTGG - Intergenic
1192380268 X:70609169-70609191 TCACAAAGGCTGCATCAAACAGG + Exonic
1197234166 X:124040407-124040429 TTAGCAAGACTGCTAAAATCCGG - Intronic
1197252347 X:124229162-124229184 TCTTCAAGGCTGCTGCAATAAGG + Intronic
1198530572 X:137547223-137547245 TCACCTAGGCTCCTACAAGTTGG - Intergenic
1200869387 Y:8081131-8081153 TCACCAAGTCTGCTATAGACAGG + Intergenic
1201495244 Y:14585940-14585962 CAACCAAGGCTTCCACAATCTGG - Intronic
1201610589 Y:15838884-15838906 TCACCTAGGCTGGCACAATCAGG - Intergenic
1202245871 Y:22819440-22819462 TCACCAAGCCTGCTATAGACAGG - Intergenic
1202398859 Y:24453188-24453210 TCACCAAGCCTGCTATAGACAGG - Intergenic
1202471921 Y:25216898-25216920 TCACCAAGCCTGCTATAGACAGG + Intergenic