ID: 1143762758

View in Genome Browser
Species Human (GRCh38)
Location 17:9116847-9116869
Sequence ATACTCGTCCTTTCATAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143762758_1143762764 30 Left 1143762758 17:9116847-9116869 CCACTCTATGAAAGGACGAGTAT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1143762764 17:9116900-9116922 ATCCTATTAACAGTTGATGTCGG 0: 1
1: 0
2: 2
3: 7
4: 108
1143762758_1143762763 4 Left 1143762758 17:9116847-9116869 CCACTCTATGAAAGGACGAGTAT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1143762763 17:9116874-9116896 TTGAAATATTTGTAAGCATGGGG 0: 1
1: 0
2: 3
3: 32
4: 443
1143762758_1143762762 3 Left 1143762758 17:9116847-9116869 CCACTCTATGAAAGGACGAGTAT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1143762762 17:9116873-9116895 ATTGAAATATTTGTAAGCATGGG 0: 1
1: 0
2: 2
3: 31
4: 393
1143762758_1143762761 2 Left 1143762758 17:9116847-9116869 CCACTCTATGAAAGGACGAGTAT 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1143762761 17:9116872-9116894 GATTGAAATATTTGTAAGCATGG 0: 1
1: 0
2: 1
3: 13
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143762758 Original CRISPR ATACTCGTCCTTTCATAGAG TGG (reversed) Intronic
901663076 1:10810983-10811005 AAACTCTTCATTTCATGGAGGGG + Intergenic
913130370 1:115833509-115833531 AGAGTTGTCCTTTGATAGAGGGG - Intergenic
1072210345 10:93240456-93240478 ATACTCTTCTTGTCAGAGAGAGG + Intergenic
1081216293 11:40403074-40403096 ATATTGGTCATGTCATAGAGTGG - Intronic
1095869044 12:47005379-47005401 GTTCTGGTCCTTTCAGAGAGGGG - Intergenic
1099714576 12:86274856-86274878 ACACTCTTCCTTTCACAGAATGG - Intronic
1101352846 12:103948488-103948510 ATATTCCCCCTTTCATAGGGTGG + Intronic
1103196021 12:119044427-119044449 ATCCTCTTCCTTTCACAGATGGG + Intronic
1103878880 12:124150620-124150642 ATACTCTTCCCTTCAAAGAAAGG + Intronic
1104040310 12:125125646-125125668 ATATTTGTCCTTCCATACAGTGG - Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1115397081 14:32920371-32920393 ATACTTGCCCTTCCATGGAGTGG - Intergenic
1125842348 15:42815358-42815380 ATACTCTTCCTATCATATATTGG + Intronic
1130349396 15:83077955-83077977 ATACTCATCCTTTCAAATAGAGG - Intergenic
1140604179 16:76515185-76515207 ATACTAGTCCTTTCTCAGATAGG - Intronic
1142621146 17:1166429-1166451 ACACTCGCCCATTCATAGTGTGG - Intronic
1143762758 17:9116847-9116869 ATACTCGTCCTTTCATAGAGTGG - Intronic
1144444476 17:15314441-15314463 ACACTTCTCCTTTCATAGGGTGG + Intronic
1148771168 17:50067674-50067696 ATAATGGTCCTTTCATTAAGAGG + Intronic
1149378325 17:56068024-56068046 ATACTTGTCTTCACATAGAGAGG - Intergenic
1149739318 17:59029409-59029431 ATGCAAGTCCTTTCATAGAATGG + Intronic
1151506537 17:74531488-74531510 ATTCACTTCCTTTTATAGAGTGG + Intergenic
1153115792 18:1654138-1654160 ATACTCGTAATTTCAAAAAGTGG - Intergenic
1155035119 18:22019587-22019609 ATACTTGGCCTCTCATAGCGTGG - Intergenic
1155509653 18:26563592-26563614 ATTCTCTTGCTTTCACAGAGAGG - Intronic
1166245275 19:41521259-41521281 ATACTGGTTCTTTTATACAGTGG + Intergenic
925084870 2:1100123-1100145 AGAATCGTCCTTTCATTCAGAGG - Intronic
926319487 2:11738979-11739001 ATAGTCTTCCTTTCAAAAAGAGG + Intronic
932943433 2:76197349-76197371 ATACTCCTCCCTTCAGAGTGGGG + Intergenic
940501379 2:154497958-154497980 ATACACTTCATTTCATAGAGAGG - Intergenic
942683186 2:178501067-178501089 ATACTGGTTCTTTTATAGAGTGG - Exonic
943011581 2:182456162-182456184 ATACTAGTTCTTTCAGAGTGTGG + Intronic
1177695406 21:24565138-24565160 ATACTCTTCCTTTAAAAAAGTGG + Intergenic
1182558991 22:31144274-31144296 ATACTCCTCCTTTCAAATGGTGG + Intergenic
950795623 3:15508517-15508539 ATACTGGTCATTTGATTGAGGGG + Intronic
951722164 3:25711748-25711770 ATACTGGTCCTGTCTTAAAGGGG + Intergenic
952433786 3:33251643-33251665 AAACTCATCAATTCATAGAGAGG + Intergenic
952913168 3:38208532-38208554 ATACTCATTTTTTCCTAGAGTGG + Intronic
953148578 3:40303141-40303163 ATACTTGTCCTTTCCTAAGGGGG + Intergenic
956271462 3:67451897-67451919 ATACTCATGCTTTCATTGACGGG - Intronic
960485317 3:118245228-118245250 AAACTCTTCCTTTCCTAGATGGG - Intergenic
961866190 3:129955061-129955083 TTGCTGCTCCTTTCATAGAGAGG + Intergenic
970970920 4:21982556-21982578 ATACTCTTCCTCTCATTCAGAGG + Intergenic
972689129 4:41379545-41379567 ATACTCCTCCTTTCAAAAGGTGG - Intronic
976299469 4:83504589-83504611 ATACTCGTCGTTTCAGTGATTGG - Intronic
976853595 4:89577022-89577044 ATTCTTGTCCTTGCATAGTGAGG + Intergenic
978751971 4:112259915-112259937 ATACTCCTCATTTCTTAAAGTGG + Intronic
982448317 4:155521528-155521550 ATACTCGTCATTTCAGTGACTGG - Intergenic
984422399 4:179540984-179541006 ATTGTGGTACTTTCATAGAGTGG - Intergenic
989581466 5:43037312-43037334 GTACTGGTCGTTTCATGGAGTGG - Intergenic
992739978 5:79763890-79763912 ATACTCATATTTTGATAGAGAGG + Intronic
1002375487 5:178786047-178786069 ATATTTGTCCTTCCATACAGTGG + Intergenic
1003690548 6:8349538-8349560 ATACTCCTCCCTTCAAATAGTGG + Intergenic
1006350855 6:33520096-33520118 ATACTCCACTTTTCATGGAGAGG + Intergenic
1007331667 6:41115589-41115611 ATACTCTTCCATCCCTAGAGAGG + Intergenic
1007536365 6:42593683-42593705 TTACTTGTCCTTTCAAAGAGTGG + Intronic
1007610988 6:43148738-43148760 ATACTCTGCGTTACATAGAGAGG + Intronic
1013727064 6:113111964-113111986 ATGCTTTTCCTTTAATAGAGAGG - Intergenic
1017052094 6:150402797-150402819 TCACTCTTCCTTTCATAGGGAGG - Exonic
1018627892 6:165797525-165797547 ATAATCGTCATTTCAAATAGTGG + Intronic
1022744146 7:33152384-33152406 GTACTAGTCCTTTGATAAAGGGG + Intronic
1026053087 7:66963142-66963164 ATACACATCCTTTCAGAGACTGG - Intergenic
1028605670 7:92652797-92652819 ATACCAGTCCTTTCATAGTATGG + Intronic
1029016761 7:97322989-97323011 ATCTTCATTCTTTCATAGAGAGG + Intergenic
1030090504 7:105853869-105853891 ATCCTCATCTTTTCAGAGAGAGG - Intronic
1050892456 9:10840928-10840950 ATACAAGTCCTTTGTTAGAGAGG + Intergenic
1052133806 9:24885983-24886005 ATCCTCCTCCTTTGATAGATTGG + Intergenic
1053445878 9:38152791-38152813 ATGCTCCTCCTTTTATAGAAGGG - Intergenic
1188144016 X:26587194-26587216 ACTCTCCTCCTTTCATACAGTGG + Intergenic
1200846310 Y:7834873-7834895 ATATTGGTCTTTTCCTAGAGGGG - Intergenic