ID: 1143763257

View in Genome Browser
Species Human (GRCh38)
Location 17:9120324-9120346
Sequence AGTTGCACAGCATTTCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143763257_1143763262 14 Left 1143763257 17:9120324-9120346 CCCATGGGAAATGCTGTGCAACT 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1143763262 17:9120361-9120383 GTACCCAAGACTTGGCACATTGG 0: 1
1: 0
2: 2
3: 8
4: 106
1143763257_1143763263 15 Left 1143763257 17:9120324-9120346 CCCATGGGAAATGCTGTGCAACT 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1143763263 17:9120362-9120384 TACCCAAGACTTGGCACATTGGG 0: 1
1: 0
2: 1
3: 5
4: 92
1143763257_1143763261 6 Left 1143763257 17:9120324-9120346 CCCATGGGAAATGCTGTGCAACT 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1143763261 17:9120353-9120375 TAGGGAGAGTACCCAAGACTTGG 0: 1
1: 0
2: 1
3: 27
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143763257 Original CRISPR AGTTGCACAGCATTTCCCAT GGG (reversed) Intronic
900521575 1:3107909-3107931 GGTTGCACAGCATTTACCTTAGG - Intronic
900828817 1:4949356-4949378 TGTTGCACAGCATCTCACAAAGG - Intergenic
902639375 1:17756740-17756762 ACTAGCACCCCATTTCCCATTGG - Intronic
905277085 1:36825327-36825349 AGTTGCACCTCAGGTCCCATTGG - Intronic
906436322 1:45799865-45799887 ATTTGCACAGGATTTGCCAGTGG + Intronic
908054124 1:60264816-60264838 AGTTCCTCAGCATTTAGCATAGG - Intergenic
913198772 1:116478909-116478931 CATTGCAAAGTATTTCCCATTGG - Intergenic
915984500 1:160450567-160450589 ACATGAACAGCATTTCCCAAAGG - Intergenic
919905861 1:202077913-202077935 ATTTGCAGAGCACTTCCCACAGG - Intergenic
921274505 1:213505620-213505642 ATGTACACAGCATTTACCATGGG + Intergenic
924448901 1:244159946-244159968 ACTTGCACAGCCTTTCCTAATGG - Intergenic
1063282167 10:4642215-4642237 ACTTGATCAGGATTTCCCATGGG - Intergenic
1063462441 10:6223169-6223191 GGCTCCACAGCATTTCCCAAGGG - Intronic
1064330492 10:14389611-14389633 AGCTGCAAAGCACTTCCCAAAGG + Intronic
1070719802 10:78748433-78748455 GGTTTCACAGCATTTCCAGTGGG + Intergenic
1071489311 10:86125195-86125217 AGTGGCAAAGCCTTGCCCATTGG - Intronic
1072057675 10:91776472-91776494 AGTTCCACAGGATATCCCAGAGG + Intergenic
1073050530 10:100664304-100664326 AGTTGCACAGGATGACCCAGGGG - Intergenic
1074915581 10:117951748-117951770 CGCTGCACAGCATTACCCAAAGG - Intergenic
1075388451 10:122074923-122074945 ATTCGCACAACATATCCCATGGG + Intronic
1076121969 10:127943715-127943737 AGTTGGTCAGCACTTCCCAAGGG + Intronic
1078878139 11:15418974-15418996 ATTTTAACATCATTTCCCATTGG - Intergenic
1082969121 11:59000418-59000440 AGTTGGTCAGCATGCCCCATCGG - Intronic
1083868477 11:65471783-65471805 TGCTGCACACCATTTGCCATTGG + Intergenic
1086817207 11:91387179-91387201 ATTGGCAAACCATTTCCCATTGG + Intergenic
1087716247 11:101612300-101612322 ATTGGCACAGCATTTGCCTTGGG - Intronic
1090269150 11:125373894-125373916 AGTTGCACTGCTTTTCCCAAGGG + Intronic
1091618080 12:2065108-2065130 TGTTGCACAGCATTTCTCCAAGG + Intronic
1095402196 12:41827756-41827778 AGTTGCACAGTATTACCTATGGG - Intergenic
1096993273 12:55822088-55822110 AGCTGCAAAGAAGTTCCCATTGG + Exonic
1098780831 12:74684588-74684610 AGTGTGACAGCATTTCCCATCGG - Intergenic
1099695312 12:86012220-86012242 ATATGCTCAGGATTTCCCATTGG - Intronic
1100893809 12:99157163-99157185 AGTTGCTCAACATTACCTATAGG + Intronic
1102839426 12:116102470-116102492 AGTTACAGAGCATCTCACATAGG + Intronic
1106005425 13:25765786-25765808 ACTTGCTCCTCATTTCCCATTGG + Intronic
1106456768 13:29934707-29934729 AGTTTCACAGCACTTCCTCTGGG + Intergenic
1108108093 13:47035208-47035230 AGTTGCACAGCTTTTGTCCTGGG + Intergenic
1109849663 13:68044849-68044871 AGTGGCACAGGAATTACCATTGG - Intergenic
1113272619 13:108691143-108691165 AGTTGCAAGGCATTGCCCAAAGG + Intronic
1114949031 14:27723969-27723991 AGTTGCACATTGTTTCACATTGG + Intergenic
1115521413 14:34236378-34236400 CTCTGCAGAGCATTTCCCATGGG - Intronic
1120264648 14:82233389-82233411 GGTTGCACAGAAATACCCATGGG + Intergenic
1125198152 15:37072292-37072314 AGATTCCCAGCATTTCCCACTGG + Intronic
1126327591 15:47497938-47497960 AGGACCTCAGCATTTCCCATAGG + Intronic
1133904071 16:10004662-10004684 AGAAGCACAGCATTTTCCTTTGG + Intronic
1135560064 16:23469367-23469389 AGTAGCAGAACATTGCCCATAGG + Intronic
1135806693 16:25549048-25549070 ATTTATACAGCATTTACCATTGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1141042046 16:80681202-80681224 AGTTGCACAGCATTTGTTTTGGG - Intronic
1143763257 17:9120324-9120346 AGTTGCACAGCATTTCCCATGGG - Intronic
1147182868 17:38697820-38697842 AGCTGCTCAGCATCTTCCATGGG + Intergenic
1151827692 17:76532376-76532398 AGGGGCAAAGCATTTCCCCTGGG - Intronic
1157382110 18:47227751-47227773 ATGTGCACAGCACTTCACATAGG + Intronic
1159448073 18:68564984-68565006 AGTTACACAGCCTTTCCATTTGG + Intergenic
1164649468 19:29881628-29881650 AGATGCACACCATTTCTTATGGG - Intergenic
1164955078 19:32376076-32376098 AGCTGCCTAGCATTTCACATTGG - Intronic
1167893982 19:52566091-52566113 AGTTGTAAAGCATTTCCCTATGG - Intronic
928357910 2:30637541-30637563 AGTCACAAAGCTTTTCCCATGGG + Intronic
929747703 2:44676135-44676157 GGTTGCACAGCTTTTCCCTCTGG + Intronic
931812233 2:65865572-65865594 AGTTGATTAGCATTTCCCATGGG - Intergenic
932976989 2:76614753-76614775 AGTAGCACAGCATTTTAAATAGG + Intergenic
932991025 2:76787709-76787731 AGTTGCAAAACAAGTCCCATGGG - Intronic
933586929 2:84189167-84189189 AGGTACACAGAATTTCCCCTAGG - Intergenic
934724269 2:96605255-96605277 AGGTACACAGCATTGCCCTTTGG - Intronic
934905679 2:98199809-98199831 TGTTGGAAACCATTTCCCATGGG - Intronic
935264233 2:101381100-101381122 AGCTTCACAGCATCTCCCACAGG - Intronic
935336312 2:102020621-102020643 AGTTGCACCGCATTTTCCCACGG + Intronic
935503657 2:103872253-103872275 AGTTCTACAGCATTTCACAGAGG - Intergenic
938690496 2:133784231-133784253 AGCAGCACAGAATTTTCCATGGG - Intergenic
939423407 2:142003324-142003346 ATTTGCACAAAATTACCCATTGG - Intronic
940320591 2:152372393-152372415 AATTGCACAGCATGCACCATAGG + Intronic
940511767 2:154624631-154624653 ATTTGCACTGGATTTCACATTGG - Intergenic
941074313 2:160989681-160989703 AGTTGCACAGCATTTTTCTGAGG - Intergenic
943307557 2:186283564-186283586 AGTTACACAGCATTACGCAAAGG + Intergenic
943748768 2:191489453-191489475 TGTGGCACAGCGTTTCCCCTTGG - Intergenic
943766960 2:191673458-191673480 AGGAGCACAGCATATCCCAGTGG - Intergenic
947860258 2:233353442-233353464 AGATGGACAGCATTTCCTCTGGG + Intergenic
948539899 2:238683570-238683592 AGTAGCCCTGCATTTCCCAGAGG - Intergenic
1169245606 20:4022181-4022203 AGTGGAACAGCATTGTCCATGGG + Intergenic
1171124013 20:22586380-22586402 AGATCCCCAGCATTTCCCACGGG + Intergenic
1171732122 20:28718936-28718958 GGCTGCATAGTATTTCCCATGGG - Intergenic
1174160068 20:48544224-48544246 AGTTGAACATCATTCCCCACTGG + Intergenic
1174879502 20:54263528-54263550 AATTGAACAGCTTTTCCCAGAGG + Intergenic
1178708454 21:34892684-34892706 AGTTCTACAGCGTTTACCATAGG - Intronic
1182083042 22:27542821-27542843 AGCTGCACAGCAGATCCCCTTGG + Intergenic
1183333364 22:37233041-37233063 AGTCACACAGCATTTGCAATTGG + Intronic
1184910961 22:47533853-47533875 GATTGCATAGCATTTACCATGGG + Intergenic
949887948 3:8711428-8711450 AGTACCACAGCATTTCCCTATGG + Intronic
952315216 3:32226434-32226456 AGTTGGTCACCATTTCCCACAGG + Intergenic
952554380 3:34515363-34515385 ATTTGCTCAGCATCTCCCCTTGG + Intergenic
955479942 3:59379657-59379679 AGTTGCAAAGCATTTTCTCTTGG + Intergenic
957188227 3:76971219-76971241 AATTGCCCAGCATTTTCCCTGGG + Intronic
959446243 3:106443352-106443374 TATTCCAAAGCATTTCCCATGGG - Intergenic
960208257 3:114929372-114929394 AGTTGCACAGAATCACCCTTGGG - Intronic
960905466 3:122596557-122596579 AGGTGAACAGGATTTCCCAAAGG - Intronic
962801165 3:138891895-138891917 AGTTGAACAGTAGTTGCCATGGG + Intergenic
963766652 3:149343263-149343285 AGTTCAACAGCACTCCCCATGGG - Intergenic
968967631 4:3777102-3777124 AGGTACACAGCATCTGCCATGGG + Intergenic
973803593 4:54502312-54502334 GGCTGCACAGCATTCCCCAGTGG - Intergenic
975509607 4:75179399-75179421 AGTTGCCCACCATTTCAGATAGG - Intergenic
976150156 4:82083610-82083632 AATGGCACTGTATTTCCCATGGG - Intergenic
979877946 4:125917132-125917154 ATTTGCATAGCATTTTACATAGG + Intergenic
982084845 4:151823997-151824019 AGATGCATAGAATTTCCTATGGG - Intergenic
983547652 4:168979771-168979793 AGTGGCTCTGCATTTCCCAGGGG + Intronic
986629537 5:9756526-9756548 AATTTGACAGCTTTTCCCATGGG + Intergenic
987221513 5:15794923-15794945 AGTTGAAAAGTATTTCCCACAGG - Intronic
989260406 5:39413169-39413191 AGTTGCACAGACTTGCCCTTTGG + Intronic
991342265 5:65624445-65624467 AGTTGCACAGCCTCGCGCATGGG + Exonic
996349518 5:122523031-122523053 AGTTACACTGCATTTTCCAGTGG + Intergenic
997891511 5:137681050-137681072 AGGTCCACAGCCTTGCCCATAGG - Intronic
999644110 5:153701066-153701088 AAGTGCACAGCAGTTGCCATGGG - Intronic
999907145 5:156154058-156154080 AGTTTCACAGAATCTCCCTTAGG - Intronic
1000859784 5:166443095-166443117 AGTTGCATAGAATGTTCCATAGG + Intergenic
1002826882 6:782066-782088 TGTTGCAAATCTTTTCCCATTGG + Intergenic
1004421156 6:15471097-15471119 AGTGGCATAGCTTTTCCCAGGGG + Intronic
1006262148 6:32883967-32883989 AATTGTACATCAATTCCCATTGG - Intergenic
1011347471 6:86387964-86387986 AGTTGTACAGAATATCCCAATGG + Intergenic
1013892499 6:115042193-115042215 AGTTACACAGCCTTTTGCATTGG + Intergenic
1016254867 6:142092817-142092839 AGATTCACAGAATTTCCCCTTGG + Intergenic
1019359446 7:597170-597192 ATTGGCAAAGCAGTTCCCATTGG + Intronic
1021903124 7:25307403-25307425 ACCTACACAGCATTTCCCAAAGG - Intergenic
1022460846 7:30605081-30605103 AGTGCTACACCATTTCCCATGGG - Intronic
1023655122 7:42411876-42411898 AGATGCTCAGCAATTCCCATGGG - Intergenic
1023723541 7:43119290-43119312 ATCTGAGCAGCATTTCCCATGGG + Intronic
1030902017 7:115136535-115136557 AGTTGGAAAGTATCTCCCATGGG + Intergenic
1031128665 7:117805440-117805462 AGTTGAACAGCTGTGCCCATTGG - Intronic
1031414251 7:121476742-121476764 ATTTTCATAGCATTTCCCAATGG + Intergenic
1038024419 8:23576087-23576109 AGTAGCACAGCATTGGCCATAGG - Intergenic
1042357007 8:67839345-67839367 GGCTGCAGAGCCTTTCCCATGGG + Intergenic
1043143326 8:76618668-76618690 ATTTTCACAGCAGTTCCCAAAGG + Intergenic
1045807939 8:106187286-106187308 ATTTGCACAGCATTTCCTAAAGG + Intergenic
1045888287 8:107125046-107125068 AGTTGCATGGCATTTCACATAGG + Intergenic
1048619100 8:136111849-136111871 AGCTGCATAGCATTTCACAGAGG + Intergenic
1048746425 8:137619542-137619564 AGTTACACAGTACCTCCCATGGG + Intergenic
1048756787 8:137748069-137748091 ATCTGCAGAGCATTTCCCCTAGG - Intergenic
1049045364 8:140146767-140146789 AGTTTCACAGCCTGGCCCATGGG - Intronic
1052623868 9:30949147-30949169 ATTTGCACAGCATTGCCTACTGG - Intergenic
1054754883 9:68947476-68947498 AGTTGCAAACGATATCCCATAGG - Intronic
1057403270 9:94743597-94743619 AGTTGCTCATGATTTCCTATTGG - Intronic
1058401724 9:104626750-104626772 AGTTGCACTGCATGTCCATTAGG - Intergenic
1058927318 9:109679605-109679627 AGTAGCTCTGCATCTCCCATTGG - Intronic
1059781950 9:117539003-117539025 TGTTGCACAGAATTTCTAATGGG - Intergenic
1060869899 9:127031053-127031075 TGTCGCACAGCCCTTCCCATGGG - Intronic
1189073683 X:37891797-37891819 AGTTGCAAAGCATTGCCAAGAGG - Intronic
1189922528 X:45916317-45916339 AGTAGCACAGAGTTTCCCTTCGG + Intergenic
1198201415 X:134422835-134422857 ACTTGCAGAATATTTCCCATAGG - Intronic
1199333644 X:146591414-146591436 AGTTGGACAGCATACCCAATGGG - Intergenic