ID: 1143763784

View in Genome Browser
Species Human (GRCh38)
Location 17:9124153-9124175
Sequence CTGCTGATTTTTAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 555}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143763784 Original CRISPR CTGCTGATTTTTAAGAAAAA TGG (reversed) Intronic
901363786 1:8727798-8727820 CTGCTGACCTTTAAGAATAGTGG - Intronic
901620224 1:10579148-10579170 CTGCTAATATTAAATAAAAAGGG + Intronic
902265516 1:15260672-15260694 TTGCTGGTTTTGAAGATAAAGGG - Intronic
904109752 1:28116543-28116565 CTGCTTTTTTTTAAGAGATATGG + Intergenic
907173372 1:52493610-52493632 CTTGGGATTTTAAAGAAAAATGG - Exonic
908364460 1:63404331-63404353 CTGTTGCTTTATAAGAGAAATGG + Intronic
908365519 1:63419355-63419377 CAGCTAACCTTTAAGAAAAAAGG - Exonic
908375015 1:63527878-63527900 CTGTTCAGTTTTGAGAAAAAAGG - Intronic
908655118 1:66380420-66380442 TGGCTAATTTGTAAGAAAAAGGG + Intergenic
908923768 1:69228339-69228361 CTGTTGATTTGTGGGAAAAAGGG - Intergenic
910558266 1:88561457-88561479 GAGCTGATTTTAAACAAAAATGG - Intergenic
910894513 1:92054056-92054078 CTCCTAATTCTTAAGAGAAATGG - Intronic
911876469 1:103170190-103170212 CTTCTGATTTTAATAAAAAATGG + Intergenic
911955249 1:104225398-104225420 CAGCTGAATCTTAGGAAAAACGG + Intergenic
911992927 1:104725618-104725640 CAACTGATTTTTAACAAAAATGG + Intergenic
912769784 1:112452950-112452972 CTGCTGATTTTTTGTAGAAATGG - Intronic
912873836 1:113335457-113335479 ATGCTGTTTTTTACGAACAATGG + Intergenic
912901457 1:113654316-113654338 ATGCTGACTTTTAAGAAAATGGG + Intronic
912979485 1:114357721-114357743 CTGCTGATTATGAAGAATACAGG + Intergenic
914408008 1:147396075-147396097 ATGAAAATTTTTAAGAAAAATGG + Intergenic
914699288 1:150116860-150116882 CTGCTGATATTTCAGATTAAAGG - Intronic
915471705 1:156129682-156129704 CTGGAGGTTTTTAAGAAAATAGG + Intronic
916299330 1:163256408-163256430 CCACTGAACTTTAAGAAAAATGG - Intronic
916688424 1:167168837-167168859 ATGCTAAATTTTAAGAAAGATGG - Intergenic
916720365 1:167480605-167480627 CAGGTGATTTTAAAGAAAATAGG + Intronic
916772222 1:167921534-167921556 ATGCTGATGTTAAAGAAAAATGG - Intronic
916826254 1:168444805-168444827 CTGATGATTCTCAAGAAAACTGG + Intergenic
916945907 1:169727300-169727322 CTGGTGATTAAAAAGAAAAAGGG - Intronic
917254427 1:173099136-173099158 CTGTAGATTTTTAAGAAGATGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917383498 1:174441229-174441251 CTGATGATTGTAAAAAAAAATGG + Intronic
917643015 1:177001504-177001526 ATTCTCATTTTTAAGAAATAAGG + Intronic
918497138 1:185153520-185153542 CTGGTGACCTTTAAGAAAACAGG + Intronic
919037252 1:192329482-192329504 CTGCTTATTATTAAGAGAAAAGG + Intronic
919109860 1:193205206-193205228 CTGATGAGTTTAAAAAAAAAGGG - Intronic
919528405 1:198682816-198682838 ATTCTTATTTTTCAGAAAAATGG - Intronic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920838852 1:209536975-209536997 CTGCTGATTCTTAAGAACAAAGG + Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921840338 1:219821461-219821483 ATGCTGCTTTTTCAGAAATAAGG - Intronic
922178755 1:223217198-223217220 CTGGGGATTTTTAAAAAAAAAGG + Intergenic
922302528 1:224314846-224314868 CGGCTAATTTTTGAAAAAAAGGG - Intronic
922318977 1:224467973-224467995 CTGATTTTTTTAAAGAAAAAAGG - Intronic
922369868 1:224898727-224898749 GTTCTGATTTTTAAGTAAATTGG + Intronic
923195958 1:231667587-231667609 TTGCTAATTTTTAAAAGAAAGGG - Intronic
923361396 1:233215090-233215112 CTGCTGATTTTTATTCATAAGGG - Intronic
923589692 1:235308413-235308435 TTTCTAATTTTTAAGAAACAGGG + Intronic
923743327 1:236676424-236676446 TTGGTGAACTTTAAGAAAAAAGG + Intergenic
923932484 1:238717870-238717892 TTGATTATTTATAAGAAAAATGG + Intergenic
924263697 1:242258250-242258272 GTGCTGGTTTTTAAGAAATGTGG - Intronic
924334093 1:242969464-242969486 CTGCTGTGTTTTCAAAAAAAGGG + Intergenic
924427696 1:243968289-243968311 GGGCTGATTTATGAGAAAAATGG + Intergenic
924820634 1:247487135-247487157 CAGCTGATATTCAAGAAAATTGG + Intergenic
1063814464 10:9756889-9756911 CTGCTGATCTTTAAGGAGCAGGG + Intergenic
1064423214 10:15207978-15208000 CAGCTACTTTTTAAGGAAAATGG - Intergenic
1064489923 10:15844271-15844293 CTTCTGATTTTTCCGCAAAAGGG + Intronic
1065013785 10:21442951-21442973 TTGCTGATTTTTGAAACAAAAGG + Intergenic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1066721102 10:38340220-38340242 GTGCTGGTTTTTAAGAAATGTGG + Intergenic
1067014673 10:42748738-42748760 CAGCTCATTTTTAAAAAGAAAGG + Intergenic
1068282823 10:54898192-54898214 TGGCTAATTTTTAAGAAAAGAGG - Intronic
1068344449 10:55755358-55755380 CTTAAGATTTTTAAGAAAGAAGG - Intergenic
1068797891 10:61104342-61104364 CTTCTCATTATTAAAAAAAATGG + Intergenic
1070293703 10:75140625-75140647 CTGCTGATTTTTGGGAAAAGAGG + Intronic
1070862091 10:79678968-79678990 CTTAAGATTTTTAAGAAAGAAGG + Intergenic
1070875046 10:79795485-79795507 CTTAAGATTTTTAAGAAAGAAGG - Intergenic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1071641970 10:87317655-87317677 CTTAAGATTTTTAAGAAAGAAGG - Intergenic
1071745306 10:88412054-88412076 CTGATGAATTTTAAGAAGGATGG + Intronic
1073692805 10:105829864-105829886 TTGGTAATTTTTAAGAAAAAGGG + Intergenic
1074192338 10:111148929-111148951 ATGCTGATTTTTCTGAAAGACGG + Intergenic
1074233236 10:111558686-111558708 CTACCTATTTTTAAGAAATACGG + Intergenic
1074733444 10:116402058-116402080 CTGCTGCTTGTCATGAAAAAAGG + Intergenic
1075189249 10:120291280-120291302 CTGGTGACCTTAAAGAAAAATGG + Intergenic
1075301516 10:121328827-121328849 CGGCTCATTTTTAAGAGAAGAGG - Intergenic
1075856514 10:125634692-125634714 CTTCTGATTTTTAACAAAATGGG - Intronic
1076126690 10:127979672-127979694 CAGCTGATTTTTAAAAAATAAGG - Intronic
1076199125 10:128544341-128544363 GTGCTGTTTTAAAAGAAAAAAGG - Intergenic
1076221219 10:128734567-128734589 CTTCTCATTATTATGAAAAACGG - Intergenic
1076578218 10:131486160-131486182 CTGTTCTTTTTTAAGAAGAAGGG - Intergenic
1076650814 10:131986008-131986030 ATGCAGATATTTAAGGAAAACGG + Intergenic
1076823459 10:132954209-132954231 CTGTTGGTAATTAAGAAAAATGG + Intergenic
1077294256 11:1817204-1817226 CTGCTGCTTTTCGAGACAAAAGG + Intergenic
1077659642 11:4056174-4056196 CAGCTTATTTATAATAAAAATGG + Intronic
1078438256 11:11343412-11343434 CAGCTGATACTTAAGACAAAAGG + Intronic
1078715929 11:13838945-13838967 CTGCTGGTTTTGAAGACACAAGG - Intergenic
1079043684 11:17081187-17081209 CTTCTAATTTTTTAGACAAAGGG + Intronic
1079152802 11:17916061-17916083 CCACAGACTTTTAAGAAAAATGG - Intronic
1079926172 11:26494583-26494605 ATGTGAATTTTTAAGAAAAATGG - Intronic
1080306505 11:30842829-30842851 CTACTGATTTTTAATAATAGTGG + Intronic
1080385499 11:31808638-31808660 CTACTGAATTTAAAAAAAAATGG - Intronic
1080459733 11:32443475-32443497 CTGCTTATTTTGAAGAACATGGG - Intergenic
1081038688 11:38182598-38182620 CTGCTGATTTATAATGAAAATGG - Intergenic
1081256755 11:40905755-40905777 CTGCACATTTTCAAGAAAAGTGG + Intronic
1081341680 11:41935595-41935617 CTGCTTATTTTTAAAAACCAGGG - Intergenic
1082949606 11:58798429-58798451 CTGGGGATTTTTAAGAAAGAGGG - Intergenic
1083255520 11:61493176-61493198 TTGGTAATTTCTAAGAAAAAAGG - Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1086004200 11:82016763-82016785 AGGCTTATTTTTAAGATAAAAGG + Intergenic
1086393153 11:86386788-86386810 CTGCTGATTTTTCAATGAAAGGG - Intronic
1086395010 11:86406432-86406454 GTGCTGAATTTTTAGAATAAAGG - Intronic
1086471204 11:87113206-87113228 CTGCAGCTTTTTAGTAAAAATGG - Intronic
1086510831 11:87556094-87556116 CTACTGATCTCTCAGAAAAATGG + Intergenic
1086747897 11:90453257-90453279 ATGCTGCTTTTTATGTAAAAGGG + Intergenic
1087121974 11:94584586-94584608 ATCCTTATTTTTAAGAGAAAGGG + Intronic
1087392103 11:97549200-97549222 AAGCTGTTTTTTAAAAAAAAAGG + Intergenic
1087540752 11:99516125-99516147 GTGCTAATTGTTAAAAAAAATGG + Intronic
1088588795 11:111383190-111383212 CTGCTGATCAACAAGAAAAAGGG - Intronic
1089511923 11:119004550-119004572 TTTCAGATTTTTAATAAAAAGGG + Intronic
1089810358 11:121126382-121126404 CTCCTAATATTTAAGAAAAAGGG - Intronic
1092374496 12:7944026-7944048 CTTGAGATTTTAAAGAAAAAAGG + Intergenic
1092641014 12:10509368-10509390 TTGATGATTTTTCAGAAGAAAGG - Intronic
1093429339 12:19066312-19066334 ATGCTGATTTGTTAGAGAAAGGG - Intergenic
1093509190 12:19905770-19905792 CTCCTCCTTTTTAACAAAAAAGG - Intergenic
1094086975 12:26604499-26604521 CTGCTGTTTTACAAGAAACAGGG - Intronic
1094419320 12:30254278-30254300 TAGCTGGTTTTTAGGAAAAAAGG - Intergenic
1095269609 12:40202352-40202374 ATGCTTTTTTTTAAAAAAAAAGG + Intronic
1095361801 12:41351238-41351260 TTGCTTAGTTTTAAGAAAATGGG - Intronic
1095379806 12:41577216-41577238 CTGGAGCTTTTAAAGAAAAAAGG - Intergenic
1095913000 12:47447907-47447929 CTTATTATTTTGAAGAAAAAGGG - Intergenic
1096936001 12:55277267-55277289 CTGATAATTTATAAGGAAAAAGG + Intergenic
1097493832 12:60302886-60302908 TTGCTGCATGTTAAGAAAAATGG + Intergenic
1097615311 12:61878264-61878286 CTGCTGAATTGTACAAAAAATGG + Intronic
1097692982 12:62751259-62751281 TTGCTGTTTTTTAAGTAAAGAGG - Intronic
1097751889 12:63364468-63364490 TTGAGGATTTTTAAGATAAAGGG + Intergenic
1098103594 12:67045333-67045355 TTGCTGAGTTTTAAGAAAGCAGG + Intergenic
1098941696 12:76544244-76544266 CTGCTTATTTATACTAAAAATGG + Intronic
1099594823 12:84647587-84647609 TTTCTAATTTTGAAGAAAAATGG + Intergenic
1099644355 12:85332500-85332522 ATTCAGATTTTTAAGAAAACTGG + Intergenic
1100603817 12:96134632-96134654 TTGCTGCTTTTTAAAAACAAAGG + Intergenic
1101071346 12:101079570-101079592 CTGCTGAAGTTAGAGAAAAAAGG - Intronic
1101373140 12:104148449-104148471 CTGCAGATTTTCAATAAAAATGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101587038 12:106094112-106094134 CTGTTGATTTAAAAAAAAAAAGG + Intronic
1101715986 12:107312731-107312753 CTGGTGATTTTTAAGAAGTGAGG - Intergenic
1101871333 12:108567973-108567995 CTGCTGATTTTTAACTAATTTGG - Intronic
1102596785 12:113999041-113999063 CTGGTCATTTTGAAGAAAATGGG + Intergenic
1102912097 12:116724171-116724193 GTGTTGCTTTTTAAGCAAAAGGG + Intronic
1103880457 12:124162187-124162209 TTGGTGCTTTTTAAAAAAAATGG + Intronic
1104175991 12:126333135-126333157 CTGCTGCTTATTAATAGAAAGGG + Intergenic
1105351276 13:19618212-19618234 CTGATGGTTTTTAAAAAAACGGG + Intergenic
1106043523 13:26116578-26116600 CTGCTGATTCTTGAGAATCAAGG - Intergenic
1106932197 13:34678681-34678703 CTGGTGATTTTCCAGAAAAGTGG - Intergenic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107345317 13:39454099-39454121 TTTCTGATTCTCAAGAAAAATGG + Intronic
1107591770 13:41915317-41915339 CTGCTGAGTGCTAAGAATAAAGG - Intronic
1108886672 13:55193618-55193640 CTTCTGATTTGTAGGATAAAAGG + Intergenic
1108966395 13:56308712-56308734 TTGTTGAATTTTAAGTAAAATGG - Intergenic
1109250844 13:60018934-60018956 TTGCAAATTTTTAAGAAAACAGG - Intronic
1109853897 13:68103558-68103580 ATGCTGTTTTTTTAAAAAAATGG + Intergenic
1109871714 13:68341899-68341921 CTGATGGTTTTAAAAAAAAATGG - Intergenic
1110109818 13:71732277-71732299 TTGGTGATTTTTAGGCAAAAAGG - Intronic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110442683 13:75542836-75542858 TTGCTGATTTTGAAGACAGATGG + Intronic
1110493632 13:76138855-76138877 CAGCTGATTTTTGACAAAATTGG - Intergenic
1110581198 13:77129596-77129618 CTGCTGTTTTATAATAAAAATGG + Intronic
1110695479 13:78483254-78483276 CAGCTTATTTTTATTAAAAAAGG - Intergenic
1110703666 13:78579615-78579637 ATGCTGATTTTTAGGTAACATGG + Intergenic
1110771014 13:79346323-79346345 CAGCTGATATTTAAAAAGAAAGG + Intronic
1110935992 13:81290066-81290088 ATCCTGATTTTTAACAAAAAGGG - Intergenic
1111293406 13:86197750-86197772 CAGCTGAATTTTAAGAGGAATGG - Intergenic
1111609174 13:90581201-90581223 CTGAGGATTTTTAAGTGAAAGGG - Intergenic
1111727190 13:92027254-92027276 ATGCTGATTTTTTAGCTAAAGGG + Intronic
1112729806 13:102348296-102348318 CTGCTGATCTTTTAGGAAACTGG - Intronic
1113331393 13:109331387-109331409 TTGTTGATTTGTAAGATAAAAGG - Intergenic
1113744429 13:112733257-112733279 CTGCTCATCTTTAAGTAAAGTGG - Intronic
1114329181 14:21618816-21618838 CTACTAATTTTTATGAAACATGG + Intergenic
1115785509 14:36821211-36821233 GTGGTGATTTTTCAGAAAATGGG - Intronic
1115799439 14:36976050-36976072 CTGCTGTTTGCTTAGAAAAATGG + Intronic
1116381345 14:44272925-44272947 TTTCTGCTTTTTAAGCAAAATGG - Intergenic
1116477255 14:45355112-45355134 CTGCTGACTTTTAAAAAGATTGG + Intergenic
1116619555 14:47181590-47181612 CTTGTGATTTTTTAGAAACAAGG + Intronic
1117023480 14:51596087-51596109 TTGCTGCTTTTTAATCAAAAAGG - Intronic
1117120445 14:52562584-52562606 TTGCTGTTTTTTAAGAGACAGGG - Intronic
1118109251 14:62697457-62697479 CAGTTGTTTTTTAAGAAAACTGG + Intergenic
1119251987 14:73164206-73164228 CTGCTGTTTATTGAGATAAATGG + Intronic
1120211182 14:81635491-81635513 CTTATTTTTTTTAAGAAAAATGG - Intergenic
1120609299 14:86620951-86620973 CTTCTGATTTTCAAGTTAAATGG - Intergenic
1121357284 14:93226318-93226340 ATGCTTATTGTTAAGAAAGAAGG - Intronic
1124005278 15:25791032-25791054 CAGCTGGTTTTGCAGAAAAAAGG - Intronic
1124036905 15:26062167-26062189 CTGCTGATTATTAAAGTAAATGG - Intergenic
1125400909 15:39301823-39301845 CTGCTCATTTATACCAAAAAAGG + Intergenic
1126405305 15:48316990-48317012 CTGCCGGTTTTGAAGATAAAGGG + Intergenic
1126409591 15:48358591-48358613 CTGCTGTGTTTAAACAAAAATGG + Intergenic
1126458565 15:48891098-48891120 TTGTTGATTTTTAACCAAAAAGG + Intronic
1126632634 15:50752922-50752944 CTGCTCATTTTTTATTAAAAAGG - Intronic
1126652184 15:50935708-50935730 CTGCGGACCTTTAAGAACAATGG + Intronic
1127153656 15:56105839-56105861 CTCATGTTTTTAAAGAAAAAAGG + Intronic
1127614392 15:60669271-60669293 CTTCTGATTATTAAAGAAAAAGG - Intronic
1130192595 15:81750751-81750773 CTGCTGTTTTTGCAGAACAAGGG - Intergenic
1131588615 15:93722856-93722878 CTGCTCAGTTTAAAGAAAAAAGG - Intergenic
1131625823 15:94119522-94119544 CTCCAGATTTTTAAGAAGACTGG - Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1133044606 16:3080731-3080753 CTTATTATTTTGAAGAAAAAGGG - Intronic
1133645301 16:7758672-7758694 CTGCTGAATTGTAAGAAACGTGG - Intergenic
1133968828 16:10552191-10552213 CTGCTGATGTTAAAGTAACAGGG - Intronic
1134450449 16:14360091-14360113 CAGCTGATTTTTAATAGAGACGG - Intergenic
1135267189 16:21037560-21037582 TGCCTGATTTTTAATAAAAATGG - Intronic
1135536199 16:23296314-23296336 CTGCTTATTTTCCAGAAAATCGG + Intronic
1135581251 16:23628531-23628553 ATGGTGATTTATAAGAAAATGGG - Intronic
1137719221 16:50618168-50618190 CTGCTCATTTGGAAGAAAAAAGG - Intronic
1138094907 16:54203993-54204015 CTGTTGCTTTTCCAGAAAAATGG + Intergenic
1139062321 16:63267550-63267572 ATGGCGACTTTTAAGAAAAAAGG - Intergenic
1140273109 16:73483815-73483837 CTGCAAATTATGAAGAAAAATGG + Intergenic
1140874758 16:79140499-79140521 CTGCTGATTTTCCAGAGACAAGG - Intronic
1141804205 16:86332020-86332042 CTGCTGACTTTGAAGATTAAGGG - Intergenic
1141812635 16:86385683-86385705 CTGCAGATTTTTATGTACAAGGG - Intergenic
1142258274 16:89026519-89026541 CATCTGATTTTTAAAAAAAATGG - Intergenic
1142484401 17:237291-237313 GTGGGGAGTTTTAAGAAAAATGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143075121 17:4335406-4335428 CTGCTGGGTATTAAGAGAAAGGG + Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144478038 17:15605747-15605769 CTGATGTTTTCCAAGAAAAAAGG - Intronic
1145410778 17:22660813-22660835 TTGCAGATTCTAAAGAAAAAAGG + Intergenic
1146363471 17:32198406-32198428 TTTCTGATATTTAAGAAAATGGG + Intronic
1146835051 17:36104156-36104178 TTGCTAATTCTTAAGAAAATAGG - Intronic
1146849663 17:36211392-36211414 TTGCTAATTCTTAAGAAAATAGG - Intronic
1146983439 17:37188544-37188566 CTGCTCATATTTGAGAAAGAAGG + Intronic
1147787379 17:42988968-42988990 ATACTGATTTTTAAGAGACAGGG - Intronic
1149052913 17:52327653-52327675 TTGCTGAGTTTTAATCAAAAAGG - Intergenic
1149092564 17:52801714-52801736 CTGCTGATGTTGCAGAGAAAGGG - Intergenic
1149177871 17:53896134-53896156 CTGCTGATTATTATGAAATGAGG + Intergenic
1149231102 17:54535748-54535770 CTGCTGGATTTTAAGAGGAAGGG - Intergenic
1149397978 17:56264304-56264326 CTGTTCATATTTCAGAAAAAGGG - Intronic
1149887541 17:60355451-60355473 TTGCTGCTTTTTTAGAAGAATGG - Intronic
1150441507 17:65195261-65195283 CCGCTGAATTTTAAATAAAATGG + Intronic
1150543288 17:66125917-66125939 CTGATGGTTTAAAAGAAAAATGG - Intronic
1152489857 17:80623334-80623356 TTGCTGATATATAAGAAAAATGG - Intronic
1152977638 18:238260-238282 CTGCTGAGTTATAAGATAAAAGG + Intronic
1153622147 18:6989592-6989614 CTCTTGATTTTTAAAATAAAAGG + Intronic
1154253120 18:12760819-12760841 CTTCTCTTTTTTAAAAAAAATGG - Intergenic
1154929170 18:20974191-20974213 CTTCTGATTTTTAGGAAGCAAGG + Intronic
1155283407 18:24264451-24264473 TTCTTGATTTTTCAGAAAAATGG - Intronic
1155589928 18:27415550-27415572 CTGAAGATTTGAAAGAAAAAAGG + Intergenic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1156730093 18:40183153-40183175 CTTCTTTTTTTTAAAAAAAAAGG - Intergenic
1158238482 18:55348334-55348356 CTCCTTATATTTCAGAAAAAAGG + Intronic
1158289941 18:55929132-55929154 CTATTGCTTTTTAAGAAAACAGG + Intergenic
1158792295 18:60796268-60796290 CTGCCAATTTTTACAAAAAAAGG - Intergenic
1158914358 18:62106695-62106717 CTGTTTATTTTTAAAGAAAAGGG - Intronic
1158989602 18:62855002-62855024 CTGCTGCTTTTTAAACTAAATGG + Intronic
1159409120 18:68047751-68047773 CAAATTATTTTTAAGAAAAAGGG + Intergenic
1159796623 18:72851965-72851987 CTCTTGATTTTTAAGTAGAAAGG + Intronic
1159802876 18:72922741-72922763 CTGATTTTTTATAAGAAAAATGG + Intergenic
1163365524 19:16873863-16873885 ATGCTAATTTTTAAGAAAAAGGG - Intronic
1165014907 19:32873785-32873807 CTGCTGATTTTGGGGAAAGAGGG + Intergenic
1165276310 19:34754969-34754991 CTGTTAAATTTTTAGAAAAAAGG + Intergenic
1168274629 19:55270562-55270584 CTACTGTTGCTTAAGAAAAAAGG + Intronic
925186721 2:1852009-1852031 CTGCTGAGCTTTAAGAATGAGGG - Intronic
925200294 2:1962123-1962145 CTGTTAATTTTTAAGATATAAGG + Intronic
926559035 2:14394947-14394969 CTGCTGATGTTGAAGACAGAGGG + Intergenic
927272972 2:21233056-21233078 CTGATGACTTCTAAGAGAAAAGG - Intergenic
927375214 2:22405424-22405446 CTGCTGACCATTAAGGAAAAGGG + Intergenic
928855194 2:35795135-35795157 CTACTGCTTTTTCACAAAAATGG + Intergenic
930379508 2:50610197-50610219 CTTCAGATTTTTAAAAAATATGG + Intronic
930437800 2:51368163-51368185 GTTCTGATTTTTAAAATAAAAGG - Intergenic
930960807 2:57259342-57259364 CTCCTGATGTTTAGGAAATAGGG - Intergenic
931003916 2:57826218-57826240 CTGATGATTTTTTTTAAAAAAGG + Intergenic
931833452 2:66075455-66075477 CTTCAGCTTTTTAAAAAAAAGGG - Intergenic
932071266 2:68622683-68622705 CTGGGGATATTTAATAAAAAAGG + Intronic
932122261 2:69112713-69112735 CTCCTGAAGTTCAAGAAAAAGGG - Intronic
933616941 2:84491816-84491838 CTGCCTATTTTTAAGACAGAGGG + Intergenic
935097829 2:99962747-99962769 TTGCTAATATTTAAAAAAAACGG - Intronic
936350842 2:111711419-111711441 CTCTTGGTTTTAAAGAAAAAAGG + Intergenic
936435278 2:112499530-112499552 CTAATAATTTTTCAGAAAAAAGG + Intronic
936953196 2:117998840-117998862 CTGATCATTTTTATGAAAATAGG - Intronic
937367116 2:121271254-121271276 CTTTTGCTTTTTAAGACAAATGG - Intronic
937788185 2:125926971-125926993 TTGCTTATTTGTAAAAAAAATGG + Intergenic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939932632 2:148254239-148254261 CTGCTGATTGTTAGGGATAAAGG + Intronic
940395186 2:153182008-153182030 CTGCTTATTATTAAGAAAAATGG - Intergenic
940458081 2:153927117-153927139 ATGATAATTTTTAAGAAAATGGG + Intronic
940766473 2:157795524-157795546 TTGCTGTTTTTTTAAAAAAATGG - Intronic
941484012 2:166056153-166056175 CTGTAGATTTTAAAGAAAAAGGG + Intronic
941651436 2:168096622-168096644 CTGCATATTTCTAAGAAAATAGG - Intronic
941983044 2:171480796-171480818 ATGCAGATTATTAACAAAAAAGG - Intronic
942438766 2:176009434-176009456 TTGCTGACTTTGAAAAAAAATGG + Intergenic
942779453 2:179623969-179623991 CTGCCAATTTTTAAAAAATATGG - Intronic
942785003 2:179690566-179690588 TTGCTGATTTTTTAAAAATAAGG + Intronic
942931664 2:181501310-181501332 CTGGTTATTTTAAAGAACAATGG + Intronic
943267910 2:185760284-185760306 CTGCTGATTGATATGTAAAATGG + Intronic
943359800 2:186904100-186904122 CTGTTGCTATTTAAGAAAAGAGG + Intergenic
944361343 2:198860942-198860964 CAGGAGATTTTTAAGAATAAGGG + Intergenic
944368911 2:198957904-198957926 TTGCTGACTGTTCAGAAAAATGG + Intergenic
944802609 2:203251309-203251331 CCCCTGATTTTAAAGCAAAATGG - Intronic
944981087 2:205120734-205120756 CTTCTGAGTTTCAAGAAATAGGG + Intronic
945842357 2:214903222-214903244 CTGTTAATTTTTCAGAATAAAGG + Intergenic
946066606 2:216993012-216993034 CTGTTGATTTTCAACAAAGATGG - Intergenic
946257413 2:218455187-218455209 ATGCTGATTTTTAAGAATAGAGG + Intronic
946612894 2:221478395-221478417 GTCCTGATGTTTATGAAAAATGG - Intronic
946765659 2:223037693-223037715 CTGCTGAGTATAGAGAAAAAAGG + Intergenic
947265061 2:228269520-228269542 GTGATGATTTTTAAGGAAACTGG + Intergenic
947283964 2:228489350-228489372 CTGCTCACTTTTAACATAAAGGG + Intergenic
947649113 2:231769399-231769421 CTGCTAAAGATTAAGAAAAAGGG - Intronic
948156279 2:235785218-235785240 CTTCTCACTTTTAAGAAAAATGG - Intronic
1168734247 20:116193-116215 CTGCTGCTTTTTGAGAAGGAAGG - Intergenic
1169496796 20:6123136-6123158 CTGCAGATTTTTAAGGGCAAAGG + Exonic
1169653666 20:7897589-7897611 CTTCTGATTTTTTTAAAAAAGGG - Intronic
1169739410 20:8875166-8875188 ATGCTCATTTTTCAGAGAAATGG + Intronic
1169966520 20:11223831-11223853 CTGCTTTTTTTTTAAAAAAATGG + Intergenic
1170449034 20:16462697-16462719 GGGCTGCTTTTTAATAAAAAGGG - Intronic
1170488714 20:16847735-16847757 ATGCTGTTTTTAAAAAAAAATGG - Intergenic
1172413569 20:34744875-34744897 GGGCTGATTTTAAAGATAAAAGG - Intronic
1172904197 20:38356760-38356782 ATTCTGATTTATAACAAAAATGG + Intronic
1173158838 20:40637611-40637633 CTATTGATTTGTAATAAAAATGG - Intergenic
1174051661 20:47771438-47771460 CAGCTTATTTTTAAGTAGAAAGG + Intronic
1174436323 20:50509912-50509934 CTCCTGAGTTTCATGAAAAAAGG + Intergenic
1176286873 21:5023047-5023069 CTGCTGATTTCCTAGAAGAAGGG + Intronic
1176383235 21:6124178-6124200 CTGCTGCTTTATGAGAACAAAGG + Intergenic
1177338350 21:19762987-19763009 CTGCTGATTTTCATCAAAATTGG + Intergenic
1178387833 21:32169161-32169183 CTGCTGGTTTTTAAGCTGAAAGG - Intergenic
1179608242 21:42532220-42532242 CTGCTTATTTATGAAAAAAAGGG + Intronic
1179740232 21:43414061-43414083 CTGCTGCTTTATGAGAACAAAGG - Intergenic
1179870308 21:44240428-44240450 CTGCTGATTTCCTAGAAGAAGGG - Intronic
1182312430 22:29418806-29418828 CTTCTGGTTTTTAAAAAGAATGG - Intronic
1183193852 22:36339700-36339722 CTGCAAAGTTTAAAGAAAAAAGG + Intronic
1183922510 22:41180551-41180573 CTGCTGATTTTTAGTAGAGATGG - Intergenic
1184124397 22:42476803-42476825 CTGGAGTTTTTAAAGAAAAAAGG - Intergenic
1184560708 22:45261404-45261426 GTGCTGAGTCTTAAGGAAAACGG - Intergenic
1184963418 22:47948554-47948576 CTGTTCAATTTTAAGAAAATTGG + Intergenic
949380849 3:3444086-3444108 GTGTTGATTTGTTAGAAAAAAGG + Intergenic
949977565 3:9474985-9475007 CTGGTGATTTAAATGAAAAATGG + Intronic
950236324 3:11324147-11324169 CTGCTGATTTGTATTACAAAAGG + Intronic
950952156 3:17011718-17011740 CTGCTGATTGTGCAGAACAAAGG + Exonic
951791510 3:26490630-26490652 CTCTTGATTTTCAACAAAAATGG + Intergenic
951823760 3:26843980-26844002 ATGATGATTTTTTAGAAAAGTGG - Intergenic
951928314 3:27935027-27935049 CTGTTGATTTTTAAGAGATTAGG - Intergenic
951962441 3:28343473-28343495 CTGCTGAATTTTAAAAACACAGG + Intronic
952029874 3:29128878-29128900 CTGATTATTTTTAAAAAGAAGGG + Intergenic
952163611 3:30721580-30721602 TTGAGGATTTTTAAGAAAAGTGG + Intergenic
952225102 3:31367167-31367189 CCCCTGAATTTTATGAAAAAAGG - Intergenic
952324847 3:32311963-32311985 CTTCAGCTTTTAAAGAAAAAAGG + Intronic
953900348 3:46837216-46837238 CTGCTGAATTTCAACATAAATGG - Intergenic
954202380 3:49031471-49031493 GTGCTGATATTTAAAAAAATGGG + Intronic
954843348 3:53532590-53532612 CTCTTGATTTTTAAGAAAAGTGG + Intronic
955023872 3:55148294-55148316 CTGCTTATTTTTATGAACACTGG + Intergenic
955166454 3:56519043-56519065 CTGCTGATTGGTAAGAGAAATGG - Intergenic
955712174 3:61791943-61791965 GTGCAGAGTTTTAAGAGAAATGG + Intronic
956266578 3:67403353-67403375 CTACTGATTATTAAAAAAATGGG - Intronic
956378588 3:68642187-68642209 TTGATGATTTTTAACAAGAAAGG + Intergenic
956703429 3:71979156-71979178 CTAGTGTTTTTAAAGAAAAAAGG + Intergenic
957464385 3:80567819-80567841 CAGCTGATTTATATGGAAAAAGG + Intergenic
957598867 3:82306039-82306061 CTGCTCATTTCAAAGAAACATGG + Intergenic
958190976 3:90184827-90184849 CTGCTGATTCTTTAATAAAAAGG + Intergenic
958413178 3:93843957-93843979 CTGCTGATTCTTTAATAAAAAGG + Intergenic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
959141224 3:102488859-102488881 CTGACGATTTTTGAGAGAAATGG + Intergenic
959770368 3:110088061-110088083 CTGCTGATTTCAAAGAAAAAGGG - Intergenic
960023650 3:112984401-112984423 CTGGAGATTTTTGAGAAAAGTGG - Intergenic
960255899 3:115511340-115511362 TTGCTGGTTTTGAAGAAGAAAGG + Intergenic
961800201 3:129441748-129441770 CGGCTGTGTTTCAAGAAAAATGG - Intronic
962526527 3:136242582-136242604 CTGGTGACTCATAAGAAAAAGGG + Intergenic
963704202 3:148665509-148665531 CTGCTGTTTTCCAAGAGAAATGG - Intergenic
964296861 3:155242726-155242748 CTTAACATTTTTAAGAAAAATGG - Intergenic
965612578 3:170560386-170560408 CTACAGATGTATAAGAAAAAAGG + Intronic
965787006 3:172346020-172346042 ATGCTGATTTTTGACAAAACAGG - Intronic
966951451 3:184822191-184822213 CTGGTCATTTCTAAGAAAAGTGG + Intronic
967443850 3:189541729-189541751 CTTCTGATTTTTGCGAATAAGGG - Intergenic
967491679 3:190099026-190099048 GTGCTTTTTTTTAAGAAAAAGGG + Intronic
970349021 4:15182516-15182538 CTCCTGCTTTTTCAGCAAAAAGG - Intergenic
970770671 4:19608477-19608499 TTGCTGATTTGTAAGAAAAAGGG + Intergenic
970943994 4:21668969-21668991 TTGCTGATTTTTAGGCAAAGTGG - Intronic
971152501 4:24048501-24048523 TTCCTGAGTTTTAAGAAAATGGG - Intergenic
971834536 4:31746704-31746726 CTCAAGATTCTTAAGAAAAAGGG - Intergenic
971871326 4:32243087-32243109 CTGCTGAAATGTAATAAAAAGGG + Intergenic
971887118 4:32464687-32464709 CAGCAGATTTTTTAGAAATATGG + Intergenic
971903631 4:32696843-32696865 CTGCTGATTATTATAAGAAAAGG - Intergenic
972240292 4:37183839-37183861 CTCCTGATTTTTAAAAATTAGGG + Intergenic
972247092 4:37256674-37256696 CTTCTGAATTTTAAAACAAATGG - Intronic
972251526 4:37307899-37307921 CTCTTGATTTTTTAAAAAAATGG + Intronic
973305637 4:48646063-48646085 AAGCTTATTTTAAAGAAAAAAGG + Intronic
974141247 4:57890337-57890359 GAACTTATTTTTAAGAAAAATGG + Intergenic
974212884 4:58804664-58804686 ATTCTGTTTTCTAAGAAAAAAGG - Intergenic
974889293 4:67860186-67860208 CTGCCGATTTTTAATAATATGGG - Intronic
975074375 4:70186576-70186598 CTGGTGATTTTTATTTAAAATGG + Intergenic
975814180 4:78200440-78200462 CTGCTGATTATTATGAAAGCAGG + Intronic
975853166 4:78594483-78594505 CTGCTGATATGAAAGCAAAATGG - Intronic
975924689 4:79434666-79434688 CTACTAATATTTGAGAAAAATGG - Intergenic
976200488 4:82573181-82573203 CTGCTGATGTTAATGTAAAATGG - Intergenic
976819971 4:89195161-89195183 CTGCTGATTTTTAGGCATGAAGG - Intergenic
976983585 4:91264079-91264101 CTGCTGACTTTTAACAAACCAGG + Intronic
977241395 4:94574534-94574556 CTGTTTAATTTTAAGAAAAAAGG - Intronic
977618489 4:99110189-99110211 CTGCTTTTTTTTAATAAAGAGGG + Intergenic
978051523 4:104206410-104206432 ATTCTGATTTCTAATAAAAATGG - Intergenic
978054406 4:104245656-104245678 CTGAGGGTTTTTAAGATAAAGGG + Intergenic
979200435 4:117971431-117971453 CTGCTGCTGTTTAAGGTAAAGGG - Intergenic
979243016 4:118465816-118465838 CTGCTGTGTTTTCAGTAAAAGGG - Intergenic
979500362 4:121433568-121433590 CTGATGGTTTTTAAAAAAATGGG - Intergenic
979579096 4:122334627-122334649 ATGCACATGTTTAAGAAAAAAGG + Intronic
979666658 4:123318145-123318167 CTCCTGATTTTCCAGAAACATGG - Exonic
979967693 4:127095307-127095329 CTTCTAATTTTTCAGAAATAAGG + Intergenic
979996432 4:127437273-127437295 CTCTTCATTTATAAGAAAAATGG + Intergenic
980243390 4:130204557-130204579 GTGCTGATTTTTAATATACAAGG + Intergenic
980884534 4:138747774-138747796 CTGCTGATTCTTATGAAAATAGG + Intergenic
981067831 4:140504281-140504303 ATGCTGAAGTTTAAGAAGAATGG - Intergenic
981449227 4:144876827-144876849 TTGCTGATATTTAAAAAACAAGG + Intergenic
981572325 4:146165825-146165847 CAGCTGTTTTCAAAGAAAAAGGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
982352992 4:154436287-154436309 CTTAATATTTTTAAGAAAAATGG - Intronic
982423722 4:155230313-155230335 CTGATTTTTTTAAAGAAAAAAGG - Intergenic
983030385 4:162794061-162794083 GTGGTGATTTTTGAGGAAAAAGG + Intergenic
983126280 4:163955054-163955076 TTTCTTATTTTTAAGAAATATGG + Intronic
984438934 4:179740933-179740955 CAGCTGATGTTTAAGAATAAAGG + Intergenic
984600150 4:181717111-181717133 CTGCTGACTTCTAAGTAAACAGG + Intergenic
986159260 5:5210212-5210234 CTTCTGTTTGTTAAGGAAAATGG + Intronic
986318024 5:6604167-6604189 CTGCTGAGTTTTCTAAAAAAGGG + Exonic
986752275 5:10798700-10798722 CTGTTAATTTTTCATAAAAAAGG + Intergenic
987105705 5:14636778-14636800 CAACTGATTTTTAAGCAAACTGG + Intergenic
987111109 5:14687751-14687773 TGGCTGATTTTTAGGCAAAATGG + Intronic
987369180 5:17177435-17177457 CTGCTGGTTATTTAGAAATAAGG + Intronic
987499554 5:18690654-18690676 CTCCTCATATTGAAGAAAAAAGG - Intergenic
987520885 5:18981876-18981898 CTGGTGATGTTGAAGAGAAAGGG - Intergenic
987574064 5:19703515-19703537 CTCATTATTTTGAAGAAAAAGGG + Intronic
988227270 5:28428295-28428317 TTGATGACTTTCAAGAAAAAAGG - Intergenic
988429067 5:31098308-31098330 CTTCAGATTTCTAAGGAAAATGG + Intergenic
989445133 5:41519104-41519126 TTGCTTTTTTTTAAAAAAAAGGG - Intergenic
990278065 5:54220716-54220738 CTGCTGATTTCAGAGATAAATGG - Intronic
990428965 5:55716180-55716202 CTCCTCTTTTTTAAGGAAAAAGG + Intronic
990460626 5:56027997-56028019 CTCCAGTTTTTAAAGAAAAAAGG + Intergenic
990659285 5:57995242-57995264 CTGCAGACTTGTAAGAAAAATGG + Intergenic
990820141 5:59829800-59829822 CTACTGCTTTTTAAGTAATATGG - Intronic
990939958 5:61192040-61192062 CTGCTGTGTTTTGAGAAATATGG - Intergenic
992045692 5:72886724-72886746 CAGCTGATTTTTAGGAGAGACGG - Intronic
992352754 5:75947890-75947912 CTCTTGATTTTAAAAAAAAATGG - Intergenic
992821212 5:80498323-80498345 CTGCAGAATTTAAAAAAAAAAGG - Intronic
992841731 5:80701992-80702014 CTGTTGTTTTTTCAGAAAGAAGG - Intronic
992946325 5:81814427-81814449 CTGCTGAGTTTAAAGAGAATGGG - Intergenic
993372690 5:87112004-87112026 TGGCTGATTTTTAAGAAAGAAGG - Intergenic
993589289 5:89774661-89774683 CTGCTGATATTTTTGAAACAAGG + Intergenic
993689536 5:90982388-90982410 CTTTTGGTTTTTAAAAAAAATGG + Intronic
994221524 5:97201286-97201308 CTGGGAATTTTTAAGAAAAGAGG + Intergenic
994416206 5:99475018-99475040 GTTGTGATTTTTAAGAAATATGG + Intergenic
994433143 5:99694660-99694682 CCGTTAATTATTAAGAAAAAAGG + Intergenic
994463763 5:100100154-100100176 GTTGTGATTTTTAAGAAATATGG - Intergenic
995050660 5:107699124-107699146 CTACTAATTTTTAAGAATATTGG + Intergenic
995126970 5:108587778-108587800 CAGCAGATTCTTAAGAGAAAAGG + Intergenic
995507313 5:112873829-112873851 TTGCTGGTTTTTAAGATAGAAGG + Intronic
995547991 5:113252026-113252048 CTGTTGATTTTTGTGGAAAAAGG - Intronic
996186179 5:120477974-120477996 CTGATGATTATTAAGAAAAAAGG - Intronic
996376150 5:122809963-122809985 CTGAATATTTTTAAGAATAAAGG + Intronic
996408805 5:123133480-123133502 ATTCTGACTTTTAATAAAAAAGG - Intronic
998515119 5:142746295-142746317 ATGCTGATTTTTAAAATAAATGG + Intergenic
998912377 5:146973956-146973978 CTGCAGATTTTAAAGAAGGATGG - Intronic
999997448 5:157105878-157105900 CTTCTGCTTTTTAAGAGATAGGG + Intronic
1000276421 5:159739822-159739844 CTCCTTATTTTAAAGAGAAAAGG - Intergenic
1000713647 5:164612303-164612325 CTGCTGATTTCTCTGAAACAAGG - Intergenic
1001082200 5:168675693-168675715 TTGTTGTTTTTTAAGAAATAGGG - Intronic
1001084446 5:168690588-168690610 CTGCTGATCTTTACGAAGTATGG - Intronic
1001143476 5:169164364-169164386 CTGCTGCTTCTTCAGGAAAAGGG - Intronic
1001467277 5:171978670-171978692 CAGCTGGCTTTTAACAAAAATGG + Intronic
1002405858 5:179030526-179030548 CTCATGATTTTTAAGTGAAATGG + Intronic
1003765993 6:9237340-9237362 ATGCTAATGTTTAATAAAAATGG + Intergenic
1003810066 6:9769482-9769504 CTGCTGAATTTCAAGAACACCGG + Intronic
1004352941 6:14906640-14906662 ATTCTGACTTTTAAGTAAAATGG + Intergenic
1004624187 6:17359192-17359214 CTGGTAATTTATAAGAAAAGAGG - Intergenic
1005139012 6:22605078-22605100 CGGCAGGTATTTAAGAAAAAAGG + Intergenic
1008069443 6:47084809-47084831 CTGCAGATTCCTAAGAAGAAGGG - Intergenic
1008307050 6:49916255-49916277 CTGTTGAATTTTATTAAAAAAGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009266427 6:61561394-61561416 CTACTGATTTTTAAGCCATAGGG - Intergenic
1009951411 6:70400997-70401019 CATGTGATTTTTAAAAAAAATGG - Intergenic
1010191013 6:73196529-73196551 CTGCTTATATATAAGAATAAGGG - Exonic
1010668645 6:78659396-78659418 CTGCAGATTTTTAACTACAATGG - Intergenic
1010808244 6:80264700-80264722 GTGATGCTTTTTAAGAAAAGAGG + Intronic
1010843161 6:80672420-80672442 CTACTGATCCTTAAGAACAAGGG - Intergenic
1011192998 6:84752921-84752943 CCTCTAATTTTTAATAAAAATGG + Intronic
1011350909 6:86422804-86422826 CTGATGATTTTTAAGAGAGTAGG + Intergenic
1011362501 6:86542886-86542908 TTGGTGATTTTGCAGAAAAAAGG + Intergenic
1011749637 6:90442098-90442120 CTCCTTATTTAAAAGAAAAAAGG - Intergenic
1011845447 6:91558391-91558413 CTTTTGATTTTTATGCAAAATGG + Intergenic
1011887174 6:92110396-92110418 CTGGAGCTTTTAAAGAAAAAAGG + Intergenic
1012118487 6:95334350-95334372 GTGCTGATATTCAAGAAAATGGG - Intergenic
1012512138 6:100014282-100014304 ATTCTGATTTTTAATAACAAAGG + Intergenic
1012717707 6:102698469-102698491 CTGCTGATTTTAGAGACATAGGG - Intergenic
1013169523 6:107623943-107623965 TTTCTCATTTTTAAGTAAAATGG + Intronic
1013441612 6:110177187-110177209 CTGCAAATTTGTAACAAAAAGGG + Intronic
1013719353 6:113004552-113004574 CTGCTGATTTTAACCAAAAAAGG + Intergenic
1014057595 6:117034317-117034339 ATCCTGATTGTTAAGAAATAGGG + Intergenic
1014411716 6:121131486-121131508 TTGCTGATTTCTGAGAAAATTGG - Intronic
1014857336 6:126417814-126417836 TTGATGACTTTTAAGCAAAATGG - Intergenic
1015810064 6:137153556-137153578 CTTCTGGTTTATAACAAAAATGG + Intronic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1016649556 6:146448294-146448316 CTGCTGCTTTTTAAGGAGAATGG + Intergenic
1017240340 6:152161482-152161504 ATGCTTTTTTTAAAGAAAAATGG + Intronic
1017540748 6:155399977-155399999 CTGCTGACTTTGATGAGAAAAGG + Intronic
1017809380 6:157973926-157973948 GTGCTGATGTTGAAGAGAAATGG + Intergenic
1018012941 6:159688360-159688382 GTGCTGAATTTTAGGACAAACGG - Intronic
1018446729 6:163865187-163865209 CTGCTGTTATTTAAACAAAATGG - Intergenic
1018598594 6:165512980-165513002 CTGTTGACTTTTAAAAAAATGGG + Intronic
1020656539 7:10935183-10935205 CTGCTTAGTTTTAAGAAAATTGG - Intronic
1020878251 7:13725776-13725798 CTGCTGAATTTTTAAAAATATGG + Intergenic
1021063254 7:16140470-16140492 CTACTGATTTTTAAGAAGTATGG + Intronic
1021127695 7:16872315-16872337 CAGCTGATTTTTAACAAAGGTGG + Intronic
1021605592 7:22406215-22406237 CTGGTGTTTTTTAAGAAGAGGGG + Intergenic
1022046329 7:26625244-26625266 CTGCTAGTTTCTAAGTAAAATGG - Intergenic
1022703192 7:32780446-32780468 CTGGTGAATGTTAAGAAAAATGG + Intergenic
1022907424 7:34870580-34870602 CTGGTGAATGTTAAGAAAAATGG + Intronic
1023419925 7:39968408-39968430 CTGTTTATTTTTAAGACACAGGG + Intronic
1023461267 7:40399811-40399833 CTCCTGATATTAGAGAAAAATGG + Intronic
1023590072 7:41772170-41772192 CTGATGCTGTTAAAGAAAAAAGG + Intergenic
1023656699 7:42429867-42429889 CTAGAGATTATTAAGAAAAAAGG + Intergenic
1024430674 7:49284794-49284816 CTTATGTTTTCTAAGAAAAAGGG - Intergenic
1026038802 7:66848481-66848503 CTGGTCAGTTTTCAGAAAAATGG + Intergenic
1026392451 7:69915354-69915376 CTGCTTATTTTTAAAAATAAAGG + Intronic
1027631104 7:80607469-80607491 CTACTGATTTTTTACAAATAAGG + Intronic
1027640591 7:80728859-80728881 ATGCTTATTTTAAAGACAAAGGG - Intergenic
1028311350 7:89341147-89341169 CTCTTGCTATTTAAGAAAAATGG - Intergenic
1028321908 7:89469469-89469491 AGGGTGATTTTTAAGAATAAGGG - Intergenic
1028705229 7:93835705-93835727 CTGGTGATATTTTACAAAAATGG + Intronic
1028713253 7:93935285-93935307 CTGCTTGTTTTTATAAAAAATGG - Intergenic
1028899211 7:96076838-96076860 TGGCTGATTTTTAAAATAAATGG - Intronic
1029206600 7:98872765-98872787 ATGCCCATTTTAAAGAAAAAGGG - Intergenic
1029648543 7:101874371-101874393 CCGCTGCTTTTTAAGTAAAATGG - Intronic
1031546453 7:123055897-123055919 ATTCTGATTTTTAATATAAATGG - Intergenic
1031636728 7:124109921-124109943 CTCCTGATTCTTGAGATAAAAGG - Intergenic
1031957437 7:127956643-127956665 CTGCTGAGTTCTAAGAACAGGGG + Intronic
1032943840 7:136827155-136827177 CAGGTAATTTATAAGAAAAAAGG - Intergenic
1032990804 7:137393223-137393245 CTGCTTTTTTTAAAAAAAAATGG - Intronic
1033031113 7:137827678-137827700 CTGCTGATGTCTAAGAAGCACGG + Intronic
1033366562 7:140676573-140676595 GAGCTGATTTTTAAGACAAATGG - Intronic
1034578735 7:152025002-152025024 TTGGCAATTTTTAAGAAAAATGG - Intergenic
1035193680 7:157196129-157196151 GTGCTGGTTTTTAAGATAGAAGG + Intronic
1036542560 8:9731625-9731647 GTGGTGATTTTTAACACAAATGG + Intronic
1037746447 8:21649335-21649357 CTGGTAATTTATAAGAAAAGAGG + Intergenic
1037895459 8:22650008-22650030 CTCCTGATTTTTAAGAGCTACGG + Intronic
1038374484 8:27024861-27024883 GTGCTGCTCTTTAAGAAATACGG - Intergenic
1039163810 8:34653251-34653273 CTACTGATGTTTATGTAAAATGG + Intergenic
1039416062 8:37394909-37394931 CTGATCTATTTTAAGAAAAAAGG - Intergenic
1039596768 8:38797466-38797488 CTGCTCCTGTTTAAGAAAGAGGG - Intronic
1039739166 8:40364634-40364656 GTACAGGTTTTTAAGAAAAAGGG - Intergenic
1040680860 8:49806923-49806945 TTGATGAATTTTAAGCAAAATGG + Intergenic
1040839187 8:51766351-51766373 CTTCTGATTTAAAAGAAAACTGG - Intronic
1042587392 8:70356586-70356608 CTGCTTGTTTTTTAGGAAAAAGG - Intronic
1042646441 8:70992314-70992336 TTGCTGCTTTTTAAGAAATTAGG + Intergenic
1042935369 8:74052916-74052938 CTTCTGATTTTTGAAAAGAAGGG + Intergenic
1043237376 8:77884981-77885003 TTGCTGATTTATAAGGATAAAGG + Intergenic
1043507150 8:80913465-80913487 CTGTTGGATTTTAAGCAAAAAGG + Intergenic
1044557333 8:93577843-93577865 CTGCAGATTTTTAACAAGATGGG - Intergenic
1045307374 8:100969960-100969982 CTCCTTATTTTTAAAAAAGAGGG + Intergenic
1045549794 8:103161361-103161383 CTTTTCATTTTTAAGATAAAAGG + Intronic
1045742485 8:105377589-105377611 TTTTGGATTTTTAAGAAAAACGG - Intronic
1045846917 8:106647948-106647970 CTGCAAATCTTTAAGCAAAATGG - Intronic
1045910855 8:107407931-107407953 CTGCTGAGTTTTCATAATAATGG - Intronic
1046095488 8:109554649-109554671 TTGATGATTTATTAGAAAAATGG - Intronic
1046504530 8:115120359-115120381 CTGATGATTTTCAAGTGAAATGG - Intergenic
1047042856 8:121017251-121017273 CTGGTGATTTAATAGAAAAATGG + Intergenic
1047378675 8:124333101-124333123 CTTCTGATTTTAAAAAAAATTGG - Intronic
1047392036 8:124459999-124460021 CTTCTCCTTTTTAAGAGAAAGGG - Intronic
1048252051 8:132874792-132874814 TTTCTGATTTTAAAGAACAAGGG + Intronic
1049958895 9:719272-719294 ATGTTTGTTTTTAAGAAAAAGGG - Intronic
1049996006 9:1034645-1034667 ATGCTAATATTTAAGAAGAAGGG - Intergenic
1050105306 9:2159445-2159467 CTGCTATTTTTTAAAAAATAAGG + Intronic
1050257218 9:3807716-3807738 CAGCTGATTTCTAAGTGAAAAGG + Intergenic
1051818014 9:21132562-21132584 CTGCTGATATTTTAGAAAGAGGG + Intergenic
1052221380 9:26027559-26027581 TTGCTGAATTTTAAGGAAACTGG + Intergenic
1052624591 9:30958881-30958903 CTGCTGAGTTTTAATCATAAAGG + Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053743136 9:41162704-41162726 CTGCTCATTTTTAAGAACACTGG - Intronic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1054685208 9:68268585-68268607 CTACTCATTTTTAAGAACACTGG + Intronic
1055143198 9:72899977-72899999 CTGCTAATTTGGAAAAAAAAAGG + Intergenic
1055848593 9:80597064-80597086 CTGGTTATTTTCAACAAAAATGG - Intergenic
1056408854 9:86304687-86304709 CCGGGGATGTTTAAGAAAAAGGG + Intronic
1057527977 9:95819254-95819276 CTGCTAATTTTTAGTAAAGATGG - Intergenic
1057687065 9:97244222-97244244 CTGTTGCTTTTTAAAAACAAAGG - Intergenic
1058179746 9:101782432-101782454 CTGATGATTTCTAAGAATATAGG + Intergenic
1058354493 9:104067094-104067116 CTGAGGACTTTGAAGAAAAATGG - Intergenic
1058819237 9:108713766-108713788 CTGCTGGTTTTTAAGACCATTGG - Intergenic
1059224747 9:112661298-112661320 CTGCTGATTTTTAAATAATGTGG - Exonic
1059517908 9:114913041-114913063 CTTCTGATATTTTAGAAAACAGG + Intronic
1059604604 9:115820674-115820696 CTGTTGAGTTTTCAAAAAAAAGG + Intergenic
1059798933 9:117730186-117730208 CTGCAGATTTTTTTAAAAAAAGG - Intergenic
1059935906 9:119310422-119310444 CTGCTGGGTTTTAATTAAAAAGG + Intronic
1060336402 9:122727263-122727285 CTTCTGTTTTTTAAGAGACAGGG + Intergenic
1060640151 9:125231490-125231512 TTGCTCATTTGTAAGAAGAAAGG + Intronic
1062339031 9:136085771-136085793 CTTCAGATGTTTAAGAAAAAAGG - Intronic
1186391508 X:9164496-9164518 CTGGTAATTTATAAGAAAAGAGG + Intronic
1186899135 X:14034141-14034163 CTTGTAATTTTAAAGAAAAAGGG - Intergenic
1187609709 X:20928931-20928953 CTCCTTGTTTTTAAGAAAAGTGG - Intergenic
1187673127 X:21688490-21688512 TTTAGGATTTTTAAGAAAAAAGG - Intergenic
1189746398 X:44173036-44173058 AAGCTGAATTATAAGAAAAATGG + Intronic
1190382258 X:49851182-49851204 TTGATGATTTTTTAAAAAAATGG + Intergenic
1190780444 X:53589462-53589484 ATGCTGATTTTTCAGAAATCAGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191862876 X:65680174-65680196 ATGCTGAGTTTTAAAAAAAGGGG - Intronic
1191995435 X:67090026-67090048 CTTCTAAGTTTTAAGGAAAAAGG - Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1193258748 X:79380361-79380383 CTGCAGATTTTGAAGAATACAGG + Intergenic
1193656477 X:84204168-84204190 CTGTAGATTTTTGAAAAAAAAGG - Intergenic
1193848073 X:86499612-86499634 CTGCTAAATGTTAAGAAAAATGG + Intronic
1194687503 X:96940700-96940722 GTGCTGTTTTTTAAGCAACAAGG + Intronic
1195263300 X:103154999-103155021 CTGCTGGTGGTTATGAAAAATGG - Intergenic
1195552793 X:106187139-106187161 CTGGGGAATTTAAAGAAAAAAGG - Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196089174 X:111720985-111721007 CTCCTGATTTTTAAAATATATGG + Intronic
1196091774 X:111751714-111751736 AAGCTGATTTTAAAAAAAAATGG + Intronic
1196362652 X:114883176-114883198 TTGCTGATCTTTCAGAAATATGG - Intronic
1196372144 X:114991188-114991210 CTGCTGATTTTGAAGAAACTTGG - Intergenic
1196596621 X:117553161-117553183 CTTCTTATTTTTAAATAAAATGG + Intergenic
1197413299 X:126144757-126144779 TGGCTGATTTATAAGAAAACAGG + Intergenic
1197721378 X:129747088-129747110 CTTCTGAGTTTAAAAAAAAAAGG + Intronic
1197797895 X:130317730-130317752 ATGCCTATTTTTAAGAATAATGG - Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1200753653 Y:6969810-6969832 CTGTGGATTTTAAAAAAAAAAGG + Intronic
1201356756 Y:13104795-13104817 CTGCTGATATTTGACAAAAGTGG + Intergenic
1201772303 Y:17626869-17626891 CTGTTGGGTTTTTAGAAAAAAGG + Intergenic
1201829252 Y:18279117-18279139 CTGTTGGGTTTTTAGAAAAAAGG - Intergenic
1202038851 Y:20662256-20662278 TTGCTGAAGTTGAAGAAAAAGGG - Intergenic