ID: 1143764050

View in Genome Browser
Species Human (GRCh38)
Location 17:9126046-9126068
Sequence TTGCAGAAGCAGAGTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 1, 2: 6, 3: 45, 4: 459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143764045_1143764050 -9 Left 1143764045 17:9126032-9126054 CCCAGCCAGCCTGATTGCAGAAG 0: 1
1: 0
2: 1
3: 25
4: 297
Right 1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG 0: 1
1: 1
2: 6
3: 45
4: 459
1143764044_1143764050 -8 Left 1143764044 17:9126031-9126053 CCCCAGCCAGCCTGATTGCAGAA 0: 1
1: 0
2: 0
3: 22
4: 307
Right 1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG 0: 1
1: 1
2: 6
3: 45
4: 459
1143764046_1143764050 -10 Left 1143764046 17:9126033-9126055 CCAGCCAGCCTGATTGCAGAAGC 0: 1
1: 0
2: 2
3: 20
4: 223
Right 1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG 0: 1
1: 1
2: 6
3: 45
4: 459
1143764043_1143764050 3 Left 1143764043 17:9126020-9126042 CCAGGCATCGTCCCCAGCCAGCC 0: 1
1: 0
2: 0
3: 25
4: 304
Right 1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG 0: 1
1: 1
2: 6
3: 45
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143764050 Original CRISPR TTGCAGAAGCAGAGTCAGGA TGG Intronic
901110437 1:6789076-6789098 TTGCAGAAGCAGGATAAGTAAGG - Intronic
901197914 1:7450518-7450540 ATGCAGAAGTAGAGACAGGTGGG + Intronic
901269807 1:7942833-7942855 TTGCAAAAACAGAGTTAGGGAGG - Intronic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902705361 1:18200532-18200554 TGGCAGAGGCAGAGACCGGAGGG - Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903747551 1:25598366-25598388 TTGGACAAGCAGAGTCAAGGAGG + Intergenic
903805507 1:26002743-26002765 TTACAGTAGCAAAGTAAGGAAGG - Intergenic
903935987 1:26895220-26895242 GTGCTGAAGAAAAGTCAGGATGG + Intronic
904174653 1:28618160-28618182 TTACAGCAGCATAGTCAGGTAGG - Intronic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904630192 1:31835464-31835486 TTGCAGAATCAGACTCATGGAGG + Intergenic
905006566 1:34714621-34714643 CTGCGGAAGGAGAGACAGGAAGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
906835252 1:49076414-49076436 ATGCAGAACCAGAGACAGGGAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907901338 1:58744163-58744185 TAGCAAAAGAAGGGTCAGGATGG - Intergenic
908103099 1:60811540-60811562 TTGCAGAAGCATACCCAGAAAGG - Intergenic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910021696 1:82598213-82598235 TTACAGAAGCCAGGTCAGGATGG - Intergenic
910074479 1:83261222-83261244 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
910715111 1:90222300-90222322 TGGCAAAAGCAGTCTCAGGAGGG + Intergenic
912185991 1:107276411-107276433 TGGCATAAGCAAAGGCAGGAGGG - Intronic
912509899 1:110182171-110182193 TTTCAGAAGCAGAGTCAAAAGGG + Intronic
912858090 1:113189691-113189713 TTGCAGAAGCGAAGACAAGACGG - Intergenic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915942565 1:160128165-160128187 TTTCAGCAGCAGAGTTAGGGAGG - Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916044515 1:160989380-160989402 TTGCAGAAACAAACACAGGAAGG - Intergenic
916178715 1:162065270-162065292 ATGCAGAAGGAGAGACAGCACGG - Intergenic
916315310 1:163442283-163442305 CTCCATAAGGAGAGTCAGGAAGG + Intergenic
917716304 1:177741309-177741331 TGGCAGAAGGAGAGGCAGGGTGG - Intergenic
917904689 1:179576729-179576751 TTGAAGAATCATAGGCAGGAAGG + Intergenic
918261507 1:182800603-182800625 TTGCACCTGCAGAGTCAGGCAGG + Intronic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920583550 1:207135970-207135992 TTGCAGAACCTCAGTCAGCACGG - Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
924009779 1:239652233-239652255 TTGCAGATTCAGACTCAGTAGGG - Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1063355884 10:5397953-5397975 TTGCAAATTCAGAGTCATGAAGG - Intronic
1063465037 10:6237414-6237436 TTGCAGAAGGAGGCTTAGGAAGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1065455817 10:25905559-25905581 GTGCAAAACCACAGTCAGGAGGG - Intergenic
1066291922 10:34022295-34022317 TTGCAGCAGCAGAGCAAAGAAGG + Intergenic
1067526507 10:47042494-47042516 TTGCAGATTCAGTGTCAGGAGGG + Intergenic
1068731012 10:60357861-60357883 TTGCAGAAGGAGAGAGAGTAGGG - Intronic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070322915 10:75367886-75367908 TTTCAGAATCAGAGCCAGGAAGG - Intergenic
1070815740 10:79321949-79321971 TGAGAGAAGCAGAGTAAGGAGGG - Intergenic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071164398 10:82787636-82787658 TTGCAGAAGCAGCCTCAGCATGG - Intronic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1073253306 10:102134844-102134866 TAGCACAGGGAGAGTCAGGAAGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1075594192 10:123716074-123716096 TTGCCGAAACAGAGGAAGGATGG + Intronic
1075976249 10:126698109-126698131 ATGCAGAGGAAGAGTCTGGATGG - Intergenic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1076233427 10:128842260-128842282 TTCCAGAAGGAGAGAAAGGACGG + Intergenic
1076316517 10:129545628-129545650 TTGCAAAAGCAGAGGGAGGCTGG - Intronic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1077317685 11:1926672-1926694 CTGCAGAAGCAGCGTCATGGTGG - Intronic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077647828 11:3941925-3941947 TTTCGGAGGCAGAGGCAGGAGGG - Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1078034901 11:7793645-7793667 TTGGAGCAGGAGAGTCATGATGG + Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078369776 11:10735283-10735305 TGGTAGCAGCAGAGTCAGAATGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080693741 11:34582795-34582817 TAGCAGAAGCAGAGTCGAGTAGG + Intergenic
1081623621 11:44633918-44633940 TTGCAAATACAGAGTCAGGTTGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1084703048 11:70799982-70800004 TTGCAGTGGCAAAGTGAGGAAGG + Intronic
1084723215 11:70923144-70923166 TTGCAGTTGCATGGTCAGGAGGG + Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087008231 11:93489531-93489553 TTGAAGCAGGAAAGTCAGGATGG + Intronic
1087271270 11:96114470-96114492 TTGCAAAAGCAGAGATAGGTGGG - Intronic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1089562638 11:119352309-119352331 TGTCAGAAGCAGAGACAGGATGG - Intergenic
1090432692 11:126659667-126659689 GATCAGAAGCAGAGTCAGAATGG + Intronic
1090771002 11:129919871-129919893 TTGCAGCAGAAGAGGCAGGTGGG - Intronic
1091228044 11:133969807-133969829 TCCCAGAAGGACAGTCAGGAGGG + Intergenic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1093165777 12:15803441-15803463 TTCCAGAACCTGAGTCATGAAGG - Intronic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095327258 12:40910586-40910608 TTGCAGAAATAAAGTCAGCATGG + Intronic
1095344398 12:41132630-41132652 TTGCAAAAGAAGAGTAAGGCAGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096908235 12:54956264-54956286 TGGCAGCAGAAGAGACAGGAGGG - Intronic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097326847 12:58286996-58287018 TTGCAGAAGCAAATTCTGCAGGG - Intergenic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098113093 12:67145019-67145041 TTGCAGAAGAAGAAACAGAAAGG - Intergenic
1098224887 12:68311245-68311267 TGGCAGAAGACCAGTCAGGAAGG - Intronic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099996167 12:89781396-89781418 TTGCAGCAGCAGTGTCAGATAGG + Intergenic
1100390403 12:94141806-94141828 TTACAGCAGCAGAGGCTGGAAGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102378906 12:112446555-112446577 TAGCAGAAGAGGAGTAAGGAGGG + Intronic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103046964 12:117744152-117744174 TTCAAGCAGCAGAGGCAGGATGG - Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1104191873 12:126489686-126489708 TGGGAGTAGCAGTGTCAGGAGGG + Intergenic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104418761 12:128617595-128617617 GGGCAGATGCAGAGTCAGGTGGG + Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1107631344 13:42345658-42345680 TTTCAGATTCAGAGACAGGAAGG - Intergenic
1109073062 13:57794106-57794128 TTACAGAACCACAGTCAGAAGGG - Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1112759458 13:102677529-102677551 TGGCAGAAGCAGAGTTTGTATGG - Intronic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113596439 13:111537375-111537397 TTGCAGAGGCAGGGTCTGGAAGG + Intergenic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1114891708 14:26932798-26932820 TTGCAGAATAAGTGTCATGAGGG + Intergenic
1116304807 14:43238709-43238731 TTGCAGAGGAAGAGTAAGGTGGG - Intergenic
1117502411 14:56366513-56366535 TCTCAGAAGGAGAGTAAGGAAGG - Intergenic
1118315444 14:64723094-64723116 TTGCAGGTGCAGAGGCAGGCAGG - Intronic
1119002742 14:70897768-70897790 GTACAGAAGCAGAGGGAGGAAGG + Intergenic
1119383806 14:74244830-74244852 TTGAGGAAGAAGAGTCCGGAGGG + Intronic
1119497387 14:75091809-75091831 TTAAAGAAGCAGAGTAAGCATGG - Intronic
1119891520 14:78186032-78186054 TGGCAGAATCAGGGACAGGAAGG + Intergenic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120678056 14:87445335-87445357 TTGCAGAAATAGAGTTAGCAGGG - Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1121718515 14:96093008-96093030 TTTCAGAATCAGAGATAGGATGG - Exonic
1122036308 14:98951557-98951579 GTGCAGAAGCAAGGCCAGGATGG + Intergenic
1122314056 14:100815345-100815367 TGGCACACGCAGAGTCAGCATGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123401720 15:19993967-19993989 TAGCAGAAGCAGAGACACAAAGG - Intergenic
1123511063 15:21000628-21000650 TAGCAGAAGCAGAGACACAAAGG - Intergenic
1125975494 15:43947771-43947793 TTGCTGAAGCAGAGGCAGCTGGG + Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1127028040 15:54829837-54829859 TTGCAGGAGCAAGGTCAAGAAGG - Intergenic
1127203381 15:56684033-56684055 GTGCAGAAGCTGAGGCAAGAAGG + Intronic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128253970 15:66183739-66183761 ATGCAGATTCTGAGTCAGGAGGG + Intronic
1129389760 15:75214668-75214690 GTGCAGCAGGAGAGACAGGAGGG - Intergenic
1129701654 15:77771854-77771876 TGCCAGGACCAGAGTCAGGAAGG - Intronic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132150080 15:99452929-99452951 ATGCAGAAGCGGAGTCCGGCTGG + Intergenic
1133455851 16:5941872-5941894 TTTCTGAAGCAGACTCAGGCCGG - Intergenic
1134680881 16:16124637-16124659 TTGAAAAAGCAGTGCCAGGAAGG + Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136097008 16:27963847-27963869 ATGCAAAGGCAGACTCAGGATGG - Intronic
1137354489 16:47747145-47747167 TTCAAGAAGCAGAGTCTGAAGGG + Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1139548691 16:67661665-67661687 GTGCAGAAGCGGGGTGAGGAGGG + Exonic
1140735636 16:77895517-77895539 TGGCAGAAGCAGAGGAAGAAGGG + Intronic
1140863237 16:79037601-79037623 TCCCAGAAGCTGAGGCAGGATGG + Intronic
1141412127 16:83842560-83842582 TTGCTGAAACAAAGTAAGGAGGG - Intergenic
1141737975 16:85867821-85867843 TTGCGGAAACAGAGTCAGACTGG + Intergenic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1146522523 17:33537149-33537171 TGGCAGAGGCTGAGTCAGAAAGG - Intronic
1147359289 17:39921163-39921185 TGGGAGATGCAGGGTCAGGAGGG + Intronic
1147597406 17:41725780-41725802 TGGCAGAACCAGAGGCAGGTGGG + Intronic
1147613662 17:41815805-41815827 TTTCAGAAGTAAAGTGAGGATGG - Intronic
1147818823 17:43229604-43229626 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1147832106 17:43304306-43304328 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151985957 17:77543918-77543940 TTGTTGAAACAGAGTCAGGGTGG + Intergenic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157291964 18:46416018-46416040 TGCCAGCAGCAAAGTCAGGAAGG - Intronic
1158109432 18:53924208-53924230 TTGCAGAATAAGAGGCAAGAAGG + Intergenic
1158204726 18:54980133-54980155 TTACAGAAGCAGAGGCTTGAAGG - Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159325691 18:66913710-66913732 TTTCAAAATCAGAGGCAGGAAGG + Intergenic
1159409139 18:68048179-68048201 TTACAAAAACAGAGTCAAGAGGG + Intergenic
1160692928 19:468121-468143 TTTCAGAGGCCGAGGCAGGAGGG + Intronic
1160696314 19:486300-486322 GTGCAGAGGCTGAGTCCGGAGGG - Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1162764968 19:12913526-12913548 TTGCTGAAGTACAGCCAGGAAGG + Intronic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163890902 19:20012083-20012105 TGGCAAAAGCAGTGTTAGGAGGG + Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165094612 19:33403334-33403356 GTCCAGAACCAGAGCCAGGAGGG + Intronic
1165822519 19:38685585-38685607 TTTCAGAAGCAGAGTGAGTTTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167410415 19:49340804-49340826 GTGCAGGAGCAGAGCCAGGTGGG - Exonic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925591119 2:5511023-5511045 TTTCAGAAGCAGTGTCAGCCTGG - Intergenic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
929824084 2:45296462-45296484 GTGCAGAAGCAGTGTCACTAGGG + Intergenic
931000756 2:57779496-57779518 CTGCAGAAGAACAGTAAGGATGG - Intergenic
931328148 2:61249712-61249734 ATGCAGAAGAAGAGTCTGCAGGG + Intronic
931430073 2:62202319-62202341 TTTCAGAGGCAGAGAAAGGAAGG + Intronic
932362285 2:71118824-71118846 TTGCAGTGTCAGAGTGAGGAGGG - Intronic
932468684 2:71940013-71940035 GGGCAGAAGCAGGGCCAGGAGGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
933035469 2:77391898-77391920 TTGCCGTACCAGAGTCAGGCTGG - Intronic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
937962118 2:127468097-127468119 TTGAAGAAGCAGGCTCAGAAAGG - Intronic
938560876 2:132470842-132470864 TTACAGAAACAGTGTCAGGTGGG - Intronic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
941800113 2:169650404-169650426 TTGCAGAAGCTGAGGCTGAATGG - Exonic
942116176 2:172731321-172731343 TTCCAGAATCAGAGTAGGGAAGG - Intergenic
942224797 2:173805589-173805611 TTACAGAATCAGAATCAGCAGGG - Intergenic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942771542 2:179526711-179526733 TAGGAGAAGCAGTGTCAGCAAGG - Intronic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
944027936 2:195194452-195194474 TTCCAGAAGAAAACTCAGGAGGG + Intergenic
944495009 2:200298306-200298328 CTGCAGAAGACAAGTCAGGAGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945684183 2:212949315-212949337 TGGCTGAAGCAGAGTCAAGTTGG - Intergenic
947206636 2:227667066-227667088 GTCCAGAAGCAGAGCCAGGCCGG - Intergenic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
949044269 2:241863777-241863799 CTGCAGAAGCAGTTTCGGGATGG - Intergenic
1168960001 20:1862447-1862469 TCCCAGATGCAGAGCCAGGATGG - Intergenic
1170052636 20:12163425-12163447 TTTCAGCAGCAAAGTCAAGAGGG - Intergenic
1170075195 20:12411209-12411231 TTCTAGAAACAGAGTCAGGGAGG - Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1171181204 20:23092039-23092061 TTGCGGGAGTAGAGTCAGGGTGG - Intergenic
1171339062 20:24412899-24412921 TGGCAGAGGCAGAGGCAGAAGGG - Intergenic
1172285313 20:33736253-33736275 TTGCAGAGGCAGTTTCAGAATGG - Intronic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172884588 20:38222627-38222649 TTGCAGAGGGAGAGTGGGGATGG - Intronic
1173033271 20:39381931-39381953 TTGTACAAACAGAGTAAGGATGG + Intergenic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173979877 20:47215614-47215636 TTGGAGAGGCTGAGTCAGGGGGG - Intronic
1174163829 20:48570667-48570689 GTCCAGAAGCAGAGTCAAGCGGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1175170148 20:57074544-57074566 TTGCATAAGCAAAGTCCTGAAGG + Intergenic
1175234605 20:57501432-57501454 TTCCAGACTCAGAGTCAGAAGGG + Intronic
1175940631 20:62536036-62536058 CTCCAGAAGCAGAGTTGGGAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177807499 21:25888648-25888670 TTGCAGGAGCAAAATCGGGAAGG - Intronic
1178232259 21:30799652-30799674 TTGCAGAGACAGATTCAAGAAGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178366764 21:31994909-31994931 TTTGGGAAGCAGAGACAGGAGGG + Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1179020902 21:37640054-37640076 TTACAGAAGGAGACACAGGAAGG - Intronic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1179936425 21:44608038-44608060 TTCCTGGGGCAGAGTCAGGAGGG + Intronic
1180172574 21:46067495-46067517 TTCCAGAAGCAGAGGCCGGATGG + Intergenic
1181048572 22:20228068-20228090 ATGCAGAAGCCGAGCCAGGCTGG + Intergenic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1183388904 22:37532371-37532393 TTCCAGAGGCTGAGGCAGGAGGG - Intergenic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184981581 22:48099479-48099501 TTCCAGATGCAGAGCCAGGCTGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
951811474 3:26705425-26705447 TTGCAGAGGGGGAGTTAGGAGGG + Intronic
953108765 3:39911863-39911885 CTTCAGAAGCTGAGTAAGGAGGG - Intronic
953240830 3:41148002-41148024 TTTCAGAGGCTGAGGCAGGAGGG + Intergenic
954420860 3:50418405-50418427 TAGCACAAGCAAAGGCAGGAAGG - Intronic
954486766 3:50860288-50860310 TTGCAGAAGCAGTGCCAGAGAGG + Intronic
955376242 3:58399716-58399738 TTGCTGATGCAGGGTCAGAAAGG - Intronic
955905837 3:63806785-63806807 ATACTGAAGCAGAGTCAGGCAGG - Intergenic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957012041 3:75017901-75017923 TTGCAGAATCAGAGGTAGCATGG + Intergenic
957425624 3:80035489-80035511 TTTCAGAAGATAAGTCAGGATGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959057708 3:101584379-101584401 TTTGGGAAGCTGAGTCAGGAGGG - Intronic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
961319712 3:126064220-126064242 CCACAGGAGCAGAGTCAGGAGGG - Intronic
961751210 3:129095874-129095896 TTTTAGAAGCAGAGTCTGGCAGG + Intronic
961805713 3:129487933-129487955 TTCCAGAGGCAGAGTGGGGAGGG + Intronic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
962273797 3:133997233-133997255 TTGCAGAGGCAGAGGGAGTAGGG - Intronic
962739651 3:138353873-138353895 TGAGAGAAGCAGAGTCAGAAAGG + Intronic
964210600 3:154222808-154222830 TTGCAGAAAGGGAGCCAGGAGGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965539098 3:169854394-169854416 TTACAGAAAAAGAGTCAGCAGGG - Intronic
965564288 3:170095617-170095639 TGGCAGAAGTCGAGTAAGGAGGG - Exonic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
969380081 4:6789639-6789661 TTGCATAAACAGATTCATGATGG + Intronic
969461388 4:7331039-7331061 TGGCAGAAGCAGAGGCCTGAGGG + Intronic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
969833337 4:9817103-9817125 TGGCAGAGTCAGAGTCAGAAAGG - Intronic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972915178 4:43868393-43868415 TTGGAAAAGCAGAGTCACCAGGG + Intergenic
974201048 4:58641002-58641024 TTGGAGAAGCAGAGTACTGAGGG - Intergenic
974369795 4:61000733-61000755 TTCCAGAAGAAGAGAGAGGAAGG + Intergenic
975329768 4:73099946-73099968 TGGCAGAAGCAAAGTAAGTATGG - Intronic
975990445 4:80254315-80254337 TTTCAGAGGCAGAGGCAAGAGGG - Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
977086177 4:92601522-92601544 TAGCTGAAGCAGTGTCAAGAGGG + Intronic
978461349 4:108956847-108956869 TTGCAGAATCAGAATCCAGAGGG + Intronic
978721745 4:111918015-111918037 ATGCAGTGGCAGAGCCAGGAAGG - Intergenic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
982068496 4:151674918-151674940 CTGCAGACGCAGACCCAGGAGGG - Intronic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983766442 4:171490011-171490033 TTGCAGGAGCACAGGCAGAAAGG + Intergenic
984481842 4:180314171-180314193 TTTCAGAAGCCGAGTCATAAAGG - Intergenic
984617284 4:181913200-181913222 ACGCAGAAGCCGAGACAGGAAGG + Intergenic
984825229 4:183918544-183918566 TTGCAGAAGCACAGTTGAGAGGG + Intronic
985041373 4:185894881-185894903 TTCCTGAAGCACAGACAGGAGGG + Intronic
986805527 5:11305281-11305303 TGTCAGGAGCAGAGTCAGAATGG + Intronic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987397188 5:17435781-17435803 ATGCAAAAGCAGAGCCAGGTGGG + Intergenic
988949760 5:36244284-36244306 ATGCAGAAGTAGTCTCAGGAAGG - Intergenic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
990267109 5:54088859-54088881 TTGTAGCAGCAAATTCAGGATGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992622120 5:78604179-78604201 TATCAGAAGCAAAGTCAGGCCGG + Intronic
993139127 5:84008146-84008168 TTGCAGGAGTAAAGTGAGGATGG + Intronic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994281849 5:97914026-97914048 TTCCAGAGGCTGAGGCAGGAGGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
997948736 5:138224933-138224955 TTCCAGAAGCTGAGGAAGGAGGG + Intergenic
998043758 5:138970135-138970157 TTGCAGAAGCAGAGGCAGAGAGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
1000029428 5:157389460-157389482 TTGCAGGAGCACAGGCAGGTTGG - Intronic
1000210262 5:159101356-159101378 TGGCAGAGACAGAGTTAGGAAGG - Intergenic
1002099519 5:176850516-176850538 AGGCAGAAGGAGAGTCGGGATGG + Intronic
1002580417 5:180206875-180206897 TTGCAGAAAGAGACACAGGAAGG + Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004392616 6:15222258-15222280 TTTCAGAAGCTGAGCCGGGATGG + Intergenic
1005250256 6:23937512-23937534 TTCCTGAAGGAGAGTCAGTATGG + Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006580327 6:35073360-35073382 TGGAAGAGGCAGAGCCAGGATGG - Intronic
1008073771 6:47124655-47124677 TTGAAGAAGCAGAACCAGGTTGG - Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1009828673 6:68900866-68900888 TTGCAGAAGCATTGTAGGGAGGG - Intronic
1010415903 6:75611161-75611183 CCACAGAAGCAGAGTCAGCAGGG - Intronic
1011253826 6:85401416-85401438 TACCAGATGCAGACTCAGGAAGG + Intergenic
1011783879 6:90822021-90822043 TCTCAGGAGCAGAGTCAGAATGG - Intergenic
1012986489 6:105881770-105881792 TGGCAAAAGCAGGGTTAGGATGG - Intergenic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1013538256 6:111083248-111083270 TTTCAGAAGCAGGGTCTGCAGGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013716390 6:112967884-112967906 CTGCAGAAGCAGAGCCCTGATGG - Intergenic
1014701560 6:124695254-124695276 TTTCAGAAGCAGAGGCAGAAAGG - Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016356594 6:143225135-143225157 TTGAACAGGCAGAGACAGGAGGG - Intronic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017148389 6:151255553-151255575 TTTGAGAAGCCGAGGCAGGAGGG + Intronic
1017159036 6:151348394-151348416 TTTGAGAAGCTGAGACAGGAGGG + Intronic
1017463353 6:154672089-154672111 TTGCAGAGGCTGACCCAGGAGGG + Intergenic
1017787136 6:157765778-157765800 TTACAGCAGGAGGGTCAGGATGG - Intronic
1017955637 6:159175515-159175537 TTACAGAAGTAAACTCAGGAAGG - Intronic
1018755032 6:166841645-166841667 CTGCAGAGGCTGAGTCAGAAAGG + Intronic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1020133766 7:5574612-5574634 TTGCTGGAGCAGAGCCAGGTGGG - Intergenic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021434428 7:20598161-20598183 TTTCAGAGGCAAATTCAGGATGG + Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1023203758 7:37725852-37725874 TAGCAGTAACAGAGGCAGGAAGG - Intronic
1024541583 7:50479520-50479542 TTGCAGGAGCAGGGGCAGGTGGG - Intronic
1025602846 7:63015878-63015900 TTTCAGAATGAGAGTCTGGAGGG - Intergenic
1026195164 7:68166730-68166752 ATGCATAAGCAGAGTCTGGGAGG - Intergenic
1026363011 7:69620012-69620034 TTGAAGAAGTAGATTCATGAAGG - Intronic
1026363537 7:69625177-69625199 TAGCAGAAGCGGACTCAGAAAGG + Intronic
1026693308 7:72568960-72568982 TTGGGGAAGCCGAGTCAGGTGGG + Intronic
1027292178 7:76726088-76726110 TAGCAGGTGCAGAGTCAAGAAGG - Intergenic
1028844419 7:95463273-95463295 TTTGGGAAGCAGAGGCAGGAGGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032674037 7:134111626-134111648 TTGCATAAGCAGACTCAGATGGG - Intergenic
1032937639 7:136751780-136751802 TTACAGAAGCAGAGATAGAATGG + Intergenic
1033407886 7:141088328-141088350 TTTCAGGAGCAGTCTCAGGAGGG - Intronic
1034164238 7:149013432-149013454 TTCCAGAAGCTGAGGCGGGAGGG + Intronic
1035032214 7:155868870-155868892 TGGCAGAAGGAGAGCCAGGAGGG + Intergenic
1037075866 8:14717474-14717496 TTGAAGAAGAACAGTCTGGAAGG + Intronic
1038863758 8:31416049-31416071 TTGTAGAAGCATAGTTGGGAAGG + Intergenic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039174864 8:34792420-34792442 TTGGAGAAGCAGAGATAGCATGG - Intergenic
1039934339 8:42027927-42027949 TAGCAAAAGCAGAGTTAAGAGGG - Intronic
1040388569 8:46931339-46931361 TTGCAGCTGCAGAGGCAGGCAGG - Intergenic
1042146946 8:65739952-65739974 TGGCAGAGGCAATGTCAGGAGGG - Intronic
1042567218 8:70124233-70124255 TTGCTGAAGCCGAGACAGCAGGG + Intronic
1042802260 8:72732394-72732416 TCTCAGCAGCAGAGTCAGGGAGG - Intronic
1044644232 8:94421072-94421094 TTGAAGAAGCAGAGGCAGTGTGG - Intronic
1044734506 8:95265914-95265936 TGTCAGAAACAGAGTCAGAAAGG - Intronic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1046732871 8:117744516-117744538 TTGCTGAAGGAGCATCAGGAAGG - Intergenic
1046906069 8:119574341-119574363 TTGCAGAAGCAGAGGCTTGCAGG - Intronic
1047223416 8:122937222-122937244 TCATGGAAGCAGAGTCAGGAAGG + Intronic
1048068567 8:130998475-130998497 TTTCAGAAGCAGACTCTGAAAGG + Intronic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1048565627 8:135593718-135593740 TTGTGGAAGCCGAGGCAGGAGGG - Intronic
1048787603 8:138066961-138066983 TTGGAGAAGCAGAAGCAGAAGGG + Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049072657 8:140368736-140368758 TAGCAGGAGGAGAGTCAGGCGGG - Intronic
1049397800 8:142409671-142409693 CTGCAGAGGCAGGGCCAGGAGGG - Intergenic
1050359922 9:4820213-4820235 TTGAAGAAGAGGAGTCAGCAGGG + Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050447589 9:5741760-5741782 TGGCAGAAACAGACTCAGAAAGG - Intronic
1050463274 9:5894983-5895005 GTGCATAAGCAGGGTCAGGTGGG + Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053248462 9:36554564-36554586 TTTCAGAGGCTGAGGCAGGAGGG - Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055004736 9:71492768-71492790 TTCCAGAAGGACAGTCAGGTCGG + Intergenic
1055259764 9:74419856-74419878 TTGTAGATTCAGAGTCAGAAAGG + Intergenic
1055332861 9:75202131-75202153 CTACAGAATCAGAGTCTGGAGGG + Intergenic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056844424 9:90025065-90025087 AAGCAGAAGCCGTGTCAGGAGGG + Intergenic
1056965628 9:91161121-91161143 TGGCAGGCGCAGAGGCAGGAAGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057738833 9:97692931-97692953 TTGCAGAAGCTGAGACTTGAAGG - Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057903346 9:98966090-98966112 TCCCAGAAGAAGAGTCAGGAGGG - Intronic
1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG + Intergenic
1058568008 9:106307715-106307737 TTTCTGAAACAGATTCAGGAAGG - Intergenic
1058773069 9:108257559-108257581 TTACATAAGCAGAGTCAGCCAGG + Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059725634 9:117005823-117005845 TTACAGATCCTGAGTCAGGAAGG - Intronic
1060198938 9:121640622-121640644 GTTCAGCATCAGAGTCAGGAGGG + Intronic
1060398336 9:123332094-123332116 TGGCAGAAGCAGGTTCAAGATGG + Intergenic
1061787095 9:133036041-133036063 TTGCAGAAGGAGGGTCAGGAAGG - Intronic
1062027939 9:134349177-134349199 TTGCAGAAGAAGGGTCTGGCTGG + Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062228151 9:135465527-135465549 TTGAAGAATCAGCGACAGGACGG + Intergenic
1062302198 9:135880650-135880672 TTGCACATGCAGAGCCAGGCCGG - Intronic
1062517913 9:136945343-136945365 TGCCAGGAGCAGAGTCAAGAGGG - Exonic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187615942 X:20993016-20993038 TTGCAGAAGCTGGGGAAGGAGGG + Intergenic
1187627356 X:21130851-21130873 TTACTGAAGCAGAATCAGGGTGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1197371044 X:125626940-125626962 TATGAGAAGCAGTGTCAGGACGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic
1200981958 Y:9270688-9270710 TGGCAGAGGCAGAGTCAGTCTGG + Intergenic
1201972465 Y:19812597-19812619 TTGAAGAAGTAGAATCGGGAAGG - Intergenic
1202128455 Y:21589042-21589064 TGGCAGAGGCAGAGTCAGTCTGG - Intergenic
1202342344 Y:23882949-23882971 TTGAAAAAGCAGATTCAAGAAGG + Intergenic
1202528425 Y:25787136-25787158 TTGAAAAAGCAGATTCAAGAAGG - Intergenic