ID: 1143764282

View in Genome Browser
Species Human (GRCh38)
Location 17:9127325-9127347
Sequence CAGTGTCACCAGAACTAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143764276_1143764282 0 Left 1143764276 17:9127302-9127324 CCCTGTGGGATCCGTGTGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101
1143764274_1143764282 2 Left 1143764274 17:9127300-9127322 CCCCCTGTGGGATCCGTGTGGAA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101
1143764278_1143764282 -1 Left 1143764278 17:9127303-9127325 CCTGTGGGATCCGTGTGGAAGGC 0: 1
1: 0
2: 0
3: 8
4: 90
Right 1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101
1143764275_1143764282 1 Left 1143764275 17:9127301-9127323 CCCCTGTGGGATCCGTGTGGAAG 0: 1
1: 0
2: 0
3: 14
4: 106
Right 1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143764282 Original CRISPR CAGTGTCACCAGAACTAGGT GGG Intronic
907329338 1:53661020-53661042 CAGTGTCCCCTTAACAAGGTTGG + Intronic
907332531 1:53680398-53680420 CAGTGGCACCAGTACTGGGGTGG + Intronic
908851941 1:68385811-68385833 CTGAGCAACCAGAACTAGGTAGG + Intergenic
914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG + Intergenic
916487465 1:165272349-165272371 CAGTGTAACCAGATCTCTGTGGG - Intronic
917205296 1:172565203-172565225 CAGTGTCTCCACTACCAGGTAGG - Intronic
922236011 1:223723270-223723292 CAGTGGCTCCAGAACCAGGCTGG - Intronic
924439737 1:244076349-244076371 CAGAGTCAGCTGATCTAGGTTGG - Intergenic
1073540283 10:104312250-104312272 CAGAGACAACAGAACTCGGTGGG - Exonic
1073981864 10:109163344-109163366 CACTGTCACAAGAACAAGATGGG + Intergenic
1083802298 11:65053626-65053648 CAGTGTCTCCTGCACTGGGTCGG - Intronic
1086519370 11:87652108-87652130 CAGTGTCACCAGAACAGCATGGG + Intergenic
1089497223 11:118913896-118913918 CTGTGAAACCAGAGCTAGGTTGG - Intronic
1090106674 11:123860570-123860592 CAGTGTCACCAGGAAAGGGTAGG - Intergenic
1091362526 11:134988874-134988896 CAGTGTCTCCAGGCCCAGGTGGG + Intergenic
1094440173 12:30466553-30466575 CTGTGTCTCCAGAAATAGGGAGG + Intergenic
1096849897 12:54428745-54428767 CAGTCTCCCCAGAACTGGCTGGG + Intergenic
1097978689 12:65714982-65715004 CAGTGATACCTGAACTAGCTAGG - Intergenic
1104431254 12:128718243-128718265 CAGTATGACCAGAACAAGGCAGG + Intergenic
1107369236 13:39724527-39724549 CAGTGTCACAGAATCTAGGTTGG - Exonic
1108172450 13:47755776-47755798 CTGGGTCACCAGAACTAGAGTGG + Intergenic
1114548575 14:23520520-23520542 CAGTGTCACCAAAAGTATCTTGG - Intergenic
1123000866 14:105293421-105293443 CAGTGTCACCAGAACTTGTGGGG - Intronic
1125351243 15:38769630-38769652 CTGTCTCACCAGACCTAGGGTGG - Intergenic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1127348176 15:58122370-58122392 CACTGTCACCAGAAATGTGTTGG + Intronic
1127391303 15:58507032-58507054 CACTGTCACAAGAACAAGCTGGG + Intronic
1127391934 15:58512745-58512767 CAGTGGCACTGGAACGAGGTAGG + Intronic
1129690360 15:77709920-77709942 CGGTGTCCCCAGACCTAGTTTGG + Intronic
1131601874 15:93857580-93857602 CAGTGGCACCAGGACCAGGTTGG - Intergenic
1132328291 15:100990457-100990479 CATTTTCACCAGCAATAGGTGGG + Intronic
1133059533 16:3165412-3165434 CAGTCTCAGCTGAACTGGGTGGG - Intergenic
1134876026 16:17699493-17699515 CATTTTCACCAGCACTAGATTGG + Intergenic
1135779951 16:25291772-25291794 CAGTGACACTAAAACTAGATGGG - Intergenic
1136050377 16:27645986-27646008 CATTGTCTCCAAAGCTAGGTAGG + Intronic
1137332300 16:47510522-47510544 CCGTGTGCCCAGAACTAGGAAGG + Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1139552921 16:67685650-67685672 CAGTGGGACCAGAACTCGGGCGG + Exonic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1143764282 17:9127325-9127347 CAGTGTCACCAGAACTAGGTGGG + Intronic
1145888095 17:28396558-28396580 CAGTGTCTCCAGAACTGAGCAGG - Exonic
1146752180 17:35391666-35391688 CAGTGTCATCAGGACTAGGTAGG + Intergenic
1147607427 17:41782165-41782187 CAGAGACACCAGAACCAGGCAGG + Intronic
1150881345 17:69032122-69032144 CAGTGTCTCCAGAATTCTGTGGG - Exonic
1156349054 18:36287381-36287403 CAGCCTCACTAGAACTGGGTGGG - Intergenic
1156482364 18:37444323-37444345 CAGTGTCTCCAGACCTATCTCGG - Intronic
1157604765 18:48919187-48919209 AAGTGCCACCAGAGCTAGGCTGG + Intergenic
1159941968 18:74415188-74415210 CAGTGTGAACAGGACTTGGTGGG - Intergenic
1162760148 19:12884226-12884248 CAGTGTAGCCTGAACTGGGTGGG + Intergenic
1167508025 19:49881364-49881386 CTGGGTCACCAGAACCAGGTAGG - Exonic
929663583 2:43815215-43815237 CAGTTTCACCTGAAATAGATTGG - Intronic
932673120 2:73755184-73755206 CTTTGTCAGGAGAACTAGGTTGG + Intergenic
932989357 2:76766990-76767012 CAGGGTTATCAGATCTAGGTAGG - Intronic
937031943 2:118747957-118747979 CTGTGTGACCAAAACTGGGTTGG + Intergenic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
938714451 2:134006842-134006864 GAGTGACACCAGACCTAGGTTGG - Intergenic
939695072 2:145313386-145313408 CACTGTCACAAGAACAAGGCAGG + Intergenic
941125628 2:161580221-161580243 CAGTGTCCCCAGAAGCTGGTGGG - Intronic
942533915 2:176942878-176942900 CAGTTTCAACAAAACTGGGTGGG - Intergenic
947821301 2:233072964-233072986 CTGTGTCACCAGAACCTGGCAGG + Intronic
1174610875 20:51797867-51797889 CAGTGTCTCCAGAATTTGATTGG - Intronic
1174741266 20:53016341-53016363 CAGTTTCAAAAGAACAAGGTAGG + Intronic
1177249321 21:18571325-18571347 CACTGTCATTTGAACTAGGTAGG + Intergenic
1182780441 22:32863263-32863285 CAGATTCAGCAGAACTAGGGAGG - Intronic
1183002866 22:34876156-34876178 CAGAGTCCACAGAACTAGATGGG + Intergenic
1183458281 22:37934461-37934483 CTCTGTCCCCAGAACCAGGTTGG + Intronic
949715468 3:6925775-6925797 CAGTTCCACCAGGACAAGGTAGG - Intronic
951289059 3:20853720-20853742 CATTTTCACAAGATCTAGGTAGG - Intergenic
952107287 3:30085081-30085103 AAGTGTCAGCAGAACCAGCTGGG - Intergenic
953839178 3:46374950-46374972 CAGAGTCAGCAGAACTGGGGTGG + Exonic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
972731029 4:41795432-41795454 CAGTCTCAGCATAACTGGGTTGG + Intergenic
972957162 4:44407212-44407234 CAGTGTCTTCAGAACTTGGTTGG - Intronic
976204671 4:82613447-82613469 CAGTGTGGCTAGAACAAGGTAGG - Intergenic
977472884 4:97464361-97464383 CAGTGGCACCACTACTAGTTTGG - Intronic
983371743 4:166868505-166868527 GAGTGTCACCTGAACTAATTTGG + Intronic
983994358 4:174163183-174163205 CAGCTTCACCAGAACTACATAGG - Intergenic
989107922 5:37880740-37880762 CTGTGCCACCAGAACTAAGCAGG - Intergenic
993285388 5:85990030-85990052 CACTGTCACAAGAACAACGTGGG - Intergenic
997476199 5:134143983-134144005 CAGTCTCAGCAGAACTAGCCAGG - Intronic
1001587663 5:172844509-172844531 CAGTGTGACCAGGACAAGCTCGG + Intronic
1003325878 6:5090467-5090489 CAGTGTCTCCAGAGCTCAGTGGG - Intergenic
1003443837 6:6167108-6167130 CAGTGTCTCCAGAATAAAGTGGG - Intronic
1004741652 6:18467538-18467560 CAGAATCAACAAAACTAGGTTGG + Exonic
1005226314 6:23647144-23647166 CTGTGTCAACTGAACTAGGTTGG + Intergenic
1006091373 6:31631079-31631101 CAGGAAAACCAGAACTAGGTGGG - Intronic
1008891374 6:56496328-56496350 CTGTGTCACATGATCTAGGTAGG + Intronic
1014286063 6:119499439-119499461 CAGTTTCACCAGTAATATGTGGG + Intergenic
1014342756 6:120229557-120229579 CAGTGGCACCAGCTCTAGGTAGG - Intergenic
1015873967 6:137803932-137803954 CAGTTTTACCAGAAATAGTTTGG + Intergenic
1017718447 6:157228449-157228471 CAGTGTCAGAAGACCTATGTGGG + Intergenic
1017974067 6:159338660-159338682 CAGTGTCAACAGGCCTAGGTGGG - Intergenic
1028534926 7:91881426-91881448 CATTGTCACCATCACTAGGCAGG - Intergenic
1030061652 7:105626533-105626555 CAGTGTCATAAGAATTATGTTGG + Intronic
1045163074 8:99571065-99571087 CAGGGGCCCCAGATCTAGGTAGG + Intronic
1045685265 8:104704963-104704985 CAGTGACACAAGAAATAGGAGGG - Intronic
1046257514 8:111720980-111721002 CACTGTCACCAGAACAACATGGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1053603779 9:39636586-39636608 CACTGTCACAGGAACTAGGCTGG - Intergenic
1053861653 9:42392942-42392964 CATTGTCACAGGAACTAGGCTGG - Intergenic
1054249761 9:62705833-62705855 CACTGTCACAGGAACTAGGCTGG + Intergenic
1054563871 9:66740355-66740377 CACTGTCACAGGAACTAGGCTGG + Intergenic
1055144155 9:72912671-72912693 CAGTGGGACCAGAACTGGGAAGG - Intronic
1057192339 9:93095117-93095139 CAGTGTGACCCGAACTAGAGAGG - Intergenic
1059671357 9:116495466-116495488 TAATGTCATCAGAACTTGGTTGG - Intronic
1061499275 9:130992904-130992926 CACTGAAACCAGAACTGGGTAGG + Intergenic
1061860380 9:133464875-133464897 CAGTGGCACCAGCACCAGGAAGG - Intronic
1197521441 X:127502802-127502824 CAGTGTCACCTTAACTATCTAGG + Intergenic
1199679549 X:150215557-150215579 CAGAGTCACCCAAACCAGGTGGG + Intergenic
1199695682 X:150341492-150341514 CAGAGTCACCCAAACCAGGTGGG - Intergenic
1201378082 Y:13343404-13343426 CAGAGTCACCAGGATTATGTAGG - Intronic