ID: 1143764822

View in Genome Browser
Species Human (GRCh38)
Location 17:9130556-9130578
Sequence TCTGAGTGGATGAGTTTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143764822_1143764829 18 Left 1143764822 17:9130556-9130578 CCCCTTAAACTCATCCACTCAGA 0: 1
1: 0
2: 3
3: 10
4: 176
Right 1143764829 17:9130597-9130619 TCCAGACCTGCCCTCACTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 141
1143764822_1143764828 17 Left 1143764822 17:9130556-9130578 CCCCTTAAACTCATCCACTCAGA 0: 1
1: 0
2: 3
3: 10
4: 176
Right 1143764828 17:9130596-9130618 TTCCAGACCTGCCCTCACTCGGG 0: 1
1: 0
2: 0
3: 29
4: 229
1143764822_1143764834 30 Left 1143764822 17:9130556-9130578 CCCCTTAAACTCATCCACTCAGA 0: 1
1: 0
2: 3
3: 10
4: 176
Right 1143764834 17:9130609-9130631 CTCACTCGGGGTTTCTTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1143764822_1143764827 16 Left 1143764822 17:9130556-9130578 CCCCTTAAACTCATCCACTCAGA 0: 1
1: 0
2: 3
3: 10
4: 176
Right 1143764827 17:9130595-9130617 CTTCCAGACCTGCCCTCACTCGG 0: 1
1: 0
2: 2
3: 23
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143764822 Original CRISPR TCTGAGTGGATGAGTTTAAG GGG (reversed) Intronic
900255586 1:1696787-1696809 TCTGAGTGTATGTGTCTCAGTGG + Intronic
900264261 1:1749489-1749511 TCTGAGTGTATGTGTCTCAGTGG + Intergenic
901863908 1:12091519-12091541 TCTGAGAGGGTGATTTTAAAGGG + Intronic
905234219 1:36534742-36534764 TCCTAGTTGATGACTTTAAGGGG + Intergenic
906636665 1:47415089-47415111 CCTGAGGTGCTGAGTTTAAGGGG - Intergenic
906938387 1:50234657-50234679 TCTAAGTGGCAGTGTTTAAGAGG + Intergenic
911831831 1:102559690-102559712 TCTGACTGGATCATTTTAACTGG + Intergenic
912915752 1:113812541-113812563 TCTGAGTGGAGGAGTGGAAAGGG + Intergenic
915186997 1:154114516-154114538 TCTAAGTGGATGTTTTTAATTGG - Intronic
916213333 1:162375532-162375554 TCTGCCTGGCTGAGTTTGAGAGG - Intronic
918354718 1:183696715-183696737 TCTGAGTGGAACAGTTTTTGGGG - Intronic
923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG + Intergenic
923158779 1:231300178-231300200 ACTAGGTGGCTGAGTTTAAGTGG - Intergenic
924397067 1:243631992-243632014 TCTTCATGGATGAGTTTGAGGGG - Intronic
1064505726 10:16027800-16027822 TCCGAGTGGAGGAGTCTCAGAGG + Intergenic
1065300739 10:24318996-24319018 TGGGAGTGGATGAGTTCAGGTGG + Intronic
1070680686 10:78446882-78446904 TCTGAGTGGGTGAGATTTATGGG - Intergenic
1072751039 10:97979040-97979062 TCTGTGTGGATGTGTCTCAGTGG + Intronic
1073120402 10:101119122-101119144 TCTGAGTGCATGCTTTTCAGTGG + Intronic
1076726307 10:132415489-132415511 TGTGAGTGGATGTGTGTGAGTGG - Intronic
1079520643 11:21322359-21322381 TCTGAGTTTATGAGTTTAGTTGG + Intronic
1081171266 11:39872584-39872606 TCTGAGGGGATGCATTCAAGTGG + Intergenic
1083103882 11:60338092-60338114 GCTGCATGGATGAGATTAAGGGG + Intronic
1083652603 11:64211901-64211923 GGTGAGTAGATGAGTTTCAGTGG - Intronic
1085237755 11:75028385-75028407 CCTTAGAGGATGAGCTTAAGAGG - Intergenic
1085668357 11:78437485-78437507 TGTGCGTGGATGGGTTTCAGAGG - Intronic
1088443502 11:109898375-109898397 TCTGACTGGATAATTTTAAATGG - Intergenic
1088731737 11:112689743-112689765 TCTGAGCCTATGAGTTTAAAGGG + Intergenic
1089042648 11:115467743-115467765 TCTGAGTGAATGAGTTTACAGGG + Intronic
1089110321 11:116050694-116050716 TCAGAGCAGATGAGTTAAAGAGG - Intergenic
1090118860 11:124003244-124003266 TCTGTGTCCATGAGTTTAATGGG + Intergenic
1096260758 12:50089256-50089278 TCTTAGTGGTTGAGGTTAAGGGG - Intronic
1098080015 12:66773882-66773904 TCTTAGTGCTTTAGTTTAAGTGG + Intronic
1100605722 12:96150550-96150572 CTGGAGTGGCTGAGTTTAAGGGG - Intergenic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1101247322 12:102896304-102896326 TGAGAGTGGATGAGGTCAAGGGG + Intronic
1103895372 12:124269639-124269661 TCTGTGTGGATGAGGGTTAGGGG - Intronic
1106043581 13:26117040-26117062 TCTGATTGGTAGAGATTAAGGGG + Intergenic
1106158035 13:27175412-27175434 TCTGACAGGATGAGGTTGAGAGG + Intergenic
1106657556 13:31762445-31762467 TCTGAGTGCATGAGGTGGAGGGG + Intronic
1106997069 13:35497172-35497194 CCTGAGTGAATCACTTTAAGTGG - Intronic
1107417602 13:40216024-40216046 CCTGAGTGGAAGAGTATGAGAGG - Intergenic
1111478529 13:88787915-88787937 TCTGACTTGATGAGTTTATAGGG + Intergenic
1111606717 13:90547970-90547992 TCTAAGTGGCAGAGTTCAAGAGG - Intergenic
1113531785 13:111032578-111032600 GCTGAGTGGATGAGTTGATTTGG - Intergenic
1114465244 14:22917763-22917785 TCTATGTGGATGAGATTGAGTGG - Intronic
1117207014 14:53453440-53453462 TCTGTGTGCCTGTGTTTAAGGGG + Intergenic
1120284943 14:82488073-82488095 TCTGAGTGGATGGTTCTAGGGGG + Intergenic
1121487729 14:94331403-94331425 TCTGAGAGGATGAGGCCAAGAGG - Intergenic
1122152720 14:99733393-99733415 TCTGTGTGGATGACTCTCAGAGG + Intergenic
1124256176 15:28144746-28144768 TCCCAGGGGATGAGTTAAAGTGG - Exonic
1125110304 15:36024475-36024497 TCTAAGTGGATGGGTCTGAGGGG - Intergenic
1127428245 15:58876874-58876896 TTTGAGAGGATGAGTTTTTGGGG + Intronic
1127880599 15:63154652-63154674 TCTCACTGGAAGAGTTCAAGTGG - Intronic
1133473834 16:6100891-6100913 TCTGAGATGAAGAGTTTCAGAGG + Intronic
1135768145 16:25195666-25195688 TGTGAGTGTATGAGTCTAAAAGG + Intergenic
1138250227 16:55496620-55496642 TCAGAGTTGATGATTTTGAGAGG + Intronic
1140870437 16:79101513-79101535 CCTAAGGGAATGAGTTTAAGTGG + Intronic
1142519005 17:492012-492034 TCTGAGTTTCTGAGTTTAACAGG - Intergenic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143764822 17:9130556-9130578 TCTGAGTGGATGAGTTTAAGGGG - Intronic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1146663629 17:34682119-34682141 TCTGAGTGGAGGGGTTGAAGTGG + Intergenic
1149282785 17:55126850-55126872 ACTCAGTGGATGACATTAAGTGG + Intronic
1149324402 17:55515431-55515453 TCCAGGTGGATGAGTTTGAGGGG - Intergenic
1150887390 17:69103653-69103675 TCAGAGTGGATGAATGCAAGGGG + Intronic
1151111502 17:71683223-71683245 TCTGATGGGATGACTTTGAGGGG - Intergenic
1155724148 18:29058086-29058108 TGTGAGTAGATGAATTTGAGAGG - Intergenic
1156511100 18:37637525-37637547 TCTAACTGGATGATTGTAAGAGG + Intergenic
1156876366 18:42018460-42018482 GCTGAGTCCATGAGTTTAATAGG - Intronic
1161498762 19:4601674-4601696 TCTGAGTGAATGAGTGCATGAGG + Intergenic
1163790407 19:19302888-19302910 TCTGATGGGATGAATTTCAGGGG - Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167768310 19:51498979-51499001 TGTGTGTGGAGGAGTTCAAGGGG + Intronic
930708395 2:54526618-54526640 ACAGGGTGGATGATTTTAAGGGG - Intronic
931743147 2:65266946-65266968 TCTGATAGAATGAGTTTCAGTGG + Intronic
931900729 2:66785157-66785179 TCAGTGTGGACAAGTTTAAGAGG + Intergenic
933210172 2:79557578-79557600 TCTGTGTGGAAGACTTTTAGGGG + Intronic
933557918 2:83853403-83853425 GCTGAGTGAATGATTTTTAGTGG - Intergenic
933987399 2:87603312-87603334 TCTGAGTGGATGAGGGAAGGGGG + Intergenic
936306440 2:111347496-111347518 TCTGAGTGGATGAGGGAAGGGGG - Intergenic
937664506 2:124469148-124469170 TCTGGGTGGAAGATTTTCAGAGG - Intronic
937692018 2:124767381-124767403 TCTTAGTGAATGTGTTTTAGTGG + Intronic
940837575 2:158541026-158541048 GCTGAGTTGATGAGATTAAATGG + Intronic
941645555 2:168036632-168036654 TCTGGCTGGATGAGGTTCAGAGG + Intronic
943367883 2:186982728-186982750 ACTAGGTGGCTGAGTTTAAGTGG - Intergenic
945681941 2:212924882-212924904 TGTGAGAGGATAAGTTTATGTGG - Intergenic
946912312 2:224476480-224476502 ACTGGGTTGAGGAGTTTAAGGGG - Intronic
947777371 2:232724163-232724185 TCTGAGTAGCTGAGATTAACAGG + Intronic
948542684 2:238701622-238701644 TCTGAGCAGATGTGTTTGAGAGG + Intergenic
1168912428 20:1459986-1460008 TCTGGGTGTATGAGTTTTGGGGG - Intronic
1171107699 20:22450681-22450703 TCTGAGGGGATGGGTGCAAGGGG - Intergenic
1174934228 20:54850057-54850079 ACTGAGTGAATGAATTTCAGAGG + Intergenic
1178484595 21:33010637-33010659 TCTGTTTGGATGAGTTGAAGGGG - Intergenic
1182429893 22:30293216-30293238 CCTGGGTGGGTGACTTTAAGGGG + Intronic
1182850697 22:33471634-33471656 TCTGAGTGGAAGAGTTTCCTGGG - Intronic
1184183371 22:42846618-42846640 CCTGAGTGAATGATTTTTAGTGG - Intronic
953896953 3:46810340-46810362 ACTGAGTGGGTGTGTATAAGTGG + Intronic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
954467590 3:50665508-50665530 TCTCAGAGGATGAGTTTAAGTGG - Intergenic
954960171 3:54557672-54557694 TCTTTGTGGATTAATTTAAGCGG + Intronic
958271027 3:91499970-91499992 TCTGAGTGGCTTAGTTTATGTGG - Intergenic
962029191 3:131581512-131581534 TCTGAGAGGAAGAGTTCAGGTGG - Intronic
963055589 3:141183971-141183993 TCTTATTGGAAGACTTTAAGTGG + Intergenic
963773160 3:149410115-149410137 CCTTCGTGGATGAATTTAAGGGG - Intergenic
964754168 3:160079298-160079320 ACTAGGTGGCTGAGTTTAAGTGG - Intergenic
964755309 3:160086623-160086645 ACTAGGTGGCTGAGTTTAAGTGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966685478 3:182689540-182689562 GCTGTGTGGCTGCGTTTAAGTGG - Intergenic
967059220 3:185856944-185856966 TCTCACTGGATGATTTTAACAGG + Intergenic
967298349 3:187987338-187987360 TCTGTATGTATGAGTTTATGGGG - Intergenic
967889147 3:194352607-194352629 TGTGAGTGGGTGTGTGTAAGTGG + Intergenic
969461848 4:7333186-7333208 TCTGACTGGCTGAGTTTCGGAGG + Intronic
970439369 4:16067090-16067112 TGTGAGTGGGTGGGTTTGAGTGG - Intronic
970487823 4:16542156-16542178 TCTTAGTGGATGAGTAAATGAGG - Intronic
973375706 4:49285354-49285376 TCGGAGTGTCTGAGTGTAAGTGG + Intergenic
973381705 4:49324887-49324909 TCGGAGTGTCTGAGTGTAAGTGG - Intergenic
979496199 4:121385708-121385730 TGTGAGTGGTTGAGATAAAGTGG - Intergenic
981003314 4:139849715-139849737 TCTGAGTGGTTAAGTTACAGTGG - Intronic
983063665 4:163186219-163186241 ACTGAGTGGATGTGTTTATTTGG + Intergenic
984824720 4:183914210-183914232 TGTAAGTGGTTGGGTTTAAGAGG + Intronic
986989311 5:13533017-13533039 TCTGAGTGGAAAATTTTCAGAGG + Intergenic
989527729 5:42472756-42472778 TGTGAGTAGATGTGTTTAGGTGG + Intronic
991527174 5:67573542-67573564 TCTGACTGGATAATTTCAAGTGG + Intergenic
994590012 5:101760603-101760625 TCTGAGTACATGTGGTTAAGGGG - Intergenic
995115554 5:108474142-108474164 TCTGATTGGGTGAGTTCAAAAGG - Intergenic
996357705 5:122615216-122615238 CCTTAGTGGGTGAGTTGAAGTGG - Intergenic
997844763 5:137276461-137276483 TCTGTGTGGCTGAGTTGCAGAGG - Intronic
999160374 5:149491179-149491201 TATGAGGGAATGACTTTAAGAGG - Intergenic
999797177 5:154999838-154999860 TGTGAGTGGAAGAGTTTTGGGGG + Intergenic
1001130157 5:169057259-169057281 TCAGAGTGGATGAGACTTAGGGG + Intronic
1001188906 5:169607652-169607674 TCTGAGTGGATAAATTTTGGGGG + Intergenic
1005947309 6:30603784-30603806 TCTAGGGGGATGAGTTTAGGGGG + Exonic
1006093964 6:31644450-31644472 GCTGAGTGGGTGGGTTGAAGGGG - Intronic
1007259843 6:40555755-40555777 ACTGAGTAGATGAGATTCAGTGG + Intronic
1007421833 6:41724336-41724358 TCAGGGTGGATGAGTTTACTGGG + Intronic
1007868758 6:45007795-45007817 TTTGAGTGGAGGATTTTAATGGG + Intronic
1008984114 6:57521339-57521361 TCTGAGTGGCTTAGTTTATGTGG + Intronic
1009172172 6:60414242-60414264 TCTGAGTGGCTTAGTTTATGTGG + Intergenic
1011910471 6:92430537-92430559 TCAGAGTGGAGGATTTTAACAGG + Intergenic
1011926922 6:92656934-92656956 TCTGAATGAATGAATTTAAATGG - Intergenic
1015731301 6:136350906-136350928 TCTAGATGGAAGAGTTTAAGTGG + Intronic
1017370283 6:153697347-153697369 TTTAAATGGATGAATTTAAGTGG - Intergenic
1021044031 7:15900313-15900335 TCTGGTTGGAAGAGGTTAAGTGG + Intergenic
1021457694 7:20847414-20847436 TGTGATTGGATGAGATTTAGGGG - Intergenic
1022111635 7:27235820-27235842 TCTGTGCGGGTGAGTTTCAGAGG - Intergenic
1022574902 7:31488032-31488054 TATCAGTGGATAAGTTTCAGGGG - Intergenic
1023481533 7:40640141-40640163 TCTGACTTGCTGGGTTTAAGAGG - Intronic
1024806112 7:53142787-53142809 TCTGAGTGGAAGATGTTAAAAGG - Intergenic
1027988167 7:85321882-85321904 TCTTAGTAGATGGCTTTAAGTGG + Intergenic
1028883370 7:95905261-95905283 TCAGAGTGGATGAAGTAAAGAGG + Intronic
1029096556 7:98089591-98089613 TCTGAGTGTATTAGTTTACATGG - Intergenic
1029506877 7:100968160-100968182 TCGGAGGGGATGGGTTTAAAAGG - Exonic
1032130805 7:129225565-129225587 TCTGAGAGAGTGGGTTTAAGGGG - Intronic
1033123311 7:138685424-138685446 TCTGAGTGGCTGAGGGGAAGGGG + Intronic
1034732265 7:153398219-153398241 TGTGTGTGGATGAGCTTCAGTGG + Intergenic
1034952905 7:155313090-155313112 GTAGAGTGGATGAGTTTCAGTGG + Intergenic
1035813102 8:2509565-2509587 TCTGAGCTGGTGAGTTTTAGAGG - Intergenic
1036133373 8:6136698-6136720 TCTGTGTGGAGCATTTTAAGAGG - Intergenic
1037196588 8:16198358-16198380 TCTCAGTGCAGGTGTTTAAGTGG - Intronic
1037200083 8:16241773-16241795 TCTGGATGGATGAGTTGCAGAGG + Intronic
1037410643 8:18592310-18592332 TCTGAGTGGATAATTTCAAATGG - Intronic
1038993301 8:32893348-32893370 TTTTAGTGGATGAGTTTAAGTGG + Intergenic
1041647501 8:60268280-60268302 TCTGAGTGTATGTGATAAAGGGG - Intronic
1041877105 8:62701905-62701927 TCTGAGTATATGGGGTTAAGTGG - Intronic
1042069355 8:64913764-64913786 TCTGGGAGGATGAGCCTAAGAGG + Intergenic
1042167781 8:65962899-65962921 TTTGTGTGTATGAGTTTAAAAGG + Intergenic
1043542330 8:81278542-81278564 TCTGAGTAGTAGAGCTTAAGGGG + Intergenic
1047340011 8:123971930-123971952 ACTGGATGGATGACTTTAAGAGG + Intronic
1048134547 8:131735922-131735944 TCTGAGTGCATGAGGGTAAAAGG + Intergenic
1050968835 9:11843065-11843087 TCTGTGTGGAATATTTTAAGTGG - Intergenic
1052502303 9:29307156-29307178 TCTGAGTGTAGGACTTTAATGGG - Intergenic
1056646284 9:88414620-88414642 TGTCAGCTGATGAGTTTAAGTGG + Intronic
1058370895 9:104266245-104266267 GATGAGTAGATGAGTTTAACAGG - Intergenic
1061344021 9:130007515-130007537 TCTGAGCAGATGAGATTAGGAGG + Intronic
1189007921 X:37014477-37014499 ACAGAGGGGATGAGTTTAACAGG + Intergenic
1189492330 X:41479916-41479938 TCTGAGTGGAAGCATTTAAGAGG - Intergenic
1189941566 X:46128655-46128677 TCTGACTGGATGTGTTAATGGGG - Intergenic
1189969225 X:46401014-46401036 TCTGAGTGGACGTGATTTAGAGG - Intergenic
1190302631 X:49065432-49065454 TCTGAGTGGAAGAGAGCAAGTGG - Exonic
1192135958 X:68600769-68600791 TCTGACTGGATAATTTCAAGGGG - Intergenic
1193328329 X:80207708-80207730 TCTGAGTGCATAACTCTAAGAGG - Intergenic
1195022591 X:100844891-100844913 TCACAGTGGATGGGTTTAATGGG - Intronic
1196910182 X:120476995-120477017 TCTGAGTCGATGTGTTCAATGGG - Intergenic
1197188075 X:123610531-123610553 TCTGAGAGGTTAAGTTGAAGAGG - Intronic
1197400618 X:125984844-125984866 TCTGACTGGATAATTTTAAATGG - Intergenic
1198835440 X:140799749-140799771 TGTGAGTTGATGAGGTTAATTGG - Intergenic
1199537848 X:148923841-148923863 TCTGATTGCATGTGTTTATGAGG + Intronic
1199782906 X:151079991-151080013 TATGTGTGGATGTGTTGAAGGGG + Intergenic
1201239993 Y:11949353-11949375 TCTGAATGCATGAGTCTAGGGGG + Intergenic