ID: 1143765073

View in Genome Browser
Species Human (GRCh38)
Location 17:9132392-9132414
Sequence GGATGTACAAGGTGTGCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143765073_1143765077 -7 Left 1143765073 17:9132392-9132414 CCCAGCGCACACCTTGTACATCC 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1143765077 17:9132408-9132430 TACATCCGTCTTCTCTAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 61
1143765073_1143765076 -8 Left 1143765073 17:9132392-9132414 CCCAGCGCACACCTTGTACATCC 0: 1
1: 0
2: 0
3: 7
4: 57
Right 1143765076 17:9132407-9132429 GTACATCCGTCTTCTCTAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143765073 Original CRISPR GGATGTACAAGGTGTGCGCT GGG (reversed) Intronic
900709800 1:4106595-4106617 GGAAATACAAGGTGTGCATTAGG + Intergenic
904009720 1:27382808-27382830 GGAAGCTCCAGGTGTGCGCTGGG - Intronic
905320762 1:37115404-37115426 GGATGAACAAGGTGAGCCCTGGG - Intergenic
906304159 1:44705945-44705967 GGAAGTACAAGGTGTGTCCTGGG + Intronic
907755287 1:57304982-57305004 GGATAACCAAGGTGTGCTCTGGG - Intronic
908255752 1:62302233-62302255 GGAGGGACAAGGTGAGCTCTGGG + Intronic
908295919 1:62713052-62713074 TGATTAACAAGGTGTGGGCTTGG + Intergenic
915701910 1:157804291-157804313 GGATGTACCAGGGGTGAGCAGGG - Intronic
1062769193 10:86116-86138 GGATGGACGAGGTGAGGGCTGGG - Intergenic
1063920959 10:10932242-10932264 GGCTGGACAAGGTATGCGGTGGG + Intergenic
1069936999 10:71924417-71924439 AGATGAACAAGGTGTGAGCAGGG - Intergenic
1076192289 10:128491361-128491383 GCATGTTCACTGTGTGCGCTGGG - Intergenic
1080556368 11:33421088-33421110 GGAGGTACAAGGAGAGTGCTTGG + Intergenic
1089533324 11:119145941-119145963 GGATGGAGAAGGTCTGTGCTAGG + Intergenic
1090257369 11:125294632-125294654 AGATGGAAAAGGTGTGGGCTTGG + Intronic
1090339366 11:126002902-126002924 GGGTGTACATGGTGTTCACTAGG - Intronic
1105505540 13:21006352-21006374 GGATGTACACAGTGGGCGCTGGG - Intronic
1117960411 14:61156440-61156462 GGATGTCCAAGTGGAGCGCTTGG + Intergenic
1121561692 14:94880874-94880896 GGCTGACCAAGGTGAGCGCTGGG + Intergenic
1128741865 15:70089370-70089392 GGATGTGCTGGGTGTGGGCTGGG - Intronic
1132458295 16:36362-36384 GGATGGACGAGGTGAGGGCTGGG - Intergenic
1143305778 17:5945564-5945586 GGATGTTCACAGTGTGCACTGGG + Intronic
1143765073 17:9132392-9132414 GGATGTACAAGGTGTGCGCTGGG - Intronic
1144505866 17:15830279-15830301 GGATGAAAAATGTGTGCTCTTGG + Intergenic
1144579592 17:16450858-16450880 GGATGGAGAAGGTGTGGGCAGGG + Intronic
1145117897 17:20228608-20228630 GGATGAACAATGTGTGCTCTTGG + Intronic
1145170041 17:20648211-20648233 GGATGAAAAATGTGTGCTCTTGG + Intergenic
1148278806 17:46331032-46331054 GGAGGTAGAAGGCGTGCCCTTGG - Exonic
1151937212 17:77269946-77269968 GGAACTACCAGGTGGGCGCTGGG - Intergenic
1152962264 18:86918-86940 GGATGGACGAGGTGAGGGCTGGG - Intergenic
1165893153 19:39126657-39126679 CGATGCATAAGTTGTGCGCTGGG + Intronic
925312149 2:2892492-2892514 GGATGTTTAAGGTGAGGGCTAGG - Intergenic
927151923 2:20201124-20201146 GGATGTCCAAGGTGTCTGCGGGG + Exonic
932085514 2:68754262-68754284 GGTTGTCCAAGGTTTGGGCTGGG - Intronic
939861725 2:147428931-147428953 AGAAGTCCAAGGTGTGAGCTGGG + Intergenic
940901434 2:159129952-159129974 TGATGTTCAAGGTGTGGGCTGGG - Intronic
946567622 2:220984472-220984494 GGGTGTCCAAGGTGTGGGTTGGG + Intergenic
1169277680 20:4244552-4244574 GGAGGTACCAGGTGTGTGGTAGG - Intronic
1173187413 20:40851078-40851100 TGATGTCCAAGGGGTGGGCTGGG - Intergenic
1180195174 21:46189765-46189787 GGAGGTATAGGGTGTGCCCTGGG + Exonic
1185170761 22:49292463-49292485 GGCTGTGCAAGGTCTGCTCTGGG + Intergenic
959562909 3:107802830-107802852 GGATGTACAAGGCAAGAGCTTGG - Intronic
960343541 3:116504465-116504487 GTATTTGCAAGGTGTGAGCTCGG + Intronic
966762209 3:183428433-183428455 GGCTGGACGAGGTGGGCGCTGGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969410874 4:7027351-7027373 GGATGTGCAATGTGTGTGCGTGG - Intronic
977177615 4:93835685-93835707 TGATGAAGAAGGTGTGAGCTAGG + Intergenic
984698818 4:182805599-182805621 GGATTTACAAGCGGTCCGCTGGG + Intergenic
985788408 5:1911853-1911875 GGAGGTCCACGGTGTGCTCTCGG + Intergenic
1002121134 5:177005986-177006008 GGATCTCCAAGGAGTGCGCTGGG + Intronic
1006995245 6:38253652-38253674 GGAAGTACAAGGTCTGGTCTGGG + Intronic
1007483818 6:42167033-42167055 GTATGCACAAGGTATGCGTTAGG - Intronic
1028923242 7:96329493-96329515 GGATGTACACAGTGGGCTCTTGG + Intergenic
1031130870 7:117832077-117832099 GGAGGTAAAAGGTGTGGGGTGGG - Intronic
1038163843 8:25065760-25065782 GGTTGTGCAAGGCCTGCGCTTGG - Intergenic
1041198312 8:55424024-55424046 GGATGGCCCAGGTGTGCGTTTGG - Intronic
1045658720 8:104413720-104413742 GGATGTACAAGGTGTATTCAAGG + Intronic
1048008537 8:130438544-130438566 GGATGGGCAGGGTGTGAGCTGGG - Intronic
1060596668 9:124852929-124852951 GGATGTCCCAGGAGAGCGCTGGG - Intergenic
1062735878 9:138137199-138137221 GGATGGACAAGGTGAGGGCTGGG + Intergenic
1185474169 X:403740-403762 GGAGGTTCAATGTCTGCGCTGGG - Intergenic
1185893249 X:3838177-3838199 GGAGGTACCAGGCATGCGCTGGG - Intronic
1185898361 X:3876599-3876621 GGAGGTACCAGGCATGCGCTGGG - Intergenic
1185903476 X:3915028-3915050 GGAGGTACCAGGCATGCGCTGGG - Intergenic
1200398102 X:156003009-156003031 GGAAGGACAAGGTGAGGGCTGGG + Exonic