ID: 1143765458

View in Genome Browser
Species Human (GRCh38)
Location 17:9134870-9134892
Sequence TCTTCCTCCTGCCCTGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 517}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143765457_1143765458 -2 Left 1143765457 17:9134849-9134871 CCAGGACTTCTCAATAAAGCGTC 0: 1
1: 0
2: 0
3: 5
4: 53
Right 1143765458 17:9134870-9134892 TCTTCCTCCTGCCCTGCTTTTGG 0: 1
1: 0
2: 3
3: 62
4: 517
1143765456_1143765458 2 Left 1143765456 17:9134845-9134867 CCTACCAGGACTTCTCAATAAAG 0: 1
1: 0
2: 0
3: 16
4: 144
Right 1143765458 17:9134870-9134892 TCTTCCTCCTGCCCTGCTTTTGG 0: 1
1: 0
2: 3
3: 62
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143765458 Original CRISPR TCTTCCTCCTGCCCTGCTTT TGG Intronic
900464133 1:2815823-2815845 TCGTCCTCCTGCCCAGCATGGGG - Intergenic
901206629 1:7501251-7501273 TCTGCCTCCCGCCCTTCTGTTGG - Intronic
902260028 1:15218013-15218035 TTTTCCTCCCACCCTCCTTTAGG - Intronic
902692217 1:18117076-18117098 TCTTCCTAGAGCCCTGCTCTGGG - Intronic
902692937 1:18121646-18121668 TCCTCCACCAGCCCTGCTGTTGG + Intronic
902701572 1:18175792-18175814 TCTTCCCTCTGCCTTGCTCTGGG - Intronic
902806708 1:18865595-18865617 TCCTCCCCCTGCCCTGCGGTTGG + Intronic
902813638 1:18903572-18903594 TCTGCCTAGTGCCCTGCTTGAGG - Intronic
903360265 1:22772580-22772602 TCCACCTCTTGCCTTGCTTTGGG + Intronic
903376967 1:22872755-22872777 TGATCCTCCTGCCCTGCTGTGGG + Intronic
904181587 1:28669550-28669572 TCCTCTTCCTTCCCTGCCTTTGG - Intronic
905861759 1:41356780-41356802 TCGTCCTCCTCCTCTGCCTTGGG - Intergenic
906196081 1:43931595-43931617 TCTCCCTTCAGCCCTGCTCTAGG + Intergenic
906762217 1:48386553-48386575 TCCTTCTCCTTCCTTGCTTTAGG - Intronic
907037687 1:51230581-51230603 TCTTCTTCCTAACCTGGTTTTGG - Intergenic
907415371 1:54310659-54310681 TCTTGCTCTTGCCCTGGTCTGGG - Intronic
907667208 1:56443837-56443859 GCTGCTTCCTGCCCTGCTTTAGG + Intergenic
908169965 1:61494446-61494468 CCTGCCTCCTGCCCCACTTTAGG - Intergenic
908517412 1:64907254-64907276 TATTCCTCCTGGCATCCTTTAGG + Intronic
908612603 1:65879216-65879238 TCTTTTCCCTTCCCTGCTTTGGG - Intronic
909704006 1:78559292-78559314 TCTTCCTCCCTCCCAACTTTTGG - Intergenic
911274226 1:95841027-95841049 TCTTACTCCTTCCCTGCATAGGG + Intergenic
911274238 1:95841096-95841118 TCCTTCTCCTTCCCTGCTTCTGG + Intergenic
911276538 1:95866843-95866865 TCTCCCTACTGACTTGCTTTTGG - Intergenic
912729187 1:112086855-112086877 TGTGTGTCCTGCCCTGCTTTTGG + Intergenic
913563343 1:120045876-120045898 TCTTACACCTCCCCTGCTTCTGG - Intronic
913634780 1:120747704-120747726 TCTTACACCTCCCCTGCTTCTGG + Intergenic
914883032 1:151562307-151562329 TCAGCCTTCTGCACTGCTTTGGG + Intronic
915170334 1:153972986-153973008 TTTTCCTCCTGACCTTCTTGAGG - Exonic
916240545 1:162634719-162634741 CCTTCAGCCTGCACTGCTTTGGG - Intronic
916579623 1:166095667-166095689 TTTTCCTCCTGCCCCCTTTTTGG - Intronic
917793900 1:178518852-178518874 CCTGCCTCCTGCCCTGCTTAAGG - Intronic
918393269 1:184088429-184088451 TCTTCCTCCTCCCCATTTTTTGG - Intergenic
919694662 1:200562070-200562092 TATTTCTCCTGGCCTGCTTTGGG + Intronic
920042427 1:203110512-203110534 TCTTCCTCCCGCCCTCCTTTTGG - Intronic
920059650 1:203218474-203218496 TCCTCTACCTGCCCTGCTTGGGG + Intronic
920803933 1:209215822-209215844 TCCTTCTCCTTCCTTGCTTTAGG - Intergenic
921507213 1:215986643-215986665 TCTTCCTCTTGGCCTGCTGAAGG - Intronic
922671848 1:227515046-227515068 ACTTGTTCATGCCCTGCTTTAGG + Intergenic
922724781 1:227917758-227917780 TCATCCCCCTGCCCTGCATGTGG - Intergenic
922729439 1:227942142-227942164 TCTTGCTCCCGCCCTGCTGCAGG - Intronic
923091456 1:230744337-230744359 TCGTGCTCCTGCCCTGCACTGGG + Intergenic
923272959 1:232373880-232373902 CCTCCTTCCTGCTCTGCTTTCGG - Intergenic
924200792 1:241656582-241656604 TCTTCCCATTGCCTTGCTTTTGG + Intronic
924244560 1:242071507-242071529 TCTTGTTCATGCCCTGCTTTAGG + Intergenic
924585752 1:245359779-245359801 TGATCCACCTGCCTTGCTTTGGG + Intronic
924604129 1:245517524-245517546 TCTGCTTCCTGCCCTCCATTTGG - Intronic
924821823 1:247499852-247499874 TCTTGTTCATGTCCTGCTTTAGG + Intergenic
924838054 1:247675342-247675364 CCTTCTTCATACCCTGCTTTAGG - Intergenic
1063311580 10:4957429-4957451 TTTTCCTCCTGCACGGCTTTTGG + Intronic
1063316217 10:5009041-5009063 TTTTCCTCCTGCACGGCTTTTGG - Intronic
1063624114 10:7673501-7673523 TCCTCCTCCTCCTCTTCTTTTGG - Intergenic
1065884326 10:30063472-30063494 CCCTCCTCCCTCCCTGCTTTAGG + Intronic
1065899168 10:30189538-30189560 TCCTCCTCCTGGCCTGCTTCTGG + Intergenic
1066005621 10:31143926-31143948 TCTTCATCCTGGGCTGTTTTGGG + Intergenic
1066223940 10:33363910-33363932 TCTTGCTCCTTCCCTCTTTTTGG - Intergenic
1066288613 10:33992993-33993015 TTTTCCTGCAGCCCTGCCTTTGG - Intergenic
1067035990 10:42917499-42917521 TCTTCCTCCTTCCCTCCCCTGGG - Intergenic
1068961301 10:62869290-62869312 TTTTCCTCCATCCCAGCTTTGGG - Intronic
1069050352 10:63785981-63786003 TCTTTCTCCTGTCCTGCTGTTGG - Intergenic
1070802424 10:79251452-79251474 TCCTCCTGCTCCCCAGCTTTGGG + Intronic
1070858107 10:79624951-79624973 CCTCCCTCCTTCCCTGCTTTTGG + Intergenic
1071019451 10:81035117-81035139 TCTCCCTCCTTCCTTTCTTTTGG - Intergenic
1071541344 10:86487202-86487224 TCTTCTGCTTGCCCTGCTTGTGG - Intronic
1071569574 10:86689551-86689573 TGTTCTTCTTGCCGTGCTTTGGG + Intronic
1071727705 10:88216725-88216747 TCCTCTTCCTGCCTTTCTTTTGG - Intergenic
1072342265 10:94464314-94464336 TTTTTCTCCTGCCCTCTTTTGGG + Intronic
1072683124 10:97521002-97521024 TCTCCCTCCTGCCCTCCTAGTGG - Intronic
1073509580 10:104034761-104034783 TCTTCCTTCTGCCCAGCTGCCGG - Exonic
1074013609 10:109509406-109509428 TCTTCCTCCTGATTAGCTTTAGG + Intergenic
1074538871 10:114348388-114348410 TATTCCTGCTGCCATGCTGTGGG - Intronic
1075844444 10:125534213-125534235 GCTTCCTCCTCTCCTGCTGTGGG + Intergenic
1076262641 10:129079818-129079840 TCTTCCTCTTGCCCTGTGTCTGG - Intergenic
1076603022 10:131671210-131671232 TCTTCCTCAGTCCCTGCCTTGGG + Intergenic
1076739972 10:132478204-132478226 TCTTCCTCCAGGCCAGCTCTGGG + Intergenic
1076819931 10:132933210-132933232 TCCTCCCCCTGCTCTGCTGTTGG + Intronic
1077220666 11:1414236-1414258 TCCTCCTCCTGCCCGGCCTCTGG - Intronic
1077303360 11:1857052-1857074 CCTTCCTCCTGCCCTGGGTAAGG + Intronic
1077316938 11:1923545-1923567 TCTTCGTACTGCTCTGCATTGGG - Exonic
1077407177 11:2387876-2387898 TGTGCCTCCTGCCCTCCTATGGG - Intronic
1077499685 11:2903538-2903560 TGTTCCTCCTGCCCTCCATCTGG + Exonic
1078066043 11:8080334-8080356 GCTTCCGCCCGCCCTGCTGTGGG + Intronic
1079121473 11:17688234-17688256 GCCTCCTCCTCCCCTGCTTCAGG - Intergenic
1080317771 11:30970030-30970052 TTTCCCTCCTTCCTTGCTTTTGG - Intronic
1080887171 11:36377384-36377406 TCTCCCGCCTGCCTTCCTTTCGG + Intronic
1081099807 11:38987196-38987218 TCCTTCTCCTTCCTTGCTTTTGG + Intergenic
1083280891 11:61626829-61626851 CCTTTCTCCTGCCCTCCCTTGGG + Intergenic
1083661932 11:64255472-64255494 CCTTCCTCCTGCCCTGACCTTGG + Intronic
1084871380 11:72100753-72100775 ACTTCCTCCTGCCCTGCTTAGGG + Intronic
1085033113 11:73284447-73284469 TCTCCCTCCTGCCCTGCCTGAGG - Intronic
1085453630 11:76653936-76653958 TCTTCCTGCTGCCAGGCCTTGGG + Intergenic
1086198324 11:84168897-84168919 TATTCATCCTTCCCTTCTTTTGG + Intronic
1086685520 11:89729610-89729632 TCTCCCTCCTGCCCTCCTACTGG - Intergenic
1088224281 11:107602735-107602757 TTTTCCTCCTTCTTTGCTTTGGG + Intronic
1088962760 11:114686263-114686285 CCATCCTCCCTCCCTGCTTTTGG + Intronic
1089556923 11:119320169-119320191 CCTTCCTCCTGCCCTGGGTCAGG - Intronic
1089563454 11:119357410-119357432 CCTTCCTCCTGCCCTCCCTCCGG + Intronic
1089697590 11:120225639-120225661 CCATCCTCCTGCCCTTCTTCAGG + Exonic
1089759605 11:120713412-120713434 TCTTCCTCCTGCTCTCTTTATGG - Intronic
1089814717 11:121162194-121162216 GCTTCTTCCAGCCCTGCTATGGG + Exonic
1089857793 11:121561887-121561909 TCTTTCTCCAGCCCTGTGTTTGG - Intronic
1089944953 11:122461372-122461394 TCCTTCTCCTTCCTTGCTTTTGG - Intergenic
1090155701 11:124436295-124436317 TCTTCCTCCTGTCTTCCTCTTGG - Intergenic
1090234873 11:125139846-125139868 TCCCCCTCCCCCCCTGCTTTGGG + Intergenic
1091224847 11:133951112-133951134 CCTTCCTCCTGCCTTCCTCTGGG - Intronic
1091313991 11:134597815-134597837 TCTTCCTCCTGGAGTGCTGTGGG + Intergenic
1091399559 12:173878-173900 ACCTCCTCCTGCCCCGCCTTGGG + Intronic
1091546233 12:1503111-1503133 TCCTCCCCCTGCCTTGCTCTGGG - Intergenic
1091785699 12:3242293-3242315 TCTGCCACCCGCCCTGCTCTAGG + Intronic
1091793012 12:3282219-3282241 TCTGCCTCCTGCACTCCTCTGGG + Intronic
1091912166 12:4241246-4241268 TCTCTCTCCTTCCTTGCTTTTGG + Intergenic
1091959968 12:4685469-4685491 TCATCCACCTGCCCTGCTCCAGG + Intronic
1092125307 12:6071252-6071274 TCTTCCTCCTTCCCTGAATCGGG - Intronic
1092228098 12:6761919-6761941 TATTCCCCCTGCCCTCCTTCGGG - Intronic
1092254077 12:6916781-6916803 CCTTCCTCCTGCCCTGCTCCGGG - Intronic
1092864339 12:12746791-12746813 TCTTCCCCCTTCCCTCCTTCTGG + Intronic
1093709974 12:22319609-22319631 TCTTCCCCCAGCCCTGCTGAGGG - Intronic
1093898202 12:24600036-24600058 TGTGCCTCTTTCCCTGCTTTGGG + Intergenic
1094013064 12:25829466-25829488 ACTTCCTCCTGACATTCTTTTGG - Intergenic
1094033176 12:26037160-26037182 TCTTCCTACTGCCCCGCCCTGGG - Intronic
1094525667 12:31229179-31229201 TCTGCCACTTGCCCTGCTCTAGG - Intergenic
1094539871 12:31354315-31354337 TCTTCCTCTTGGCCTGCCCTAGG + Intergenic
1094605953 12:31949315-31949337 ACTTCCTCCTGCCTTTCTATTGG - Intergenic
1094812733 12:34155307-34155329 TCTTGTTCATGCCCTGCTTTAGG - Intergenic
1095095750 12:38147704-38147726 TCTTCCTCCTTCCCTCCCTAGGG + Intergenic
1095298073 12:40549874-40549896 TCTTTCTCTCTCCCTGCTTTAGG + Exonic
1096776907 12:53969890-53969912 TCTACCTCCTCCACTGCTCTGGG - Intergenic
1096842963 12:54390476-54390498 TCTCCCTCCACCCCTGCCTTGGG - Intronic
1097043339 12:56169650-56169672 ACTTCCTCCTGCCCTTCCTTTGG + Exonic
1097055639 12:56247610-56247632 TCCTCCTCCTGCCCTTCTGTAGG - Exonic
1097225120 12:57472499-57472521 TCTTCTTCCTTCCCTGCATCAGG + Exonic
1097638334 12:62148538-62148560 CCTTCCTCCTTCCCCTCTTTTGG - Intronic
1098299898 12:69043383-69043405 TCTTCCTCCTGCCCCTCCTAAGG + Intergenic
1098682303 12:73371264-73371286 TCTTCCTCCTCCCCTGCCTTTGG + Intergenic
1100221907 12:92514131-92514153 TCTTCTTCCTCCCGTGCTATGGG + Intergenic
1100578129 12:95912210-95912232 TCTCCCTCCCTCCCTGCTTTAGG - Intronic
1100988369 12:100226770-100226792 GTTTTCTCCTGCCCTGATTTGGG - Intronic
1101362636 12:104042263-104042285 CCTTCCTCCTGCCTTGCATGGGG + Intronic
1101519434 12:105467861-105467883 GCTTCCTCCGGCCCTGCTCTTGG + Intergenic
1102409634 12:112706508-112706530 TCATTCTCCTGCCCTGCTTCTGG + Intronic
1103536863 12:121639177-121639199 TCTCCTTCATGCCCTGCTCTGGG - Intronic
1105488525 13:20862148-20862170 TCTTCCCTCTCCCCTGTTTTAGG + Intronic
1105647008 13:22331549-22331571 TCTCCTTCCTGCCCTGCCTCTGG + Intergenic
1106084712 13:26531083-26531105 ACTTCATCCTGCTGTGCTTTGGG + Intergenic
1107387851 13:39931806-39931828 TCTCCCTCCTTCCCTCCTTTTGG - Intergenic
1107790199 13:43994325-43994347 TCTGCCTCCCACCCTGCTCTAGG - Intergenic
1108115075 13:47118642-47118664 TCTGACTCCTGCCCTGCTGCTGG - Intergenic
1108704762 13:52974950-52974972 TCTTCCAGCTGCCTTGCTTGGGG + Intergenic
1109213086 13:59557399-59557421 CCTCCCTCCTTCCCTCCTTTTGG - Intergenic
1109548357 13:63859754-63859776 TCTGTCTCCTTCCTTGCTTTTGG - Intergenic
1109742279 13:66569764-66569786 TCTTCCTCCTCACCAGCATTTGG - Intronic
1109883148 13:68507992-68508014 TCTTCTACCATCCCTGCTTTTGG + Intergenic
1111712881 13:91839628-91839650 CCTTCATCCTGCAATGCTTTGGG + Intronic
1112444659 13:99453331-99453353 TCCTCCTCCTGCCCTGGTCCAGG + Intergenic
1112846351 13:103647859-103647881 TCCTTCTCCTTCCCTGCTTTTGG + Intergenic
1113008177 13:105731676-105731698 TTTTCCTCTTGCCTTGCTCTTGG - Intergenic
1113155399 13:107314637-107314659 ACTTCCTCCTGCCCTAGTCTTGG + Intronic
1113227844 13:108178384-108178406 TCTTGCTGCTGCTCTTCTTTGGG + Intergenic
1113262667 13:108582558-108582580 TCTTCCTGCAGCACTGCTTCCGG - Intergenic
1113560803 13:111279243-111279265 TCTTCCACCGGCCATGCTTTAGG + Intronic
1113947416 13:114051895-114051917 TGTTCCTCCTGATCTGCTCTTGG - Intronic
1114323940 14:21570232-21570254 CCTTCCGCCTGCCCTACTGTGGG - Exonic
1114327316 14:21602302-21602324 CCTTCCGCCTGCCCTACTGTGGG - Intergenic
1114330713 14:21634318-21634340 CCTTCCGCCTGCCCTACTGTGGG - Exonic
1114948018 14:27711474-27711496 GCTTCCTCCCTCCCAGCTTTTGG + Intergenic
1115814848 14:37152971-37152993 TTTTCCTCCTTCCCCACTTTTGG - Intronic
1117341724 14:54797765-54797787 TCTCCCTCCTGCCCTCTTCTAGG - Intergenic
1117928969 14:60818733-60818755 TCTCCCTGTTGCTCTGCTTTTGG + Exonic
1118759547 14:68871667-68871689 TCTCCCTGCAGCCCAGCTTTGGG - Intergenic
1118972625 14:70650033-70650055 TTTTCTTCCTCCCTTGCTTTAGG + Intronic
1119569476 14:75657585-75657607 TCTTCCTCCCTTCCTGCTTATGG - Intronic
1119610036 14:76053964-76053986 TCTTCCTCCTCTCATCCTTTAGG + Intronic
1119750798 14:77075979-77076001 TCTTCCTCCTGCCCTAGTTAAGG - Intergenic
1120243735 14:81981373-81981395 TCTTCCTGTTTCCCTGCTTGAGG - Intergenic
1120558338 14:85958312-85958334 CCTTGTTCCTGCCATGCTTTTGG + Intergenic
1121262216 14:92574717-92574739 TCTTCATCCTGCTCTGCTGGAGG + Intronic
1122056580 14:99102475-99102497 TCTTCCTCCTGCTCTGGTCATGG + Intergenic
1122252952 14:100453150-100453172 TCTTCCTACTGCCAGCCTTTAGG - Intronic
1122302282 14:100738073-100738095 TCTTCCTCCTCTCCTAATTTGGG - Exonic
1122747268 14:103905976-103905998 TCTTCCTCACGCCTTGCATTTGG + Intergenic
1122803837 14:104246897-104246919 TCTCCCTCCCGCCCAGCTCTGGG - Intergenic
1123204431 14:106698758-106698780 TCTTCCTCCTTCCCCTTTTTGGG - Intergenic
1123209437 14:106745229-106745251 TCTTCCTCCTTCCCCTTTTTGGG - Intergenic
1123774489 15:23565643-23565665 TTTTCCTTCCCCCCTGCTTTTGG - Intergenic
1124987676 15:34637955-34637977 CCTTCATCCTGCAATGCTTTGGG + Intergenic
1125374342 15:39013061-39013083 TCTTCCTCCTTCCCCTTTTTAGG - Intergenic
1126203757 15:46019325-46019347 TCTGCCTTGTGCCCTGCTCTAGG + Intergenic
1126497159 15:49304471-49304493 CCTTCCTCCTGCCATGATTGTGG - Intronic
1127360425 15:58240391-58240413 TCTTCCTTCTGCCCAGCAATTGG - Intronic
1127605211 15:60580161-60580183 TCTTCTTCCTGTTCTACTTTTGG + Intronic
1128673490 15:69592284-69592306 TCTTCTTCTTGCCCACCTTTAGG - Intergenic
1128792529 15:70443633-70443655 TCTGCCTCCACCCCTGCTTCTGG - Intergenic
1129962790 15:79703156-79703178 TCTCCCTTCTCCCCTGTTTTGGG + Intergenic
1130074096 15:80673979-80674001 TCTTCCTCCAGCCCTCCTCCCGG + Intergenic
1130371149 15:83285672-83285694 TCTTCCACCTGCCTTGCTGCTGG + Intergenic
1132207173 15:99994089-99994111 GCTTCCTTCTGCTTTGCTTTTGG - Intronic
1133256906 16:4522671-4522693 TTTTCCTCCAGACCTGGTTTGGG - Intronic
1135969713 16:27063476-27063498 TCTTCCGCCTCACCTGCTCTGGG - Intergenic
1136272389 16:29156081-29156103 TCCTCCTCCTGCTCTGCTGATGG - Intergenic
1136360391 16:29775689-29775711 TCTTCATCTTTCCCTGCTCTGGG - Intergenic
1136867298 16:33768333-33768355 TATTCCTCCTTCCCTTCTTTTGG + Intergenic
1137536940 16:49334383-49334405 TGTCCCTCCTTCCCTGATTTTGG - Intergenic
1137606259 16:49788703-49788725 TTGTCCTCCTCCCCTGCCTTGGG - Intronic
1137744377 16:50810041-50810063 TCTTCCTCATCCCCTGCTCTGGG - Intergenic
1138094296 16:54199993-54200015 TGTCCCTCCTGCCCTGGTGTCGG - Intergenic
1138483334 16:57318583-57318605 TCAGCCTCCTGCCCTGGTTTGGG + Intergenic
1140562971 16:76005551-76005573 TCTTCTTTCTGCCTTTCTTTGGG + Intergenic
1140829187 16:78735774-78735796 CCTGCCCCCTGCCTTGCTTTAGG + Intronic
1140857343 16:78989697-78989719 TCTCTCTCCTGCTCTGCTTCTGG - Intronic
1140877649 16:79167906-79167928 TCTTCCAACTTCTCTGCTTTTGG + Intronic
1141155200 16:81592511-81592533 CCTTCCTCCTGCGGTGCCTTTGG + Intronic
1141449044 16:84084883-84084905 TCTTGCTTCTGCCCTGTCTTGGG - Intronic
1142075950 16:88117892-88117914 TCCTCCTCCTGCTCTGCTGACGG - Intronic
1142273103 16:89101242-89101264 TGTTCCTCCATCCCTGCTCTGGG - Exonic
1142311529 16:89316979-89317001 TCTTCCTGCTGTGGTGCTTTAGG + Exonic
1203104864 16_KI270728v1_random:1347870-1347892 TATTCCTCCTTCCCTTCTTTTGG - Intergenic
1203128650 16_KI270728v1_random:1614498-1614520 TATTCCTCCTTCCCTTCTTTTGG + Intergenic
1143141075 17:4742080-4742102 TCTTCCTCTCCCCCAGCTTTGGG - Intronic
1143765458 17:9134870-9134892 TCTTCCTCCTGCCCTGCTTTTGG + Intronic
1143856869 17:9857742-9857764 TCTTTCACCTGGCCTGCTCTTGG - Intronic
1143977703 17:10842579-10842601 TCTGCCTCCAGCACTTCTTTTGG + Intergenic
1144132170 17:12256949-12256971 TCTTCCTTCTGCACAGATTTTGG - Intergenic
1144513361 17:15896772-15896794 TCTTCTTCCTGCCCTGCAGGTGG - Intergenic
1145000222 17:19299760-19299782 TCTTTCACCAGCCCTGCATTGGG + Intronic
1145046267 17:19619294-19619316 ACTTTCTCCTGCCCTACCTTGGG + Intergenic
1146380285 17:32322784-32322806 TCATCCTCATGCCCTCCATTCGG - Exonic
1147157145 17:38549684-38549706 TTGTCCTCCAGCCCTGCTTCCGG + Intronic
1147264676 17:39227518-39227540 TCTCCCTCCTCCTCTGCTGTGGG + Intergenic
1148631773 17:49116032-49116054 TCTTTCTCCTCCCTTGCTTTTGG - Intergenic
1150218910 17:63484908-63484930 TCTTCCTGCTGCTCTGCTACGGG + Exonic
1150323230 17:64234043-64234065 TCTGCCTTCTGCTCTGCTTTTGG - Intronic
1150516090 17:65810870-65810892 TGTTCCACCTTCCCTCCTTTAGG - Intronic
1150659205 17:67060907-67060929 TCTGCTTCAGGCCCTGCTTTTGG + Intergenic
1151057725 17:71052951-71052973 TCTGCCTCCCTCTCTGCTTTGGG + Intergenic
1151728501 17:75897690-75897712 TCTTCCTGCTGCCCTCCGCTGGG + Intergenic
1151835589 17:76580921-76580943 TTTTCCTTCTGCCCTGATTCAGG - Intronic
1151875170 17:76863928-76863950 TGTGCCTCCTGCTCTGCATTTGG - Intergenic
1152384757 17:79965639-79965661 TGTCCATCCTGCCCTGCTGTGGG - Intronic
1153027854 18:687624-687646 TCTGCATCCTGCCCTGTTTCAGG + Intronic
1153095296 18:1394555-1394577 ACTGACCCCTGCCCTGCTTTTGG - Intergenic
1153130485 18:1850757-1850779 CCTTCCTCTTTCCCTGATTTGGG - Intergenic
1153630476 18:7064456-7064478 TCTTTCTCATGACCTGATTTCGG + Intronic
1153836591 18:8969487-8969509 GCTGCCTCCTGCCCTTCCTTGGG - Intergenic
1154239606 18:12640701-12640723 TCTTCTTCCCGCCCTGCAGTTGG - Intronic
1155547687 18:26931699-26931721 TCTCCCTCCAGCCTTGCTTCAGG - Intronic
1156041876 18:32832135-32832157 AGTGCCTGCTGCCCTGCTTTTGG - Intergenic
1156363425 18:36404168-36404190 TCTTGGTCCTGCCCTCCTGTAGG + Intronic
1156577113 18:38330117-38330139 TCTTCCTTTTTCCCTGCTATAGG + Intergenic
1157308223 18:46532554-46532576 ACTTCCTCCTCCTTTGCTTTTGG - Intronic
1157628962 18:49078015-49078037 TGTTCCTCCTTTCCTGCTTTGGG + Intronic
1158712128 18:59847293-59847315 TCTGCCTCCGCCCCTGCCTTGGG + Intergenic
1159015586 18:63099610-63099632 TCTGCCCACAGCCCTGCTTTAGG - Intergenic
1160694391 19:475531-475553 GCTGCCTCCTCACCTGCTTTGGG - Intergenic
1161477980 19:4496773-4496795 TCTCCCTCCTCCTCTGCTTGTGG - Intronic
1163404517 19:17113804-17113826 TCTCCTGCCTGCCCTGCATTCGG - Intronic
1163451448 19:17379569-17379591 TTCTCCTCCTGCCCAGCTCTGGG - Intergenic
1163701350 19:18788279-18788301 ACATCCTCCTGCCCTGAGTTGGG + Exonic
1164402828 19:27913435-27913457 TCATCCTGCTGGCCTGGTTTAGG - Intergenic
1164607872 19:29613025-29613047 CCTTCCTCCTGCCCTGCCTCAGG + Intronic
1164611599 19:29636331-29636353 TCTTCCTCGTGCCCTGCAAGTGG + Intergenic
1165138281 19:33684408-33684430 GCTGCCTCCTGCCCTGCTGCTGG - Intronic
1165545807 19:36534961-36534983 CCTTCCTCTTCTCCTGCTTTAGG - Intronic
1166469909 19:43071212-43071234 TCTGCTTCCTGCTCTGCTCTGGG - Intronic
1167178890 19:47886109-47886131 TCTGCCTCCTTACCTGATTTGGG + Exonic
1167327053 19:48833109-48833131 TCCCCCTCCTGCCTTGCATTTGG - Intronic
925214967 2:2086629-2086651 GCTTCTGCCTGCCCTGCTGTTGG + Intronic
925384834 2:3454693-3454715 TCTTCCTGCTGCCCTTCTGAAGG + Intronic
926191840 2:10734259-10734281 TCTTCCTCCTTCCCAGCTCCTGG + Intronic
926224177 2:10955559-10955581 GCTTCCTCCTGCCCTGCACCTGG + Intergenic
926435557 2:12834128-12834150 TTTTCCTCCTCCCCTTCTATTGG - Intergenic
926604264 2:14881356-14881378 TCTTCCTCTCCCCCTACTTTTGG - Intergenic
926798693 2:16640277-16640299 TCTTCCCCCTGCACTGCCATAGG + Intronic
928124016 2:28603851-28603873 GCTCCCTCCCGCCCTGGTTTAGG - Intronic
928396043 2:30944083-30944105 TCCTCCTGCTGCCCTGCCTGAGG + Intronic
929094694 2:38252144-38252166 TCCTCTTCCTGCCCAGCCTTGGG + Intergenic
929829986 2:45339374-45339396 TCCTCCACCTGCACTGGTTTGGG + Intergenic
930615954 2:53593679-53593701 TTGTCCTCCTGCCCAGCTTTTGG - Intronic
930695347 2:54406204-54406226 TCTGTCTCCTGCCTTGCTTCAGG - Intergenic
931722620 2:65078374-65078396 TCTGCCTTGTGTCCTGCTTTGGG + Intronic
931894314 2:66712306-66712328 TCTTCCTCATGCCTTGCCTTTGG + Intergenic
932246820 2:70203211-70203233 GCATCATCCTGCCCTGCCTTGGG - Intronic
933687898 2:85157863-85157885 TCTCCCTCCTTCCCTCCTTAAGG + Intronic
933839683 2:86276360-86276382 TTTTCCTACTGCTCTGCTTCTGG + Intronic
935730999 2:106065222-106065244 TCTCCCTCCCTCCCTGCTTGGGG - Intronic
936006430 2:108892811-108892833 CCCTTCTCCTTCCCTGCTTTTGG + Intergenic
936384991 2:112021232-112021254 TCTTGCTCTTGCTCTGCTGTTGG + Intronic
937151979 2:119692340-119692362 TCTTCCTCCTGCCCTTTGCTGGG - Intergenic
937389715 2:121474435-121474457 GCCTCCTCCTTCCCTTCTTTGGG - Intronic
938639499 2:133265410-133265432 CCTTCCTCCTCCTCTCCTTTTGG - Intronic
939340709 2:140893054-140893076 TTTTCCTCATGCCCTCCCTTGGG - Intronic
939525739 2:143291583-143291605 ACTGCCTCCTGGCCTGCTGTTGG - Intronic
939984183 2:148814024-148814046 TCTTCCTCCTGCCCAGCCTGGGG + Intergenic
940568047 2:155394011-155394033 TCTTCCTGCTGTCCACCTTTTGG + Intergenic
940749232 2:157605957-157605979 TTTCCCTCCTTCCCAGCTTTTGG + Intronic
941621682 2:167786095-167786117 TCTGCCTCCTACCCTGAATTTGG + Intergenic
942190578 2:173465124-173465146 TCTTACTCCTGTGCTGCTTGCGG + Intergenic
942449137 2:176098420-176098442 TCTTCCTCCTGCTCTGGTGGGGG - Intergenic
943038552 2:182775396-182775418 TATTCCTCTTGCCTTGATTTCGG - Exonic
943178441 2:184509464-184509486 TCTTCTTCCTTTCCTGCTTTTGG + Intergenic
943215996 2:185036303-185036325 TCTTCATCCTGCCTTTCCTTAGG - Intergenic
943265920 2:185732290-185732312 TCTTATTTCTTCCCTGCTTTTGG - Intergenic
943491806 2:188562401-188562423 TCTTCTTCCTTCCTTGCTTTTGG + Intronic
943504619 2:188738691-188738713 TCTTCCTCCCTCCCACCTTTTGG + Intronic
943685554 2:190813957-190813979 TCTGCCTCCTGACTTTCTTTGGG + Intergenic
944136888 2:196409458-196409480 TCTTGCTGCTGCCCAGCTTTTGG - Intronic
944978063 2:205080311-205080333 CCTTTCTCCTGCTCTGCTTCCGG + Intronic
945017343 2:205533226-205533248 TTTTCCTTCTGCCTTCCTTTGGG - Intronic
945299089 2:208199368-208199390 CCTTCCTCCTTCCTTTCTTTTGG + Intergenic
945583507 2:211627208-211627230 TCTTCCTCATGGCCAGCTTGAGG - Intronic
946708636 2:222484559-222484581 TCATCCTTCTTCCCTCCTTTTGG + Intronic
947784832 2:232807608-232807630 TCTTCCTCTTGGGCTGCTCTTGG + Intronic
947808319 2:232983377-232983399 TCTGCCTTCTGCCCTGGTCTTGG - Intronic
947998724 2:234549713-234549735 TCTCCCTCCTTCTCTCCTTTTGG + Intergenic
948508668 2:238448498-238448520 TCTTCTTCCTGCCACCCTTTGGG + Exonic
948634037 2:239322743-239322765 TCTTCATCCTGCCCGGGTGTGGG + Intronic
948653817 2:239464723-239464745 TTTTCCTCCTTCCCTACTCTCGG - Intergenic
948813212 2:240495893-240495915 TCCTCCTCCTTCCCCACTTTTGG + Intronic
948949909 2:241242685-241242707 TCCTCCTCCTGCCCTGTGTTTGG - Intronic
1169289278 20:4334935-4334957 TCTTCCTCCTCCTCTGCTCAGGG - Intergenic
1170019977 20:11826586-11826608 TCTCCCTCCCTCCCCGCTTTTGG - Intergenic
1170805836 20:19630797-19630819 TTTTCATCCTGGCCTGCTCTAGG - Intronic
1170973894 20:21142220-21142242 TTTTCCCCCTGCCCTGCCTTAGG + Intronic
1171473375 20:25390017-25390039 TCCTCCTCCTGCTCTGCATCAGG - Intronic
1172010845 20:31844887-31844909 TCTTCCTCATGCCCAGCGTTTGG - Exonic
1173310432 20:41892092-41892114 TCCTCCTCCTCCCCATCTTTAGG + Intergenic
1173464868 20:43272849-43272871 CCTTCCTCCTGCCCCGCCTCAGG + Intergenic
1174247010 20:49188689-49188711 TCTTCCTCTTGTCCTGCCTCTGG + Intergenic
1174302765 20:49594273-49594295 TCTGGCTCCTGCCTGGCTTTTGG - Intergenic
1175274857 20:57761304-57761326 TCTGCCTCCAGCCCTGGGTTGGG + Intergenic
1175567638 20:59993412-59993434 GCTCCCTCCTCCCCTGCTTCTGG + Intronic
1178356844 21:31916579-31916601 TCTTCCTCCTGTCCTGTGTTGGG + Intronic
1179449171 21:41456360-41456382 TCTTCCTGCTGGCCTGCCCTGGG - Intronic
1180037068 21:45255583-45255605 TCTTCCACCTGCCAGGCTTGGGG + Intergenic
1180410911 22:12607281-12607303 GCTGCCTCCTTCCCTGTTTTTGG + Intergenic
1180559119 22:16601616-16601638 ACTTCCTCCTCCCCTGCTCCGGG + Intergenic
1180977952 22:19860859-19860881 TCTCCTTCCTGCCCTGCTGGTGG + Intergenic
1181623442 22:24106364-24106386 TTTTCCTCCTGCCCCTCTTCAGG + Intronic
1182021144 22:27082590-27082612 TCTTCCTCCTGCCATGGTCAAGG + Intergenic
1182368155 22:29792476-29792498 TCCTCCTCCTGCCCTTCTCTAGG + Exonic
1183650550 22:39151283-39151305 TCTTCCTCCAGCTGTGCTTGGGG - Intronic
1184048270 22:41985962-41985984 TCCTCCTCCTGCTTTGCTGTAGG + Exonic
1184651210 22:45920225-45920247 GCTTCCTCCTGCCCCTCTGTGGG - Intergenic
1185092586 22:48784366-48784388 TCGTCTTCCTGGCCTCCTTTGGG + Intronic
950216135 3:11161041-11161063 TTCTCCTCCTGCCCTGCCTGTGG + Intronic
950216146 3:11161100-11161122 TTCTCCTCCTGCCCTGCCTGTGG + Intronic
950265216 3:11568436-11568458 TCTCCCTGCTGCCCTGCGTAGGG - Intronic
950304705 3:11908962-11908984 TCTTCCTCCTGTCCAGACTTTGG - Intergenic
950305686 3:11914083-11914105 TCTTCCTCCTGTCCAGACTTTGG - Intergenic
951068301 3:18294959-18294981 TCTTTCTCCTTCCTTGCTTTAGG - Intronic
951333875 3:21398378-21398400 TCCTTCTCCTTCCTTGCTTTAGG - Intergenic
951829102 3:26904347-26904369 TCTCCCTCCATCCCTCCTTTTGG - Intergenic
951899424 3:27642217-27642239 TCCTCCTCCAGCCCTGCTCAGGG - Intergenic
952039773 3:29248189-29248211 ATTTCCTCCTTCTCTGCTTTTGG - Intergenic
952503972 3:33990602-33990624 TCTTCCTCCTCCCCTGACATTGG - Intergenic
952618137 3:35300592-35300614 TCTTTCTCCTGCTCTTCTGTGGG - Intergenic
952879492 3:37974625-37974647 TCTTTCTCCAAGCCTGCTTTGGG + Intronic
952932800 3:38373205-38373227 TCTTCCTCCTCCTCTCCTCTGGG + Intronic
953847009 3:46435729-46435751 TGCTCTTCCTGCCCTGCCTTGGG + Exonic
954463376 3:50640381-50640403 TCTACCTCCTGCCGGGCCTTGGG - Exonic
954819257 3:53311067-53311089 TCTTCCTCCTCCCATCCTCTTGG - Intronic
954875019 3:53796548-53796570 TCTTTCTCCTGCCCACTTTTAGG - Intronic
956268156 3:67421446-67421468 TCTTCGCTCTGCCCTGCTTTAGG + Intronic
956342549 3:68242191-68242213 CCCTTCTCCTGCCCTGCTTGTGG + Intronic
958510073 3:95036951-95036973 CCTTCATGCTGCACTGCTTTGGG + Intergenic
959220967 3:103519139-103519161 ACTTGCTCCTGCCTTACTTTTGG + Intergenic
959271355 3:104214767-104214789 CCTTCCTCCTGCCCTCGTTTTGG - Intergenic
960820297 3:121723708-121723730 TCTTCCTTCTGCCCTTCACTTGG - Intronic
961052337 3:123757509-123757531 TCTTCCTCCATCCCTGATGTGGG - Intronic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
961462565 3:127061834-127061856 CCTTCCTGCTGCCCTGTATTGGG + Intergenic
961670660 3:128526539-128526561 TCTCCCTCCCTCCCTCCTTTTGG + Intergenic
961861258 3:129918272-129918294 TCTTCCTCCTGTCCGGACTTTGG - Intergenic
962599111 3:136977044-136977066 TCCTCCTCCTTCCTTGCTTTTGG + Intronic
962616675 3:137133618-137133640 TCTTCCTCATGCCCTACCTTGGG + Intergenic
963907324 3:150783344-150783366 TCTTCCACATGCCCTCCTTCTGG - Intergenic
964238130 3:154558489-154558511 TCTCCCTCCTGCCCCGCAATAGG + Intergenic
964800621 3:160553329-160553351 TTTTACTCCTGGCCTGCTTACGG - Intronic
965802798 3:172511928-172511950 TCTTCCTCCTGCACTGCTCCAGG - Intronic
966798819 3:183743277-183743299 TATTTCTCATGCCCTGTTTTTGG + Intronic
966910491 3:184557019-184557041 TCTTCCTCCACCGTTGCTTTCGG - Intronic
966912453 3:184566999-184567021 TCCTCCTCATGCCCTGCTCAAGG + Intronic
967059913 3:185862889-185862911 CCTTCTTCCCTCCCTGCTTTTGG - Intergenic
967396719 3:189016749-189016771 TCTTTCTCCTGCTCTGCCATGGG + Intronic
967702486 3:192609406-192609428 CCTCCCTCCTACCCTGGTTTGGG - Intronic
967851247 3:194084121-194084143 TTTGCCTCCAGCCCTACTTTAGG - Intergenic
968451610 4:678648-678670 TCTTCCTGCTGGCCTGCGGTGGG - Exonic
968908970 4:3467014-3467036 CCTTGCTCCTGCCCAGCTTCTGG + Intronic
969119605 4:4898448-4898470 TCTGTCTCCAGCTCTGCTTTTGG - Intergenic
969176632 4:5403737-5403759 TCTTCCTCCTGGCATGCTGGGGG - Intronic
969395388 4:6917399-6917421 CCTTCCTCCTGGGCTCCTTTTGG - Intronic
969849743 4:9946983-9947005 CCTTCCTCCAAGCCTGCTTTAGG + Intronic
970819770 4:20198464-20198486 TCTTCCTCCTTCTCTTATTTGGG + Intergenic
971024221 4:22571937-22571959 TCCTTCTCCTTCCTTGCTTTAGG + Intergenic
971028149 4:22608420-22608442 TCTCCCTCCAGCCTTGCTTCAGG - Intergenic
971149291 4:24014014-24014036 TCTTCCTCGTGCAATGCTGTAGG + Intergenic
975744972 4:77466617-77466639 GCCTCCCCCTGCCCTGCTGTGGG + Intergenic
977398587 4:96502331-96502353 TAATCCTCCTTACCTGCTTTTGG + Intergenic
979094837 4:116534555-116534577 CTTTCTTCCTGTCCTGCTTTTGG - Intergenic
979145321 4:117239755-117239777 TCTTCATCCTTGCCTGCTTGGGG + Intergenic
979840391 4:125432172-125432194 GCTGCTTCCTGCGCTGCTTTGGG - Intronic
979976615 4:127204514-127204536 TATTTCTCCTGCTCAGCTTTGGG - Intergenic
980585395 4:134807463-134807485 TCTTGTGACTGCCCTGCTTTGGG - Intergenic
980923333 4:139109812-139109834 TGTTCCTCCCTCCCTCCTTTTGG - Intronic
980948845 4:139350970-139350992 TCTTTATCCTGTTCTGCTTTAGG - Intronic
981031356 4:140128764-140128786 TCTTTCTCTTGCCCTGCATGTGG - Intronic
982422341 4:155211900-155211922 TCTTCCTCCCTCTCTGCTCTTGG - Intronic
983228866 4:165110345-165110367 CCTTCCTCCTCCTCTGCTCTAGG + Intronic
983578282 4:169282172-169282194 TCATCCACCTTCCCTCCTTTTGG - Intergenic
984970489 4:185184580-185184602 TGTTCCTCCAGCCCTGGTGTTGG - Intronic
985950933 5:3220835-3220857 TCTTCCCCTTGCTCTGCTTGTGG - Intergenic
986021547 5:3809044-3809066 TCTTCCTCCTCCTCCACTTTGGG + Intergenic
986618002 5:9639430-9639452 TTTTCCTCCTATCATGCTTTGGG + Intronic
987037201 5:14030596-14030618 CCTTCCTTCTGCTCTGATTTGGG + Intergenic
989175635 5:38522317-38522339 TCCTCTTCCTTCCCTGCTTTAGG + Intronic
989230904 5:39085853-39085875 TCTTTCTCCTTCCTTGCTTTAGG - Intergenic
989570659 5:42943275-42943297 TGTCCCTCCTTCCCTCCTTTTGG - Intergenic
989655039 5:43737329-43737351 TCTCTCTCCTTCCTTGCTTTAGG + Intergenic
990392166 5:55334989-55335011 TCTGCATCCTTCCCTGCTCTTGG + Intronic
991188321 5:63837726-63837748 TAGTCCTATTGCCCTGCTTTTGG - Intergenic
991301977 5:65137512-65137534 TCTCACTCCTGCCCTTCATTCGG + Intergenic
991979268 5:72214710-72214732 TCTGTCTCCTGTCTTGCTTTAGG + Intergenic
992194811 5:74328628-74328650 TTTTCCTCCTCCCCTGCCTATGG - Intergenic
992704767 5:79380071-79380093 ACTTCCTTCTTCCTTGCTTTAGG - Intronic
993464005 5:88222356-88222378 ACTGCCCCCAGCCCTGCTTTAGG + Intronic
993849181 5:92984398-92984420 TTTTTCTCCTGCCTTGATTTTGG - Intergenic
995294898 5:110508534-110508556 CCTTCCTCATGCCCTCCTTCTGG + Intronic
995620254 5:114018256-114018278 TCTTCCTCCAGCCTTGCTCTGGG - Intergenic
997394839 5:133550990-133551012 TCTTGCTCCTCTCCTCCTTTAGG + Intronic
997476540 5:134145800-134145822 TCTTCCTCTAGCCCAGCTTGAGG + Intronic
997792948 5:136778784-136778806 TGATTCTCTTGCCCTGCTTTGGG + Intergenic
997911196 5:137875338-137875360 TCCACCTCTTTCCCTGCTTTCGG - Intronic
998007464 5:138666441-138666463 TTTTCCTCGTGCCAGGCTTTAGG + Intronic
998754422 5:145360261-145360283 CCTTCCTCCTGCCACTCTTTGGG - Intergenic
999354728 5:150915423-150915445 TCTTCCTCCTTCCCTTTTTTAGG + Intergenic
1000022586 5:157331415-157331437 TCCTCCTACAGCCCTGCTGTTGG + Intronic
1000100924 5:158015472-158015494 TCTCCCTCCCTCCCTCCTTTTGG + Intergenic
1001043062 5:168350628-168350650 TTTTCCTCCTGTCCTGCCCTTGG - Intronic
1002079607 5:176729516-176729538 TCTTCCTCCTTCCCTGGGGTGGG - Intergenic
1003277446 6:4664658-4664680 TCTTCCTTAGGCCGTGCTTTGGG + Intergenic
1003631359 6:7790614-7790636 TCTGCCTCCTGCCCTTCTACTGG + Intronic
1003977792 6:11360296-11360318 TCTTGCTCATGCTCTCCTTTGGG - Intronic
1004260794 6:14105972-14105994 TCCTCCTCCTGCCCTTTTTATGG - Intergenic
1004429785 6:15533149-15533171 TCTGCCCCATGCCCTGCTCTGGG + Intronic
1004649484 6:17594868-17594890 TTTTTCTCCAGCCCTGCTCTTGG - Intergenic
1005158354 6:22834194-22834216 GGTCCCTACTGCCCTGCTTTGGG + Intergenic
1006179554 6:32146516-32146538 TCTCCCTCCTGCCTTATTTTTGG - Intergenic
1006453883 6:34121286-34121308 TCTTCCAGCTGCTCTGCTGTGGG + Intronic
1007387603 6:41530320-41530342 TCTTCCTCCCTCCCTTCCTTTGG + Intergenic
1008595649 6:53039407-53039429 TCTTGCCCAGGCCCTGCTTTTGG - Intronic
1009296048 6:61949022-61949044 TCTTCTTCCTTCCCTCTTTTGGG + Intronic
1009819393 6:68780473-68780495 TTTTCCTCCTGACTTCCTTTGGG - Intronic
1010940059 6:81906274-81906296 CCTTCCTCCTGTCCTGTATTGGG + Intergenic
1011963730 6:93125357-93125379 TCTTGCTCCTGCCCTATTTGTGG - Intergenic
1012520086 6:100110684-100110706 TCTTCCTCCTTGTCTGCTTTTGG - Intergenic
1012593366 6:101010875-101010897 TCCTGCTCCTGCTTTGCTTTTGG + Intergenic
1013365403 6:109433894-109433916 TCTTCCTCCTGCCTTTCTCATGG - Intronic
1014780234 6:125557045-125557067 TCTTCCTCTTTCCCTTCCTTTGG - Intergenic
1015635076 6:135266964-135266986 TCATTCTCCAGCCCTCCTTTTGG + Intergenic
1015838124 6:137444409-137444431 TCTCTCTCCTTCCCTGATTTTGG + Intergenic
1016481969 6:144492170-144492192 CTTTCCTCCTTCCCTCCTTTTGG + Intronic
1017012272 6:150070622-150070644 CCCTCCTCCTGTCCTGCTTGGGG - Intergenic
1017929763 6:158941573-158941595 TCTTCTTCCTGCCCTACTTGGGG - Intergenic
1019164782 6:170091084-170091106 TCTGCCCCCTGCCCTGCTCCCGG + Intergenic
1019193000 6:170264373-170264395 TCCTCCTCCTGCCTTGCATGCGG - Intergenic
1019341199 7:509951-509973 TCCTTCTCCTGGGCTGCTTTAGG + Intronic
1019778263 7:2925143-2925165 TCCTCTTCCTGCCCTGCTTCAGG - Intronic
1020047139 7:5048836-5048858 TCTTCCTCCTGCTCTGGTGATGG - Intronic
1020097027 7:5374912-5374934 GCTTCCTCCTGCCCTCTTTGGGG - Intronic
1020292500 7:6732694-6732716 TCTTCCTCCTGCTCTGGTGATGG - Intergenic
1020526966 7:9274443-9274465 TCTTCTTCTTGGACTGCTTTGGG - Intergenic
1021579918 7:22141734-22141756 TGGTCCTCCTGTCCAGCTTTTGG + Intronic
1022550064 7:31229531-31229553 TCCTTCTCCTTCCTTGCTTTAGG + Intergenic
1022610433 7:31866727-31866749 TCTCTCTCCTTCCTTGCTTTAGG - Intronic
1023379057 7:39587624-39587646 TCTGCCACATCCCCTGCTTTGGG + Intronic
1024282219 7:47728712-47728734 TCCTCCTCGTTCCCTGGTTTTGG + Intronic
1026214851 7:68339431-68339453 TCTTCCTCTTCCTCCGCTTTTGG - Intergenic
1026575645 7:71569423-71569445 TCTCCCTCCCTACCTGCTTTTGG + Intronic
1026847679 7:73706891-73706913 TCTCCCTCCTGCCCTTCCTGAGG + Intronic
1027116164 7:75483435-75483457 TCTTCCTCCTGCTCTGGTGATGG + Intronic
1027275663 7:76552263-76552285 TCTTCCTCCTGCTCTGGTGATGG - Intergenic
1028348313 7:89811578-89811600 TCTCCCTCCCTCCCTTCTTTTGG - Intergenic
1028905413 7:96148796-96148818 ACTGCCTCCTTCCCTGCTGTTGG - Intronic
1029657117 7:101934663-101934685 TCTTCCTCCTTCCCAGTTTCTGG + Intronic
1029721370 7:102366817-102366839 TCTTCCTCCTGCTCTGGTGATGG - Intronic
1029746974 7:102521402-102521424 TCTTCCTCCAGCAATGCCTTCGG - Intergenic
1029764927 7:102620491-102620513 TCTTCCTCCAGCAATGCCTTCGG - Intronic
1030739116 7:113086804-113086826 ACTTCCTCGTGCGCTGCCTTTGG - Intronic
1031030672 7:116730766-116730788 TCTTCCTCCTGCCTGACCTTAGG - Intronic
1031438507 7:121763427-121763449 TTTCCCTCCCACCCTGCTTTTGG + Intergenic
1031754401 7:125619275-125619297 TCCTTCTCCTTCCTTGCTTTTGG + Intergenic
1031770922 7:125841312-125841334 TATCCCTCCTGCCCTGTTTTAGG - Intergenic
1032059348 7:128711146-128711168 CTTTCCTCCTGGCATGCTTTGGG + Intronic
1032873361 7:136010738-136010760 TCTTACTTCTGTCCTGTTTTGGG + Intergenic
1033352605 7:140573822-140573844 TCTTCTTCCTGCCGTTCTGTGGG + Exonic
1034618202 7:152436391-152436413 ACTTCCTCCTCCCCTGCTCCGGG - Intergenic
1035099240 7:156382680-156382702 GCTTCCTCCTCCCCTGCTGGGGG + Intergenic
1035132803 7:156671188-156671210 TCTTCCATCTGCCCTGCCATTGG - Intronic
1035402858 7:158578690-158578712 CCTTCCTCCCTCCCTTCTTTAGG + Intronic
1035655647 8:1302904-1302926 GCCTCCTTCTGCCGTGCTTTTGG + Intergenic
1036109218 8:5879054-5879076 TCTTCCTCCTTCCCCTTTTTAGG + Intergenic
1037648977 8:20819550-20819572 ACCTCCTCCTTCCCTCCTTTTGG - Intergenic
1037936724 8:22919917-22919939 TTTTCCTGCTCCCCTGCTCTGGG - Intronic
1038997997 8:32946335-32946357 TTTTTCTCCTTCCTTGCTTTGGG + Intergenic
1039088155 8:33800178-33800200 TCTTCCTCCTTCCTTGCCTGTGG + Intergenic
1039413322 8:37373861-37373883 TCCTCCTTCTTCCCTGCCTTGGG + Intergenic
1039711662 8:40061604-40061626 AATTCCTCCTGCCCTGCTGCAGG + Intergenic
1039936800 8:42052246-42052268 TCCTCCTCCTCCCCTGGCTTTGG - Intergenic
1040381476 8:46877307-46877329 TCTTCCTCCTTTGCTGCTTTAGG - Intergenic
1040930739 8:52732571-52732593 TCTTCCTCCATCCTTTCTTTAGG - Intronic
1040951370 8:52941142-52941164 TCTTCCTCCACCTCGGCTTTAGG - Intergenic
1041005451 8:53493353-53493375 CCTCCCTCCTTCCCTGCTGTAGG + Intergenic
1041625333 8:60019504-60019526 TCTTCCTCATCCCCTGCTACAGG + Intergenic
1041789234 8:61673327-61673349 CCTTCAGCCTGCCTTGCTTTGGG - Intronic
1042032079 8:64487246-64487268 TCTTCTTCCTGACATGCTCTGGG - Intergenic
1042094364 8:65196770-65196792 CCTGTCTCCTGCCCAGCTTTTGG + Intergenic
1042862054 8:73324878-73324900 TCTTCCTCAAGTCCTGCATTGGG - Exonic
1042886650 8:73559721-73559743 CCTTCCTGCTGCCCTGTTGTTGG + Intronic
1045009119 8:97942607-97942629 TCTTCCTCATGACTTGTTTTTGG - Intronic
1045459469 8:102413024-102413046 TCTTCCTCCTCGCCTCCTCTGGG - Intergenic
1045534486 8:103014316-103014338 TTTTGCCCCTGCCCTGGTTTAGG - Intergenic
1045848445 8:106664023-106664045 TCTTCCTCCCATCCGGCTTTAGG - Intronic
1047174218 8:122525129-122525151 CCTTCCTCCTGCCCTGCAATAGG - Intergenic
1047744368 8:127833259-127833281 TCTACCTCCTGCCCTGCCCTGGG + Intergenic
1048206933 8:132422941-132422963 TCTCCTTCCTGCCCTCCTTCAGG - Intronic
1048311117 8:133323238-133323260 TCCTCCTCCTGCCCTGCCCCAGG - Intergenic
1048400189 8:134058695-134058717 TCTTGCCCCTGCCATGCTCTGGG + Intergenic
1048515326 8:135103414-135103436 TCTTCCACCCTCCCTGTTTTTGG + Intergenic
1049197498 8:141323805-141323827 TCTTCCTGCTGCCCTGGCCTGGG + Intergenic
1049590273 8:143456213-143456235 TCTTCCCCCTGCCTTCCTATGGG - Intronic
1049813949 8:144589412-144589434 GCTTCCCGCTGCCCTGCTCTGGG - Intronic
1050506911 9:6358099-6358121 TCTACCTCCTGCCCAGCTCTTGG + Intergenic
1052040528 9:23733735-23733757 CCTTACTCCTGGCCTGCTGTAGG + Intronic
1052141160 9:24986362-24986384 CCTTTCTCCAGCTCTGCTTTTGG - Intergenic
1053216691 9:36277396-36277418 TCTTGCTCGTGTCTTGCTTTTGG + Intronic
1053294528 9:36903202-36903224 TCTTCCTCCTTCCTTGGTCTGGG - Intronic
1053439710 9:38106137-38106159 TTTTCCTCCTCCCCTGACTTAGG - Intergenic
1054144479 9:61552126-61552148 TCTGCCTCCTGCTCTGCCTGCGG - Intergenic
1054922671 9:70557723-70557745 GCCTCCTCCTTCCTTGCTTTTGG + Intronic
1056038613 9:82636830-82636852 TCCTTCTCCTTCCCTGTTTTTGG - Intergenic
1056554134 9:87675361-87675383 TCTTCCTCCAGCCCTTCCTCGGG - Intronic
1056569582 9:87803522-87803544 TCTTCCTCCAGCCCTTCCTCGGG + Intergenic
1057517110 9:95731134-95731156 TCTTCCTCATGCCATGGATTTGG - Intergenic
1057843318 9:98503276-98503298 CCTCCCTCAAGCCCTGCTTTAGG - Intronic
1058228574 9:102397313-102397335 GCTTCCTCCTCCCATGGTTTCGG + Intergenic
1058604571 9:106706932-106706954 TCTTCCTCCTACCTAGCTTGGGG + Intergenic
1059114058 9:111584895-111584917 TCTACCTCAAGCCCTCCTTTTGG - Intronic
1060011033 9:120042948-120042970 CTTTCCTCCTTCCCTGCATTTGG - Intergenic
1060271295 9:122143952-122143974 TGTTCCTCTTGCTTTGCTTTAGG - Intergenic
1061371368 9:130199435-130199457 TCTTCCTCCATCTCTGATTTGGG + Intronic
1061505492 9:131029551-131029573 TCTTTGTCCTGCTCTGCTCTTGG - Intronic
1061601496 9:131673331-131673353 TTTTCATCCAGCCCTGATTTGGG - Intronic
1061865313 9:133489082-133489104 TCCTCCTGCTGCCCTGCTCTGGG - Intergenic
1062183192 9:135202240-135202262 TCTCTCACCTGCCCTGCTTGAGG + Intergenic
1062463761 9:136672417-136672439 TCTTCCTCCTCCCCTTCCTCGGG + Exonic
1187155094 X:16714362-16714384 TCCACCTCCTGCCATCCTTTTGG - Intergenic
1187365868 X:18665412-18665434 TCTACCTCCTGCCCACCTCTCGG + Intronic
1187510954 X:19919067-19919089 ATATCCTCCTGCCCAGCTTTTGG + Intronic
1188581665 X:31721506-31721528 TCTCCATCCTGCCAGGCTTTTGG + Intronic
1188739872 X:33764625-33764647 ACTTCTTCCTTCCTTGCTTTAGG + Intergenic
1188970314 X:36607244-36607266 CCATCCTTCTGCCCTGCTCTGGG + Intergenic
1191580827 X:62758932-62758954 TCTTCCTCCTTTGCTGCTTTAGG + Intergenic
1191634777 X:63363684-63363706 TCTTCCTCCTTCCCCTTTTTTGG + Intergenic
1191689787 X:63927841-63927863 TTTTCCTTCTGCACTGCCTTAGG - Intergenic
1191826271 X:65367944-65367966 TCTTCCCACTACCCAGCTTTGGG - Intronic
1192078326 X:68022763-68022785 TCCTACTCCTTCTCTGCTTTGGG + Intergenic
1192132285 X:68563646-68563668 TCTTCCTCCTTGCCTTTTTTTGG + Intergenic
1192419450 X:71016214-71016236 GCTTTCTCCTTCCCTTCTTTGGG + Intergenic
1192609478 X:72553434-72553456 TCTCCCTCCTGCCCCTTTTTTGG + Intronic
1192748815 X:73966421-73966443 TCTTCCTCCTGCTGTAATTTTGG + Intergenic
1192809871 X:74538053-74538075 TCTTCCACATGCCCTCCTTGGGG - Intergenic
1195377255 X:104239818-104239840 ATTTCCTTCTGCCCTTCTTTTGG - Intergenic
1195699762 X:107695601-107695623 TCTTCTTCCCAACCTGCTTTTGG - Intergenic
1195816338 X:108893638-108893660 TCTTCATACTGTGCTGCTTTGGG - Intergenic
1196899192 X:120366606-120366628 TCTTCCTCCTCCTCCGATTTGGG - Exonic
1197083226 X:122442991-122443013 TACTCCTCCAGCTCTGCTTTTGG + Intergenic
1198276102 X:135097544-135097566 ACTGCCTCCTGCCCTGTCTTTGG - Intergenic
1198310411 X:135423191-135423213 ACTGCCTCCTGCCCTGTCTTTGG + Intergenic
1198379621 X:136071601-136071623 CCGTCCTCCTGCCCTGCTGCAGG + Intergenic
1201324774 Y:12744491-12744513 TCTCCCTCATTCCCTGCTTCAGG + Intronic
1201757829 Y:17506361-17506383 TCTTGTTCATGCCGTGCTTTAGG - Intergenic
1201843725 Y:18399621-18399643 TCTTGTTCATGCCGTGCTTTAGG + Intergenic
1202068679 Y:20968022-20968044 TCTTCCTCCTTCCCCTTTTTAGG - Intergenic
1202081920 Y:21092490-21092512 TCTTCCTCCCTTCCTTCTTTAGG + Intergenic