ID: 1143766478

View in Genome Browser
Species Human (GRCh38)
Location 17:9141096-9141118
Sequence GAGCAATCTGAGATGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 252}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143766474_1143766478 -1 Left 1143766474 17:9141074-9141096 CCATTAAGTTTGAAGTGCTTTTG 0: 1
1: 0
2: 0
3: 29
4: 246
Right 1143766478 17:9141096-9141118 GAGCAATCTGAGATGTGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143766478 Original CRISPR GAGCAATCTGAGATGTGGGG TGG Intronic
900631955 1:3641274-3641296 GAGCATGCTGAGTTGTGGTGTGG - Intronic
902505554 1:16937470-16937492 GAGAAATGTGAGATCTGGAGAGG + Intronic
903478878 1:23638757-23638779 GAGCAATCTGGGTTGTTGAGGGG + Intronic
905529374 1:38664510-38664532 GAGGAATCAAAGATCTGGGGAGG - Intergenic
905911335 1:41656985-41657007 GAGGAAACTGAGATCTGGAGAGG + Intronic
906409791 1:45569257-45569279 GGGGAATGTGAGATTTGGGGTGG + Intronic
906808614 1:48803967-48803989 GAGGAAACTGAGATGTTGAGAGG - Intronic
906872037 1:49493654-49493676 GAGGAAACTGAAATGTGGGCTGG + Intronic
907409759 1:54275596-54275618 GGGCACTGTGAGCTGTGGGGTGG - Intronic
908462194 1:64356777-64356799 GAGCAATCTTGGGTCTGGGGAGG - Intergenic
908877793 1:68697696-68697718 AAGCAACCTGGGCTGTGGGGAGG + Intergenic
911931841 1:103914490-103914512 GAGAAATTTGAGATGTGATGAGG + Intergenic
912568702 1:110606759-110606781 AAGGAAGCTGAGATCTGGGGCGG - Intronic
914416996 1:147493514-147493536 GAGCAATGTGAGATGAAGGAGGG + Intergenic
915168829 1:153963661-153963683 GAGCAATCAGAGATCGGGAGCGG + Intronic
915579436 1:156804663-156804685 GAGCAAGAGGAGAGGTGGGGAGG - Intergenic
917303029 1:173598650-173598672 GAGCAAACTGAGGTATAGGGAGG - Intronic
919804700 1:201374639-201374661 AAGAGAGCTGAGATGTGGGGAGG - Intronic
920796018 1:209137595-209137617 TAGAAATCTGAGATGTGGCCAGG + Intergenic
921527752 1:216239177-216239199 GAGCAATGTGTGCTTTGGGGTGG - Intronic
923196938 1:231677613-231677635 GAGCAAACTGAGACCTGGAGAGG + Intronic
923371861 1:233322526-233322548 GAGGAATCTGAGTTGTGGTGTGG + Intergenic
1063543135 10:6954727-6954749 GAGAATTCTCAGATCTGGGGAGG + Intergenic
1064601914 10:17002413-17002435 GTGCAATCTGTGATTTGGGAAGG + Intronic
1064676135 10:17762216-17762238 TAGCAGACTGAGATGTGGCGTGG - Intronic
1065141820 10:22725677-22725699 GAGCAACCTGGGATGGGGGTAGG + Intergenic
1067410031 10:46056019-46056041 GAGGAATCTGAGACCTGGTGAGG - Intergenic
1068567230 10:58589362-58589384 GAGGAAACTGAGGTGTGGGGAGG + Intronic
1071574422 10:86715303-86715325 GAGCAGACTGAAATGTGGTGAGG + Intronic
1073135173 10:101216251-101216273 TAGCACGCTGAGATGTGGGAAGG + Intergenic
1074569986 10:114615461-114615483 GAGGAAACTGAGATGGGGGTCGG - Intronic
1075289878 10:121219907-121219929 GAGGAAACTGAGACATGGGGAGG - Intergenic
1075403971 10:122182043-122182065 GAGCAAACCCAGATGTGGGATGG - Intronic
1075588018 10:123671313-123671335 CAGCATTATGACATGTGGGGTGG - Intronic
1075611851 10:123860989-123861011 GTGCAGTCTGAGGGGTGGGGTGG + Intronic
1075886291 10:125902103-125902125 GAGCAATGTGAGGTGGGGGGAGG + Intronic
1076469568 10:130709132-130709154 GAACAATCTGAGATGGGGCCGGG - Intergenic
1076524951 10:131106592-131106614 GGGCAGTCTGAGATGTGGTTAGG + Intronic
1076529309 10:131133937-131133959 GAGAAATCTGAGATCAGGGTTGG + Intronic
1079915531 11:26364854-26364876 GAGGGATATGAGATTTGGGGTGG - Intronic
1080602595 11:33834476-33834498 GAGGAAGCTGAGATGTGGCAGGG - Intergenic
1081430618 11:42972726-42972748 AAGCATTCTGAGAAGTGGGAAGG - Intergenic
1081484284 11:43515889-43515911 GAGAAATGAGAGATCTGGGGAGG + Intergenic
1081695573 11:45106877-45106899 TATGAATCAGAGATGTGGGGTGG + Intronic
1084309872 11:68310865-68310887 GAGCAGGGTGAGATGTGGGAAGG + Intergenic
1085060356 11:73440305-73440327 GAGAAGTGTGAGGTGTGGGGTGG - Intronic
1085565788 11:77512271-77512293 GAGAAATCTGAAATAGGGGGAGG - Intergenic
1085718271 11:78891695-78891717 GAGGAAACTGAGATGTGGAGAGG + Intronic
1086314323 11:85574530-85574552 TAGCAATATGAGATTTGGTGGGG - Intronic
1088792930 11:113242086-113242108 AAGAAATCTGAGACTTGGGGAGG - Intronic
1088836297 11:113580464-113580486 CAGCAATCTGAGATTTTGGGAGG - Intergenic
1091751265 12:3022543-3022565 GAGCTATCTGAGAAGCTGGGTGG - Intronic
1092495954 12:8995390-8995412 AAGGAATCTGTGATTTGGGGGGG + Intronic
1094352227 12:29539903-29539925 GAGCCATCTGTGAAGTGGTGTGG - Intronic
1094354606 12:29564612-29564634 GAGCAGTTTCACATGTGGGGAGG + Intronic
1097351266 12:58551660-58551682 GACAAATCTGAGAGGTAGGGTGG + Intronic
1100404593 12:94262545-94262567 GAGCACTCTGAGTGGTGAGGGGG + Intronic
1100956165 12:99911086-99911108 GAGAAAACTGAGATTTAGGGTGG + Intronic
1101598560 12:106188859-106188881 CAGCAAGCTGAGGTGTGGAGGGG - Intergenic
1103451731 12:121033891-121033913 GAGAAAACTGAGATGTCTGGAGG + Intronic
1104351165 12:128045139-128045161 GAGATGTCTGAGAAGTGGGGAGG + Intergenic
1106203592 13:27566946-27566968 GGGCAAGTTGAGATGAGGGGAGG - Intronic
1106288348 13:28337741-28337763 TAGCAATCTGTGATGTGGTGTGG + Intronic
1107133609 13:36920626-36920648 AAGAAATCTCAGAGGTGGGGTGG - Intronic
1108203697 13:48066876-48066898 AATCAATCTGTGAGGTGGGGGGG + Intronic
1108890397 13:55251179-55251201 GAGCATTCTGGGATGGGTGGAGG + Intergenic
1111565282 13:90006115-90006137 GACCAATCTGAGATCTGGAATGG + Intergenic
1113031282 13:105996577-105996599 GCACACCCTGAGATGTGGGGCGG - Intergenic
1113324985 13:109272196-109272218 GAGACATCTGAAAAGTGGGGAGG - Intergenic
1116780091 14:49227627-49227649 GAACAATCTGAGAGGAGGGAAGG - Intergenic
1117218753 14:53579912-53579934 AAGCAATCTGAGAAATGGAGGGG + Intergenic
1119205846 14:72792817-72792839 CAGCAATCTAAGATTTGGAGGGG - Intronic
1121183959 14:91950434-91950456 GAGAAAACTGAGATGTCGAGAGG - Intergenic
1202871785 14_GL000225v1_random:171816-171838 GAGCAATATGGGGTGGGGGGAGG - Intergenic
1123804293 15:23855152-23855174 GAGCATGCAGAGATGTGGGCAGG + Intergenic
1128285352 15:66432068-66432090 GAGAAATCTGAAATGTGGCAAGG + Intronic
1128433842 15:67626127-67626149 GAAGAATCTGTGATGTGGAGGGG + Intronic
1128746224 15:70116337-70116359 GAGCAATCTGGGGTAGGGGGTGG + Intergenic
1130151970 15:81318093-81318115 GAGGAAACTGAGGTTTGGGGAGG - Intronic
1130386767 15:83418752-83418774 GAGCAGTTTGAGAAGTGAGGCGG - Intergenic
1130912297 15:88279106-88279128 GAGTAACCTGAGACTTGGGGAGG + Intergenic
1131295686 15:91147316-91147338 GAGCTCCCTGAGATGTGGGGTGG + Intronic
1131581283 15:93646252-93646274 GTTCATTCTGAGAAGTGGGGTGG + Intergenic
1134445841 16:14330915-14330937 GAGTAATCTGGGATGAGGGAAGG + Intergenic
1137256745 16:46781490-46781512 GAGCAAACTGAGATCTAGGAAGG + Intronic
1137908154 16:52347294-52347316 GAGCCATCTGAGATTTTGGTAGG - Intergenic
1139708792 16:68760842-68760864 GGGGAGTCTGGGATGTGGGGTGG + Intronic
1140282711 16:73569119-73569141 GAGCATTCTGAGATAGAGGGTGG - Intergenic
1141525834 16:84610914-84610936 AATAAATTTGAGATGTGGGGTGG - Intronic
1141626228 16:85262725-85262747 GAGGAAACTGGGCTGTGGGGAGG - Intergenic
1143766478 17:9141096-9141118 GAGCAATCTGAGATGTGGGGTGG + Intronic
1144216274 17:13058351-13058373 CAGCAACCTGAGATGTGGACTGG - Intergenic
1144874602 17:18390846-18390868 GGACAGTCTGAGATGGGGGGTGG + Intergenic
1144955148 17:19015344-19015366 GAGCAATGTGAGAGGTGGTATGG - Intronic
1145276881 17:21436899-21436921 GAGCCATCCGAGAGGTGGGCAGG - Intergenic
1145314713 17:21722792-21722814 GAGCCATCTGAGAGGTGGGCAGG - Intergenic
1145713161 17:26994729-26994751 GAGCCATCCGAGAGGTGGGCAGG - Intergenic
1147447087 17:40480996-40481018 CAGCCATCTAAGAGGTGGGGGGG - Intronic
1147663301 17:42129203-42129225 GAGCAAACTGAGGGGTGGAGCGG - Intronic
1148819394 17:50351859-50351881 GGTCAATCTGAGATTTGGGATGG + Intronic
1151257044 17:72885966-72885988 GAGCAAGCTGAGATCTGAGATGG - Intronic
1152380067 17:79937723-79937745 GAGCACTCAGAGATCTGGGGAGG - Exonic
1153971314 18:10229630-10229652 GCGCATTCACAGATGTGGGGTGG + Intergenic
1154008625 18:10556881-10556903 GAGCAATCTGGGGTGGAGGGAGG - Intergenic
1155067147 18:22277715-22277737 GAGAAATCGGAGGTGGGGGGCGG - Intergenic
1156329761 18:36109131-36109153 GAAGAATCTGAGAATTGGGGAGG - Exonic
1156575901 18:38314800-38314822 GAGGAATGAGAGATGTGGGTGGG - Intergenic
1156792862 18:40998744-40998766 GTGCAATCTTAGATGTGAAGAGG - Intergenic
1158954420 18:62524579-62524601 GAGCATTCTGTGATGGCGGGTGG - Intronic
1160426231 18:78781088-78781110 GGGAAATCTGAGATGCCGGGTGG - Intergenic
1161369779 19:3904382-3904404 CAGCCATCTGTGATGTGGGTGGG + Intronic
1163157813 19:15449055-15449077 GAGCAATCTTGGTTGGGGGGTGG - Intronic
1163364632 19:16869171-16869193 GAGGATTCTGAGATGTGGGGCGG - Intronic
1163597647 19:18229677-18229699 GAGTAAACTGAGACGTGGAGAGG + Intronic
1163761085 19:19137231-19137253 GAGAGAGCTGAGCTGTGGGGAGG - Intronic
1164283731 19:23791575-23791597 GAGGAATATGGGATGAGGGGTGG - Intronic
1165729423 19:38135281-38135303 GAGCCATCTGGGATGTGGGTAGG - Intronic
925139343 2:1539339-1539361 GAGAAAACTGAGATGCGGAGAGG + Intronic
927062320 2:19435339-19435361 GCGAAATCTGAGATGTTGGGTGG + Intergenic
927485275 2:23484575-23484597 CAGCACTCTGGGATGTGGGATGG + Intronic
927510049 2:23638811-23638833 GAGCATTCTGAGATATGAGATGG - Intronic
930073634 2:47389494-47389516 GAGCAATATGAGGTTTGGGCTGG - Intergenic
930863992 2:56105150-56105172 GAGCAGCCTGAGATTTGAGGGGG - Intergenic
931859759 2:66342486-66342508 GAGCAATGGGAGATTTGGGCTGG - Intergenic
932245925 2:70196369-70196391 CAGCACTCTGAGAGGTGGGCAGG - Intronic
935902831 2:107810953-107810975 GAGAAATAGGAGAAGTGGGGAGG + Intergenic
936075308 2:109397913-109397935 GAACAATGGGAGATGTGGGAAGG + Intronic
936778190 2:115999309-115999331 GAACATTCTGAGGTCTGGGGTGG + Intergenic
937304591 2:120863372-120863394 GTGCAATCACAGGTGTGGGGTGG - Intronic
945056800 2:205876366-205876388 GAGCAATGTAAGATTTGGGGAGG - Intergenic
945326240 2:208485926-208485948 AAGCAATCTGACATGTTGTGAGG + Intronic
945328738 2:208514982-208515004 GGGCACTCTGAGGTGAGGGGTGG + Intronic
945504431 2:210620836-210620858 TATCAATCTGAGATTTGGGCAGG + Intronic
945922432 2:215769373-215769395 GAGCAATTTGAGAGGAGCGGGGG + Intergenic
946156292 2:217808913-217808935 GAGGAATAGGAAATGTGGGGAGG + Intronic
948609720 2:239159193-239159215 GAGTAATGTGAGGTGTGGGTGGG - Intronic
948804841 2:240449005-240449027 GAGAAGTCTGAGACCTGGGGGGG + Intronic
948988209 2:241538978-241539000 AAACACTCTGAGGTGTGGGGTGG + Intergenic
1168813463 20:721174-721196 GAGGAATCTGAGGTGTGGAGAGG + Intergenic
1169234716 20:3921634-3921656 CACCAATCTGTGATGTGAGGCGG - Intronic
1171173195 20:23033718-23033740 GAGCAACCTCAGATTTGGGAGGG - Intergenic
1171837000 20:30166379-30166401 GAGCAATTTGAGACCTAGGGTGG - Intergenic
1172366155 20:34351407-34351429 CAGCAATCTGAGAGGTGAGGTGG - Intergenic
1174737541 20:52979539-52979561 GAGAAATCTGAGATGCGAGTGGG + Intronic
1178704515 21:34862196-34862218 GAGGAAACTGAGATCTGGAGAGG - Intronic
1180202698 21:46235247-46235269 GAGCAGCCTGACCTGTGGGGAGG - Exonic
1180798127 22:18617664-18617686 GAGCCAACTGAGATGTAAGGGGG - Intergenic
1181223591 22:21377602-21377624 GAGCCAACTGAGATGTAAGGGGG + Intergenic
1181371780 22:22424753-22424775 CAGGAATCAGAGATGTGGGAGGG - Intergenic
1181390020 22:22573500-22573522 GAGCAAACTTAGATTTGGGAGGG + Intergenic
1181870000 22:25890740-25890762 CAGCAATCTGAGATGGGGAATGG - Exonic
1183233216 22:36596139-36596161 GAGCGAGCTGAGGCGTGGGGAGG + Intronic
1183309038 22:37099314-37099336 GAGCAGTCAGAGATGGGGAGGGG + Intronic
950541213 3:13614447-13614469 GAGCAAACTGATAAGTGGGTAGG - Intronic
951424024 3:22521014-22521036 GAGCAGTCTGATATGAGGGCAGG - Intergenic
952888114 3:38024302-38024324 GAGCACTCCGAGATCTGCGGGGG - Intronic
956391955 3:68783446-68783468 GACCAAACTGAGATGAGGAGAGG + Intronic
956821933 3:72961830-72961852 TAGAAAACTGAGATGTGGGTAGG + Intronic
961391791 3:126556435-126556457 GAGGAAAGTGGGATGTGGGGAGG - Intronic
961404050 3:126666505-126666527 GTGCTATCTGAGGTGTGGGAAGG - Intergenic
961811699 3:129525662-129525684 GAGCTATCTTTGATGAGGGGAGG + Intergenic
963583679 3:147157744-147157766 GAGCAAACTGAGAGGTGGTGAGG + Intergenic
965448083 3:168800903-168800925 CAGCAAGCTGAGAGGTGGGAGGG - Intergenic
966159950 3:176957402-176957424 GAGAGAGCTGAGATGTGTGGTGG - Intergenic
967293703 3:187945742-187945764 GGGCAACCAGAGGTGTGGGGTGG - Intergenic
969918343 4:10512094-10512116 GAGGAATCTGGGATCTGGGAGGG + Intronic
970155525 4:13137957-13137979 GATTAATCTGAGATGTGAGTAGG - Intergenic
970974657 4:22029611-22029633 GAGGAAACTGAGATGTGCAGAGG - Intergenic
974449379 4:62032491-62032513 GAGTAAACTGAGACATGGGGAGG - Intronic
975591931 4:76009622-76009644 GAGCAAGGTGAAATGTGGGGGGG - Intergenic
977564017 4:98563219-98563241 GAGCAAGCAGAGATGAGAGGAGG + Intronic
977741273 4:100486640-100486662 CAGCCATCTGTGAGGTGGGGAGG + Intronic
978984388 4:114992358-114992380 GAGGAATCTGGGTGGTGGGGCGG - Intronic
979087315 4:116429045-116429067 GAGAAATGTGAGATGGGGGAGGG + Intergenic
979752847 4:124300758-124300780 GAGCAATCTGAGATGGGACAGGG - Intergenic
980089122 4:128423473-128423495 GAGTTATTTCAGATGTGGGGTGG - Intergenic
981004311 4:139859729-139859751 GAGTAATCTGAGACGTAAGGAGG + Intronic
981491556 4:145345928-145345950 GAGTAATCTGAGATGTAAGGAGG + Intergenic
981717302 4:147764235-147764257 GAGTAATGTGAGATGAGGGTGGG + Intronic
982169764 4:152649556-152649578 GATCAAATTGGGATGTGGGGTGG + Intronic
983293745 4:165839430-165839452 GAGCAACCAAAAATGTGGGGTGG - Intergenic
983359326 4:166708761-166708783 GAGCAAAGTGAGATGGGGTGGGG + Intergenic
986334177 5:6740923-6740945 GAGGAAACTGAGATGCGGAGAGG + Intronic
986509726 5:8491533-8491555 GAGGAATCTGTGGTATGGGGAGG + Intergenic
987336883 5:16904990-16905012 CAGCAATCTGAGCTCTGAGGAGG - Intronic
990441378 5:55848940-55848962 GAGCAATGTGATTTGTTGGGTGG - Intergenic
992634981 5:78718583-78718605 GAGAAAACTGAGGTGTGGGCAGG - Intronic
992684539 5:79186769-79186791 GAGGAAACTGAGAGGTGGTGAGG - Intronic
993503405 5:88685519-88685541 AAGCAAGCTGAGATGAGGTGAGG - Intergenic
993660075 5:90622539-90622561 GAGCAATCAGAGGTATGAGGCGG - Intronic
994185415 5:96809746-96809768 GAGCACTCCGAGATGTCTGGAGG - Intergenic
995027922 5:107446084-107446106 GAGGAACCTGAGATGTGGAGAGG - Intronic
997222421 5:132180601-132180623 GACCAAGCTGGGGTGTGGGGAGG + Intergenic
997410598 5:133687914-133687936 GAGCCATCTGGGACCTGGGGAGG - Intergenic
997518394 5:134506579-134506601 CAGCAGGCTGAGAGGTGGGGGGG - Intergenic
998459169 5:142296670-142296692 GGGGAAACTGAGACGTGGGGAGG + Intergenic
999113723 5:149143018-149143040 GAGCAGTCTGAGATGCAGAGAGG - Intronic
999245715 5:150153517-150153539 GAGGAAGCTGAGATCTGGAGAGG - Intronic
999537189 5:152529936-152529958 CAGCACTTTGAGATGTGAGGGGG + Intergenic
999767895 5:154755157-154755179 GAGGAATCGGAGACGAGGGGCGG + Intronic
999801867 5:155046010-155046032 CAGAAATCTGAGATGTGCTGAGG - Intergenic
1000051265 5:157564818-157564840 GAAGAAACTGAGATGTGGGGAGG - Intronic
1000994510 5:167945386-167945408 GAGGAGACTGAGGTGTGGGGAGG - Intronic
1001150061 5:169219565-169219587 GAGCTATCTGAGCTGTGCAGAGG + Intronic
1001857789 5:175027752-175027774 GAGGAGGCTGAGATGTGGGCAGG + Intergenic
1003968094 6:11272631-11272653 GAGCAATCTGAGGTTAGGTGGGG - Intronic
1005398022 6:25404097-25404119 GAGTAATCTTAGAAGTGGAGGGG - Intronic
1005608916 6:27504420-27504442 GAGCTACCTGAAATGGGGGGGGG + Intergenic
1006717262 6:36128661-36128683 GATCATTCTGAGATGAGGGTGGG - Intronic
1006929416 6:37678686-37678708 GAGCAATCCAAGCAGTGGGGAGG - Intronic
1009899828 6:69797142-69797164 CTGCAAGCTGAGATGTGGGAGGG + Intergenic
1012707426 6:102549673-102549695 GAGAAATATGAGATGGGGAGTGG - Intergenic
1012963711 6:105649791-105649813 GAGGAAACTGATATTTGGGGAGG - Intergenic
1013999947 6:116353624-116353646 CAGAAAACTGAGATTTGGGGAGG + Intronic
1014245666 6:119065716-119065738 GAGAAATCTCAGATCTGAGGAGG - Intronic
1015822604 6:137280242-137280264 GAGTGATCTGAGATGGGGGTAGG - Intergenic
1017916521 6:158835944-158835966 GAGCAATCAGAGCTGTGGTTTGG + Intergenic
1018712607 6:166507390-166507412 GTGCTATGTGTGATGTGGGGTGG - Intronic
1019428732 7:988894-988916 GAGCAGTCCGAGCTGTGGGGTGG - Exonic
1021103490 7:16610297-16610319 GAGGAATCTGAGGTTTGGAGAGG - Intronic
1021607339 7:22421427-22421449 GAGGAAACTGAGGCGTGGGGAGG + Intronic
1023344174 7:39254104-39254126 GAGCTGTCTGAGCTCTGGGGAGG - Intronic
1023597689 7:41849358-41849380 GTTCAATCTGAGATTTGGGTAGG + Intergenic
1024000958 7:45189186-45189208 GAGCAATGGGAGATATGGGAAGG + Intergenic
1024298082 7:47862358-47862380 GAGCAGCCTGAGATGAGGAGGGG + Intronic
1024854120 7:53757015-53757037 GAGGAAAATGAGAGGTGGGGTGG + Intergenic
1024907369 7:54401555-54401577 GAGAAAACTGAGAAGTGGAGAGG + Intergenic
1025501306 7:61302993-61303015 GAGCAATTTGAGGTGTATGGTGG - Intergenic
1025516166 7:61649216-61649238 GAGCAATTTGAGGTGTATGGTGG - Intergenic
1025540503 7:62078042-62078064 GAGCAATTTGAGGTGTATGGTGG - Intergenic
1026199582 7:68202803-68202825 GAGGAAACTGAGGTGTAGGGAGG + Intergenic
1026867952 7:73834897-73834919 GAGCAGGCTGGGATGTGGGAAGG - Exonic
1028731452 7:94155111-94155133 GAGCAATTTAAAATGTGAGGGGG - Intergenic
1029026562 7:97423032-97423054 GAGGAAACTGAGATCTGGAGAGG + Intergenic
1031436174 7:121734705-121734727 GAGGAAACTTAGATGGGGGGTGG - Intergenic
1032023296 7:128421855-128421877 GAGCCACCTGTGAAGTGGGGAGG + Intergenic
1033286640 7:140047105-140047127 GAACATTCTGAAATGTGTGGTGG + Intronic
1034182342 7:149148148-149148170 CAGCAATCTGAGCGGTGGCGCGG + Intronic
1034437508 7:151070212-151070234 GAGCCAGCTGAGATGTTGCGGGG - Exonic
1034825668 7:154260125-154260147 GAAAAATCTGACATGTGGAGAGG + Intronic
1035029195 7:155846356-155846378 GAGCATTCTGGGAGGAGGGGTGG + Intergenic
1036521264 8:9493854-9493876 GAGCAATTAGAGTTTTGGGGTGG - Intergenic
1037254293 8:16934903-16934925 GTTCAAGATGAGATGTGGGGTGG - Intergenic
1038422019 8:27439533-27439555 GAGAAGTCTCAGAGGTGGGGAGG + Intronic
1045507535 8:102789177-102789199 GAGCCAGCTGAGGTGTGGGGTGG + Intergenic
1047464915 8:125103430-125103452 GAGCAATTTGTGATGTGCCGTGG + Intronic
1048573252 8:135672023-135672045 GAGCCAGCTGATATGTGGAGGGG + Intergenic
1048651949 8:136487731-136487753 AAGCCCTCTGAGATGTGGGCTGG + Intergenic
1048984771 8:139729567-139729589 GAGCACACTGTGATGTGGTGTGG - Intergenic
1048985652 8:139733431-139733453 TAGCAGGCTAAGATGTGGGGTGG + Intronic
1049246221 8:141563991-141564013 TAGCCAGCTGAGGTGTGGGGTGG + Intergenic
1051020874 9:12541177-12541199 CAGCAATCTGAGTTCTGTGGAGG + Intergenic
1052274874 9:26664538-26664560 GCCCCATCTGAGAGGTGGGGGGG + Intergenic
1052841833 9:33298309-33298331 GAGCAAATTTAGATGTGGGGAGG + Intronic
1053259237 9:36647347-36647369 GGGCTATCATAGATGTGGGGTGG + Intronic
1056380580 9:86053707-86053729 GAGCAGTCTGTGATGCGGTGGGG - Intronic
1057797494 9:98169339-98169361 GGGCAGTGTCAGATGTGGGGAGG - Intronic
1057898034 9:98925245-98925267 CAGCACTCTGAGATGAGGGAAGG - Intergenic
1058393545 9:104524275-104524297 GAGCAAGATGAGATTTGGGTGGG + Intergenic
1059913969 9:119077937-119077959 GAGGAAACTGAGATGCAGGGTGG + Intergenic
1060373958 9:123102073-123102095 AAGGAACCTGAGATGTAGGGAGG - Intronic
1060437663 9:123608470-123608492 GAGCAAAATGAGGCGTGGGGAGG - Intronic
1061663282 9:132145135-132145157 GAGGAAACTGAGATGAGAGGAGG + Intergenic
1061984943 9:134125223-134125245 GAGGAAACTGAGGTGTAGGGAGG + Intergenic
1203732661 Un_GL000216v2:104782-104804 GAGCAATGTGGGGTGGGGGGAGG + Intergenic
1185831419 X:3306475-3306497 GTGGAAACTGAGATCTGGGGAGG - Intergenic
1186586870 X:10884668-10884690 GAGGATACTGAGATGTGGAGAGG - Intergenic
1187783348 X:22854891-22854913 GCTCAATATGAGATGTGGCGAGG + Intergenic
1188657713 X:32718136-32718158 GAACAATATGAGATTTGGGAGGG + Intronic
1189300216 X:39947123-39947145 GAGCAGTCCCAGATATGGGGTGG - Intergenic
1190569631 X:51768285-51768307 GGGCAATCTGAGAGGGTGGGTGG + Intergenic
1190690313 X:52908126-52908148 GAGCCATGTGAGATGCGGTGAGG - Exonic
1190695670 X:52947666-52947688 GAGCCATGTGAGATGCGGTGAGG + Exonic
1195863230 X:109403231-109403253 GAGAAATCTGAGATGGGGGTGGG - Intronic
1196189139 X:112776974-112776996 GAGGAATCTGAGAACTGGAGAGG - Exonic
1197664824 X:129212296-129212318 GAGGAAACTGAGATGTGGAGAGG + Intergenic
1199740542 X:150732100-150732122 GAGGAAAATGAGAGGTGGGGTGG + Intronic
1201245165 Y:11996354-11996376 GTGGAAACTGAGATCTGGGGAGG + Intergenic