ID: 1143767890

View in Genome Browser
Species Human (GRCh38)
Location 17:9149619-9149641
Sequence GAGGGTAAACTAGGAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143767886_1143767890 6 Left 1143767886 17:9149590-9149612 CCTTGTTCTTCTCATCTCTTCTT 0: 1
1: 0
2: 7
3: 103
4: 1114
Right 1143767890 17:9149619-9149641 GAGGGTAAACTAGGAAACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143767890 Original CRISPR GAGGGTAAACTAGGAAACCC TGG Intronic
906754253 1:48293502-48293524 GATGGTAGAGTAGGAGACCCTGG - Intergenic
909216906 1:72901531-72901553 GAAAGTCAACTAGGATACCCAGG + Intergenic
909886484 1:80947985-80948007 GAGAGTCAACAAGGATACCCAGG + Intergenic
911867631 1:103049142-103049164 GAAGGTTAACAAGGATACCCAGG - Intronic
913355926 1:117922347-117922369 GAAGGTAAACCAGGAAAGCATGG + Intronic
913424124 1:118707677-118707699 GAGAGTCAACAAGGATACCCAGG + Intergenic
913455182 1:119023080-119023102 GAGAGTCAACAAGGATACCCAGG + Intergenic
913934195 1:125017644-125017666 GAAAGTCAACAAGGAAACCCAGG + Intergenic
914388304 1:147194050-147194072 GAAGGTTAACAAGGATACCCAGG - Intronic
915878835 1:159643530-159643552 GAAGGTAAACTAGAAACCCAAGG + Intergenic
919254881 1:195108243-195108265 GAAAGTTAACAAGGAAACCCAGG + Intergenic
920915276 1:210253503-210253525 GAGGGAAAAGTTGGAAACCCTGG + Intergenic
921288239 1:213629126-213629148 GAAGGTTAACAAGGATACCCAGG - Intergenic
922143324 1:222912412-222912434 GAGGGAAAAGTAGGAAACTGAGG - Intronic
1064286022 10:13991844-13991866 GAGGGTAAACTAGAAAATTAAGG + Intronic
1064468261 10:15607679-15607701 GAAGGTAAACGATGAAATCCTGG + Exonic
1065107625 10:22406681-22406703 GAAAGTAAACAAGGAAACCCAGG - Intronic
1065974897 10:30833637-30833659 GAGGGTAAACAAGGAACCAAAGG + Intronic
1066034950 10:31471659-31471681 GAAGGTCAACAAGGATACCCAGG + Intronic
1069537643 10:69266745-69266767 GAAGGAGAACTAGGAACCCCTGG + Exonic
1069880071 10:71586821-71586843 GAGGATAAAATAGGAGTCCCAGG - Intronic
1079455047 11:20629159-20629181 GAAGGTAGACTGGGAAACCCTGG + Intronic
1079463286 11:20704047-20704069 GAGAGTTAACAAGGATACCCGGG - Intronic
1080275360 11:30497589-30497611 GAGGATAAATTGAGAAACCCAGG - Intronic
1082064651 11:47890115-47890137 GAGGGGAAAAGAGTAAACCCAGG - Intergenic
1082876855 11:57997707-57997729 GAAGGTCAACAAGGATACCCAGG - Intergenic
1083635272 11:64117481-64117503 GAGGGTAAACAGGGAACCCTGGG - Exonic
1087090456 11:94265990-94266012 GAAAGTAAACAAGGAAACCATGG + Intergenic
1087719091 11:101641484-101641506 GAAGGTAAACAAGGATATCCAGG + Intronic
1088204375 11:107375219-107375241 GAAGGTCAACAAGGATACCCAGG + Intronic
1089556522 11:119318351-119318373 GAGGGTGAGCCAGCAAACCCTGG + Intronic
1089884782 11:121809624-121809646 GTGGGTAAAATAGGAAAGGCTGG + Intergenic
1090557311 11:127890420-127890442 CAGGGGAAACCAGGAAACCAAGG + Intergenic
1093855557 12:24098000-24098022 GTTGGTAAAGTAGGAAACCGTGG - Intergenic
1094082312 12:26551289-26551311 GAGGGTAAATTGGGAGTCCCTGG - Intronic
1095151606 12:38802106-38802128 GAAGGTCAACAAGGATACCCAGG + Intronic
1097216825 12:57420649-57420671 GATGGAAAACTAGTAAAGCCTGG - Intronic
1099912424 12:88849452-88849474 GAAAGTCAACAAGGAAACCCAGG + Intergenic
1100737425 12:97552431-97552453 CAAGGTAAACTAGGAATCCTAGG - Intergenic
1100960774 12:99960591-99960613 GAGGGGAAATAAGAAAACCCTGG + Intronic
1105311296 13:19214269-19214291 GAAGGTTAACAAGGATACCCAGG - Intergenic
1109320394 13:60803418-60803440 GAGAGTTAACAAGGATACCCAGG - Intergenic
1111031701 13:82608457-82608479 GAGGGTACTGTAGGAAACCAGGG - Intergenic
1111676124 13:91391003-91391025 GAGGGGAAACTATTTAACCCAGG + Intergenic
1111917358 13:94374659-94374681 GAAAGTCAACAAGGAAACCCAGG + Intronic
1117740655 14:58816115-58816137 GACTGTAATCTAGGAAAGCCAGG - Intergenic
1117887881 14:60384242-60384264 GAAGGTAAACAAGGATATCCAGG + Intergenic
1118064460 14:62175746-62175768 GAGGGCAAACTCAGAAAACCAGG - Intergenic
1118313233 14:64708093-64708115 GAGGGGAAAATAGAAAACCTTGG + Intronic
1120199154 14:81517897-81517919 GAGGGTACACATGGTAACCCTGG - Intronic
1121514438 14:94540049-94540071 GAGAGTAAATCAGGAAACACAGG + Intergenic
1122451579 14:101812783-101812805 GATGGTAAACTGGGAAAGCTGGG - Intronic
1125009448 15:34855074-34855096 GACGCGATACTAGGAAACCCAGG - Exonic
1127179686 15:56401587-56401609 GAAGGTTAACAAGGATACCCAGG + Intronic
1128323457 15:66707808-66707830 GGGGGGAAACTTGGCAACCCGGG + Intronic
1134644338 16:15854375-15854397 GAGGGTAATCTGTGAAACTCTGG + Intronic
1137859404 16:51831105-51831127 AAGGCTAAACTGGAAAACCCAGG - Intergenic
1141104804 16:81224654-81224676 GGGGGGAATCTAGGAAGCCCTGG + Intergenic
1141108043 16:81249730-81249752 GCTGGGAAAATAGGAAACCCAGG + Intronic
1141226177 16:82118126-82118148 AAGAGTAAACTAGGCAACACTGG + Intergenic
1141513969 16:84530752-84530774 GAGGCTCAATGAGGAAACCCAGG - Intronic
1143767890 17:9149619-9149641 GAGGGTAAACTAGGAAACCCTGG + Intronic
1145715001 17:27010742-27010764 GAAAGTCAACAAGGAAACCCAGG + Intergenic
1147702983 17:42407498-42407520 CAGTGTAAACCAGGAAACTCTGG - Intronic
1149584422 17:57775971-57775993 GAGGGAAAACTTGGAAATGCTGG + Intergenic
1154163531 18:11997309-11997331 GAGCAGGAACTAGGAAACCCTGG + Intronic
1156908116 18:42379313-42379335 GAAGGTTAACAAGGATACCCAGG - Intergenic
1159426527 18:68295653-68295675 GATGGAAAAATAGGAAATCCTGG - Intergenic
1159969720 18:74634710-74634732 GAGGGTGAAGGAGGAAACGCAGG + Exonic
1164315229 19:24081572-24081594 AAGAGTAAACCAGGTAACCCAGG + Intronic
925793023 2:7512237-7512259 GAGGGGAAAATTGGAAACTCAGG - Intergenic
926251105 2:11155819-11155841 GAGGGTGAACTAGGGAGCCTAGG + Intronic
927208785 2:20626268-20626290 GAGGAGAAACTATGAAAGCCAGG + Intronic
928032305 2:27791530-27791552 GATGGAGAACTAGGAAAGCCAGG - Intronic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
929543637 2:42841543-42841565 GAGGGTAGATTGGGAAACACGGG - Intergenic
933786435 2:85846376-85846398 AATGGTAAAAAAGGAAACCCTGG - Exonic
935959839 2:108413989-108414011 CAGGGCAAACAAGGAAACCAGGG + Intergenic
938103350 2:128513062-128513084 GATTGGAAACTTGGAAACCCAGG - Intergenic
939464996 2:142545533-142545555 GATGGTAAAGTGGGAAGCCCTGG + Intergenic
939776023 2:146389185-146389207 GAGTGTAAACTAAGAACACCAGG + Intergenic
941337475 2:164263576-164263598 GAGAGTCAACAAGGATACCCAGG + Intergenic
942056692 2:172190811-172190833 GAAGGTTAACAAGGATACCCAGG - Intergenic
944628094 2:201593525-201593547 GAAGGTCAACAAGGATACCCAGG - Intronic
945116528 2:206413601-206413623 GAAGGTTAACAAGGATACCCAGG - Intergenic
947301661 2:228694811-228694833 GAAGGTTAACAAGGATACCCAGG - Intergenic
1170090523 20:12584969-12584991 GAAAGTAAACAAGGATACCCAGG + Intergenic
1171050730 20:21856021-21856043 GAAGGTTAACAAGGATACCCAGG + Intergenic
1171218766 20:23374298-23374320 GAGGGTTTAGAAGGAAACCCTGG - Intergenic
1173771548 20:45663967-45663989 GAGGGTTAACAAGGATATCCAGG - Intronic
1173997855 20:47353155-47353177 GACAGTAACCTAGAAAACCCTGG - Intronic
1175677374 20:60958412-60958434 GAGAGTAAATTAGGAAAACGTGG - Intergenic
949450266 3:4177137-4177159 GAAGGTTAACAAGGATACCCAGG + Intronic
949678738 3:6488454-6488476 GAAAGTCAACAAGGAAACCCAGG - Intergenic
949854815 3:8451585-8451607 GAGGGGAGAACAGGAAACCCAGG - Intergenic
950427097 3:12930388-12930410 GAGGGTAGGCTGGGAAACCTGGG - Intronic
950944344 3:16929160-16929182 GAGAGACAACTAGGAAACCAAGG + Intronic
955426410 3:58795858-58795880 AAGGGAAAACTAGGAAACTCAGG + Intronic
958204594 3:90373410-90373432 GAGAGTTAACAAGGATACCCAGG + Intergenic
958651293 3:96940147-96940169 GAAAGTAAACAAGGATACCCAGG - Intronic
960508333 3:118519345-118519367 GAGGGTTAACAAGGATATCCAGG + Intergenic
961752615 3:129106052-129106074 GAACGTGAACTAGGAATCCCTGG - Intronic
961849603 3:129802384-129802406 GATGGTGAACTAGGAAACATAGG + Intronic
962178141 3:133176270-133176292 GAAGGTTAACAAGGATACCCAGG + Intronic
967324888 3:188229186-188229208 GGTGGTAAATTAAGAAACCCGGG + Intronic
969370926 4:6731221-6731243 CTGGGTAGACTAGGAGACCCTGG - Intergenic
969710285 4:8839331-8839353 GAGGGGAAATTAGGAACCGCAGG - Intergenic
970285480 4:14508436-14508458 GAACGAAAACTAGGAAAGCCTGG + Intergenic
973311434 4:48713719-48713741 GAAAGTTAACAAGGAAACCCAGG + Intronic
974740172 4:65996840-65996862 GAGAGTCAACAAGGATACCCAGG - Intergenic
975233091 4:71957585-71957607 GAGGGTAAACCATGAAAACCAGG + Intergenic
976050543 4:81007587-81007609 GAGGATAAACAAGGCAACTCTGG - Intergenic
976529678 4:86137133-86137155 GAAGGTCAACAAGGATACCCAGG + Intronic
977653416 4:99494712-99494734 GAAAGTTAACTAGGATACCCAGG + Intergenic
978459728 4:108937824-108937846 AAGGGTGAACCAGGAAAGCCAGG - Exonic
978464791 4:108996570-108996592 GAAGGTTAACAAGGATACCCAGG + Intronic
978641270 4:110874344-110874366 GAAGGTCAACAAGGATACCCAGG - Intergenic
981984482 4:150837338-150837360 GAAGGTTAACAAGGATACCCAGG - Intronic
982622120 4:157721690-157721712 GAGGATAAACGAGGTAACCTAGG - Intergenic
983407294 4:167347059-167347081 GAAGGTCAACAAGGATACCCAGG - Intergenic
990230066 5:53703726-53703748 GAGGGTTAACAAGGATATCCAGG - Intergenic
990870228 5:60423142-60423164 GAAGGTTAACAAGGAAATCCAGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
992983589 5:82203297-82203319 GAGGGTAAACAACCAAACACTGG - Intronic
993531916 5:89035680-89035702 GATGATAAACTATGAGACCCAGG - Intergenic
995316005 5:110775158-110775180 GAGAGTCAACAAGGATACCCAGG + Intergenic
997112434 5:131089732-131089754 GAGAGTCAACAAGGATACCCAGG + Intergenic
999743471 5:154574396-154574418 GAGGGGAAATCAGGAAACACAGG - Intergenic
1000571822 5:162924216-162924238 GATGGTGAAATAGGAAGCCCTGG - Intergenic
1001358921 5:171061706-171061728 GAAAGTTAACAAGGAAACCCAGG - Intronic
1001700153 5:173701026-173701048 GATGGTAAATCAGGAAACCTGGG - Intergenic
1001742392 5:174064841-174064863 GAGGGTGAAAGAGGAATCCCAGG + Intronic
1002698780 5:181108176-181108198 GAGGCTATACTACGAAAGCCAGG - Intergenic
1003764113 6:9216051-9216073 GAAGGTTAACAAGGATACCCAGG + Intergenic
1007627296 6:43253770-43253792 GAGGAGAAACCAGGAGACCCAGG - Intronic
1008734829 6:54530072-54530094 GAAGGTTAACAAGGATACCCAGG + Intergenic
1008836390 6:55836685-55836707 GAGGGTAAACAAGATAACCTGGG - Intronic
1009937829 6:70254510-70254532 CAGGGTGAACCAGGAAAACCTGG - Exonic
1013538597 6:111086293-111086315 GAGGGTAAAATAGTAAACAAAGG - Intergenic
1013635204 6:112022594-112022616 GAGGGTAAACTAAGAGGCCCTGG - Intergenic
1013895521 6:115083169-115083191 GAAGGTCAACAAGGATACCCAGG + Intergenic
1014071294 6:117184279-117184301 GAAAGTCAACAAGGAAACCCAGG + Intergenic
1014907358 6:127045844-127045866 GAAGGTTAACAAGGATACCCAGG + Intergenic
1016188976 6:141236406-141236428 AATGTTAAACTAGAAAACCCAGG - Intergenic
1018658295 6:166061660-166061682 GAGCGTGAACCAGTAAACCCTGG - Intergenic
1019515834 7:1439876-1439898 GAGGGCCAGCTAGGCAACCCGGG + Intronic
1024511600 7:50208516-50208538 GAGGGCAAATTAGGACAGCCTGG - Intergenic
1024916135 7:54502277-54502299 GAAGGTTAACAAGGATACCCAGG - Intergenic
1026403118 7:70036507-70036529 GGTGGGAAACTAGGAAACCAAGG - Intronic
1028928125 7:96382698-96382720 GATGGTGAACTAGGAGACTCGGG - Intergenic
1030157359 7:106468581-106468603 AAGGATAAACAAGGAAACCTGGG - Intergenic
1030166180 7:106557990-106558012 GAAGGTTAACAAGGAAATCCAGG - Intergenic
1030514269 7:110520435-110520457 GAGGGGAACCAAGGAAAGCCTGG - Intergenic
1032625590 7:133588324-133588346 AAGGGTGAAATGGGAAACCCTGG - Intronic
1038183286 8:25248807-25248829 GAAGGTAAAATAGGAGACCAAGG + Intronic
1041757283 8:61328398-61328420 GAGGGTCAACTTGGACACACAGG + Intronic
1042457447 8:69021577-69021599 GAAAGTAAACAAGGATACCCAGG + Intergenic
1042886206 8:73554703-73554725 GATGGTAGAATAGGAAGCCCTGG - Intronic
1044746145 8:95373250-95373272 GAAGGTTAACAAGGATACCCAGG - Intergenic
1046114999 8:109774475-109774497 GAAAGTTAACTAGGATACCCAGG - Intergenic
1046251100 8:111632700-111632722 GAAAGTTAACTAGGATACCCAGG + Intergenic
1047116227 8:121844342-121844364 GAAGGGAAACTAGAATACCCTGG - Intergenic
1047632500 8:126723623-126723645 GATGGAAAACTAGGAAACAGAGG + Intergenic
1047889312 8:129290434-129290456 GTGGTGAAACTAAGAAACCCTGG - Intergenic
1047998990 8:130361246-130361268 GAGGGAAAACTCTGGAACCCAGG - Intronic
1051317948 9:15863411-15863433 GATGGTGGAATAGGAAACCCTGG - Intronic
1054826313 9:69577358-69577380 GAGGGAAAACTAGGAAGCTCTGG + Intronic
1058202751 9:102064721-102064743 GAAGGTTAACAAGGATACCCAGG - Intergenic
1060375093 9:123110253-123110275 GCGGGTAAACCAGGACACACAGG + Intronic
1060768669 9:126314448-126314470 AAGGGTAAGCTAGGAGACCTAGG + Intergenic
1061670687 9:132186580-132186602 GAGGGTCAACTGGGAAGCCAAGG - Intronic
1187594611 X:20757010-20757032 GAAGGTTAACAAGGATACCCAGG + Intergenic
1189877590 X:45452921-45452943 GAGGGTAATCTGGGAATCCCAGG - Intergenic
1191122253 X:56918679-56918701 GAGGGTTAACAAGGATATCCAGG - Intergenic
1193343525 X:80380502-80380524 GAAGGTTAACAAGGATACCCAGG - Intronic
1194028609 X:88784958-88784980 GAGAGTTAACAAGGATACCCAGG - Intergenic
1195947646 X:110232114-110232136 GAAGGTTAACAAGGATACCCAGG + Intronic
1196188623 X:112771729-112771751 GAGGGTAAACAAGGAAAAGCTGG + Intergenic
1196770715 X:119290718-119290740 GAATGTAAACTAGCAGACCCTGG - Intergenic
1197931776 X:131703795-131703817 GCAGGCAAACTAGGAAACACAGG - Intergenic
1199578379 X:149336461-149336483 GAAAGTAAACAAGGATACCCAGG + Intergenic
1201450350 Y:14104726-14104748 GAAGGTTAACAAGGATACCCAGG + Intergenic
1201703927 Y:16914643-16914665 GAAAGTAAACAAGGATACCCAGG + Intergenic
1201710623 Y:16987507-16987529 GAAAGTAAACAAGGATACCCAGG + Intergenic
1202249727 Y:22857397-22857419 GAAGGTTAACAAGGATACCCAGG + Intergenic
1202327532 Y:23707062-23707084 GAAGGTTAACAAGGATACCCAGG + Intergenic
1202402714 Y:24491145-24491167 GAAGGTTAACAAGGATACCCAGG + Intergenic
1202468068 Y:25178938-25178960 GAAGGTTAACAAGGATACCCAGG - Intergenic
1202543238 Y:25962990-25963012 GAAGGTTAACAAGGATACCCAGG - Intergenic