ID: 1143769077

View in Genome Browser
Species Human (GRCh38)
Location 17:9156434-9156456
Sequence CTGGGCCATGTGAAGTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143769070_1143769077 -9 Left 1143769070 17:9156420-9156442 CCAGTGAGAAGCCCCTGGGCCAT 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217
1143769067_1143769077 -3 Left 1143769067 17:9156414-9156436 CCTGCTCCAGTGAGAAGCCCCTG 0: 1
1: 0
2: 1
3: 29
4: 287
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217
1143769066_1143769077 1 Left 1143769066 17:9156410-9156432 CCTTCCTGCTCCAGTGAGAAGCC 0: 1
1: 0
2: 1
3: 35
4: 254
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217
1143769064_1143769077 15 Left 1143769064 17:9156396-9156418 CCATCACCAAATGGCCTTCCTGC 0: 1
1: 0
2: 0
3: 20
4: 258
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217
1143769063_1143769077 16 Left 1143769063 17:9156395-9156417 CCCATCACCAAATGGCCTTCCTG 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217
1143769065_1143769077 9 Left 1143769065 17:9156402-9156424 CCAAATGGCCTTCCTGCTCCAGT 0: 1
1: 0
2: 1
3: 19
4: 255
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217
1143769061_1143769077 28 Left 1143769061 17:9156383-9156405 CCTCTGAGGAGACCCATCACCAA 0: 1
1: 0
2: 1
3: 12
4: 131
Right 1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG 0: 1
1: 0
2: 1
3: 27
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143769077 Original CRISPR CTGGGCCATGTGAAGTCTGG GGG Intronic
900151620 1:1181434-1181456 CTGGGCCAAATGAAGTGAGGAGG - Intronic
901961273 1:12828417-12828439 CTGGGTCATGTGAAGTGAGGAGG - Intronic
901983264 1:13053287-13053309 CTGGGTCATGTGAAGTGAGGAGG - Intronic
901985746 1:13074044-13074066 CTGGGTCATGAGAAGTGAGGAGG + Intronic
901996063 1:13152723-13152745 CTGGGTCATGAGAAGTGAGGAGG - Intergenic
901998825 1:13175631-13175653 CTGGGTCATGTGAAGTGAGGAGG + Intergenic
902017310 1:13318758-13318780 CTGGGTCATGTGAAGTGAGGAGG + Intronic
902644462 1:17788748-17788770 CTGGGCCTTCTGCAGCCTGGTGG - Intronic
902926872 1:19701702-19701724 CTGGGACCTGTGCAGACTGGTGG + Intronic
903058246 1:20651762-20651784 CGGGGCCAGGTGAAGTTTGAGGG + Exonic
903846234 1:26281170-26281192 CATGGCCAGGTGAAGGCTGGGGG - Exonic
904594934 1:31637949-31637971 CTGGGCCAGGTGAACTGTGCGGG + Intronic
904865510 1:33575596-33575618 ATGGGTCAACTGAAGTCTGGTGG + Intronic
905771217 1:40639176-40639198 CTGGGCTGTGTGAAGTGGGGAGG - Intronic
906155433 1:43611472-43611494 CTGAGCCAAGAGAAGACTGGAGG + Intronic
906286162 1:44589161-44589183 CTGGGGAAAGTGAAGTTTGGTGG - Intronic
907468090 1:54652913-54652935 CAGGGCCATGTCCAGTCTGGAGG - Exonic
907937420 1:59055224-59055246 GTCAGCCATGTGAAGACTGGAGG + Intergenic
908714460 1:67054449-67054471 CTGGGGCGTGGGGAGTCTGGTGG + Intergenic
910435379 1:87200743-87200765 CTGGGCCAACTGTAGTCAGGAGG + Intergenic
912881817 1:113423559-113423581 CTGGGCCCTGCTGAGTCTGGGGG + Intronic
913092880 1:115491836-115491858 CTGGGCCATGCCAAGGCTGCAGG - Intergenic
913370758 1:118096407-118096429 CTGGGCAAAGTGGAGTGTGGAGG - Intronic
914987689 1:152474397-152474419 CTGGGAGATGAGAAGTCTGAAGG + Intergenic
915279538 1:154813324-154813346 CTAGGCCATGTGAAGTGAGGGGG - Intronic
915986385 1:160469552-160469574 CTGAGCCATCTGAAGGCTGAAGG - Intergenic
920138070 1:203786813-203786835 CTGGACCATTTGAGGTCAGGAGG - Intergenic
920961648 1:210669151-210669173 CAGGGCCATGTGAAGTCAAAGGG - Intronic
922763899 1:228147948-228147970 CTGGGCGATGGGGGGTCTGGGGG - Intronic
922974008 1:229768752-229768774 CTGGGCCAAGGGAAGGCAGGTGG + Intergenic
923045547 1:230353195-230353217 CTGACCCATGTGTAGCCTGGAGG - Intronic
1062976189 10:1685070-1685092 CAGGACCATGTCGAGTCTGGAGG + Intronic
1063032087 10:2245537-2245559 CTGTGCAATGTGAAGTCTACAGG - Intergenic
1064116128 10:12578946-12578968 CTGGGGAATGTGCAGTCTAGTGG + Intronic
1065626248 10:27631857-27631879 AGGGGCCATGTGACTTCTGGGGG + Intergenic
1065811276 10:29445938-29445960 CTGGGCCATGCAAAATCAGGCGG - Intergenic
1065975892 10:30842122-30842144 GTGGGCCATGTGATAACTGGTGG - Intronic
1067156075 10:43782342-43782364 CAGGGCAAAGTGAAGGCTGGTGG - Intergenic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1070339685 10:75486373-75486395 CTGGGCCATGTTAAGTCAAGCGG - Intronic
1070684646 10:78471686-78471708 CTGTGGCATGTGAATTGTGGGGG + Intergenic
1071561734 10:86650892-86650914 CTGGGCCCTTGGCAGTCTGGGGG + Intergenic
1072786837 10:98289418-98289440 CTGGGCCACATGAAGCCTGTGGG - Intergenic
1075087443 10:119422992-119423014 CTGAGCCAGGTGCAGCCTGGAGG + Intronic
1076887920 10:133271057-133271079 CTGGGCCAGGTGAAGCCGGCTGG - Exonic
1077279271 11:1734750-1734772 CAGGGCCTGGAGAAGTCTGGAGG - Exonic
1077661718 11:4074495-4074517 CTGGGCCTTGTGCAGCCTGGGGG - Exonic
1079194428 11:18313248-18313270 CTGAGCTATGTGAAGTATGCAGG + Intronic
1081848749 11:46260363-46260385 CTGGGCCAGCTGACGTCAGGAGG - Intergenic
1082646752 11:55735578-55735600 TTGGGCCTTGTGAACCCTGGAGG - Intergenic
1083316118 11:61815973-61815995 CTGCGTCGTGTGAAGACTGGAGG - Intronic
1083486403 11:62985222-62985244 CTGGGCTCTGGGAAGTGTGGTGG + Intergenic
1088125872 11:106422787-106422809 CTGAGCCAAGTGGAGTCTGCAGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089629903 11:119778055-119778077 CTGGGCTAAGTGAGGGCTGGAGG - Intergenic
1093163110 12:15772292-15772314 TTGGGAAATGTGAAGTCTGAGGG + Intronic
1094194184 12:27728939-27728961 CAGGGGCACGTAAAGTCTGGTGG + Intronic
1096627825 12:52906167-52906189 CTGGGCCAGGTGAACACTGTAGG + Intronic
1098219070 12:68249289-68249311 CTGGGCCATGTGCGGCCTGTGGG - Intronic
1101875387 12:108593715-108593737 CTGGGCCAGGTGGGGTCTTGGGG - Intronic
1103460001 12:121096161-121096183 CTGGGCAATGAGGAGACTGGAGG - Intergenic
1103566826 12:121820254-121820276 CTGGGCCAGGTGAGGGCTGCAGG + Intronic
1103612324 12:122131395-122131417 CTGGGCCATGTGGGGTTTAGGGG + Intronic
1105228123 13:18457268-18457290 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105228135 13:18457402-18457424 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105228147 13:18457536-18457558 CTGGGCCACATGAAGCCTGTAGG + Intergenic
1105228159 13:18457670-18457692 CTGGGCCACATGAAGCCTGTAGG + Intergenic
1105228171 13:18457804-18457826 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1105228183 13:18457938-18457960 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1106719781 13:32426489-32426511 CAGGGACATGTGACTTCTGGAGG - Intronic
1107302159 13:38977154-38977176 CTGGGTCCTGTGAATTCTCGAGG + Intronic
1108391360 13:49951062-49951084 CTGGGCCACATGCAGTCTGTGGG - Intergenic
1113932971 13:113978128-113978150 CTCGGCAGTGTGAGGTCTGGAGG + Exonic
1114252417 14:20972532-20972554 GTGGGACATGTTAAGTCTGAAGG + Intergenic
1115486496 14:33915818-33915840 CTGGATCATGTGAACTCTGGAGG + Intergenic
1117093534 14:52273538-52273560 CTCGCCCATCTGAAGTCGGGCGG - Intronic
1120701470 14:87703756-87703778 CTGAGCCATGAGAAGAATGGTGG + Intergenic
1121317499 14:92970974-92970996 CTGGGGCCTGAGAAGTCCGGGGG - Intronic
1121678017 14:95770202-95770224 CTTTGCCCTGTGAATTCTGGGGG - Intergenic
1124037198 15:26065370-26065392 CTGGACCATGAGATGTCTTGTGG + Intergenic
1126048816 15:44668896-44668918 CTGGGGCATGTGGGGACTGGAGG + Intronic
1128087497 15:64896085-64896107 CTGGGCACTGTAAGGTCTGGAGG - Intronic
1131840060 15:96427667-96427689 ATGGGCCATGTGAAGGCAGAGGG + Intergenic
1132198802 15:99933395-99933417 CTGGGGCATGAGAAGTTTGGGGG + Intergenic
1135222880 16:20628273-20628295 ATGGGACATCTGAAGACTGGTGG - Intronic
1139357912 16:66378267-66378289 CTGGGACAAGGGAAGTCAGGAGG + Intronic
1140740166 16:77934491-77934513 CTGGGCCATGTTCCTTCTGGAGG - Intronic
1141482389 16:84315178-84315200 GTGAGCCATGGGATGTCTGGGGG - Intronic
1142101818 16:88276052-88276074 CTGGCCCATGTGGAGCCTGTTGG - Intergenic
1142112021 16:88338097-88338119 ATGGGCCATGGGATGTCTTGGGG - Intergenic
1142432507 16:90037547-90037569 CTGGGGAAAGTAAAGTCTGGGGG + Intronic
1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG + Intronic
1143958523 17:10695364-10695386 CTGGGCAAGATGAAATCTGGAGG - Intronic
1145976341 17:28986340-28986362 CTGGGCCCTGGGAAGTGAGGCGG - Intronic
1151958666 17:77393397-77393419 ATAGGCCATGTGAAGTCAGTGGG + Intronic
1152246252 17:79186151-79186173 CTGGGCCCAGTGCAATCTGGAGG - Intronic
1153157784 18:2168469-2168491 CTTGGCCCTGTGAAGTTTGCTGG - Intergenic
1154469916 18:14690423-14690445 CTGTGCCAGGTGATATCTGGAGG - Intergenic
1154525269 18:15282342-15282364 CTGGGCCACATGAAGCCTGTAGG - Intergenic
1155752456 18:29443162-29443184 CTGGGCCATGTGAAGTTGTTGGG - Intergenic
1156297892 18:35809197-35809219 ATGGCCCATGGGAAGCCTGGTGG - Intergenic
1156323845 18:36054635-36054657 ATTGGCCATGGGAAATCTGGAGG + Intronic
1161066342 19:2240238-2240260 CTGGGCAGCGGGAAGTCTGGCGG - Intronic
1161457169 19:4375225-4375247 CTGGGCCAGGTGGGGGCTGGAGG - Intronic
1168386064 19:55964143-55964165 AGGGGCCATGTGATGCCTGGTGG - Intronic
1168475698 19:56673557-56673579 CTGGCCCCTGAGAAGTCTAGGGG + Intergenic
1168640002 19:58024828-58024850 CGGGGCCGTGTGGAGGCTGGCGG + Intergenic
925689453 2:6506219-6506241 CAAAGACATGTGAAGTCTGGAGG - Intergenic
925877697 2:8327156-8327178 CTGGGCTAAGTCAAGTCTGCAGG - Intergenic
926516565 2:13853516-13853538 CTGGGTCATATGAAATCTGAAGG + Intergenic
926672225 2:15587287-15587309 ATTGGCAATGTGAAGTTTGGAGG - Intergenic
927056429 2:19369702-19369724 CTGGGCCAAGTGACCTCTGCTGG - Intergenic
929778152 2:44941274-44941296 CTGGACTATGTGGAGCCTGGGGG + Intergenic
931056744 2:58480874-58480896 TTGGGCAATGTGGAGTCTAGGGG + Intergenic
933240801 2:79918317-79918339 CTAGGCCATGAAAAGTCTGCAGG - Intronic
934570886 2:95372674-95372696 CTGGGCCAGGTGCAGGCAGGTGG + Intronic
934813688 2:97306116-97306138 ATGGCCCATGTGCAATCTGGAGG - Intergenic
934824007 2:97402364-97402386 ATGGCCCATGTGCAATCTGGAGG + Intergenic
937657043 2:124388257-124388279 CTAGGCCAGCTGAAGCCTGGGGG + Intronic
938524454 2:132114467-132114489 CTGGGCCACATGAAGCCTGTAGG - Intergenic
943300455 2:186191357-186191379 CTGGGCCAGGTCAGGTGTGGTGG + Intergenic
943742632 2:191426922-191426944 CTGGGCCATGTGCAGCCAGAGGG - Intergenic
945516096 2:210764751-210764773 CTGGGCCCTGTTAAATCTGTGGG + Intergenic
947125075 2:226860212-226860234 TTGGGGCATGTTGAGTCTGGTGG + Intronic
948255148 2:236562919-236562941 CTGGTGCATGAGAATTCTGGTGG + Intergenic
948454511 2:238098524-238098546 CTGGGCCCTGTGAGCTCTGCAGG - Exonic
948598303 2:239094561-239094583 ATGGGCCACGTGGAGTCTGTAGG - Intronic
948781772 2:240325857-240325879 GTGGCCCCTGTGAAGTCAGGGGG + Intergenic
948886618 2:240888122-240888144 CGGGGACATGTGATGTCTGGGGG - Intronic
949063645 2:241975717-241975739 CAGGGGCATGTGACTTCTGGTGG + Intergenic
949066828 2:241996148-241996170 CTGTGCCATGGGAACCCTGGGGG - Intergenic
1171484552 20:25477532-25477554 CTGGGCCTTGGGACCTCTGGTGG + Intronic
1173036722 20:39418753-39418775 CTGGTCCATGGGGATTCTGGTGG + Intergenic
1173659312 20:44722397-44722419 CTGAGCCATGAGAAGGATGGAGG - Intronic
1173794679 20:45851025-45851047 CTGGGCCATGAGACATCTTGGGG + Intronic
1175300271 20:57937970-57937992 CTGGGGCATGGGAGGTTTGGTGG + Intergenic
1175999713 20:62826317-62826339 GGGGCCCATCTGAAGTCTGGAGG - Intronic
1176772159 21:13086130-13086152 CTGGGCCACGTGAAGCCTGTAGG + Intergenic
1177000958 21:15612581-15612603 CTGGGCCACATGCAGTCTGTGGG - Intergenic
1178282884 21:31298845-31298867 CTGGGCCATGAGAAGTATAATGG + Intronic
1178640987 21:34344665-34344687 CTAGGCCCTGGGAAGACTGGAGG + Intergenic
1178717453 21:34979120-34979142 CTGGGAACTGTCAAGTCTGGAGG + Intronic
1180147517 21:45929579-45929601 GTGGGCCATGGAGAGTCTGGGGG - Intronic
1181273389 22:21673813-21673835 CTGGCCCATGTGACTTTTGGGGG + Intronic
1182195581 22:28512761-28512783 CTGGGGCCTGTCAAGGCTGGGGG + Intronic
1182495985 22:30707846-30707868 CTGGGCCATGTGTAGCCTCGTGG - Intronic
1183065528 22:35360088-35360110 CAGGGCCATGTCAGGTCTTGTGG + Intergenic
1183229275 22:36570823-36570845 CTGGGCCCTGCCAAGTCTAGTGG - Intronic
1183964644 22:41434478-41434500 CTGGCCCCTGAGAAGTCTAGGGG + Exonic
1184116737 22:42426754-42426776 CTGGGCCCAGAGAAGCCTGGTGG + Intronic
950102629 3:10367296-10367318 CTGGGCCCAGAGAATTCTGGAGG - Intronic
950567654 3:13780685-13780707 CTGGGACAGGTGAGGTCTGCTGG - Intergenic
953042156 3:39265000-39265022 CTGTGTCATGTAAAGTCTGGGGG + Exonic
954334817 3:49910060-49910082 CAGGGACATGTGGAGTCGGGAGG - Intronic
954916873 3:54156093-54156115 CTGGGCAATTTGAAGACTGAAGG - Intronic
955251121 3:57283440-57283462 CTGGGAAATGAGAAGTGTGGTGG + Intronic
956139270 3:66129159-66129181 CTGGGAAATGTGAAGTAAGGTGG - Intergenic
957132222 3:76237961-76237983 CTGGGCTATGTGGAGACTTGGGG + Intronic
965307074 3:167079462-167079484 GTGGGCCATGTGAAATTTGGGGG + Intergenic
966594514 3:181713226-181713248 CTGGGACATGTGAAGTCTGCTGG - Exonic
969482041 4:7451839-7451861 CTTGGCCCTGAGAAGCCTGGAGG - Intronic
969711186 4:8845069-8845091 CTGGGACATGTGGAGGATGGAGG + Intergenic
970302872 4:14700143-14700165 CTGGGCAATCTGAAGACTGTTGG - Intergenic
971138941 4:23902412-23902434 CTGAGCCCTGTGAAGTCCTGAGG - Intronic
972331432 4:38067849-38067871 CTGGGCCATGGGAGGTAAGGAGG - Intronic
973645885 4:52950897-52950919 CAGGGCCATGTCTAATCTGGAGG - Intronic
976202688 4:82595447-82595469 CTTAACGATGTGAAGTCTGGTGG - Intergenic
977097976 4:92769781-92769803 CTGTGCTATGTGCAGTCTAGGGG - Intronic
977938601 4:102833916-102833938 CTGAGCCACGGGAATTCTGGCGG - Intronic
978937402 4:114394887-114394909 CTGGGTGATGTGAGGTTTGGGGG - Intergenic
982058224 4:151575299-151575321 CTGGACCATGTGTGGTGTGGAGG + Intronic
982926127 4:161338930-161338952 CTGGGCTATATGAGGTCTGCAGG - Intergenic
985009072 4:185563858-185563880 CAGGGCCAAGAGAACTCTGGAGG - Intergenic
991430443 5:66539296-66539318 CTGGGCCATCTGAGGGCTTGGGG - Intergenic
992888813 5:81185304-81185326 CTGGGCAAAGTGAAGAGTGGTGG + Intronic
993086369 5:83368360-83368382 ATGGCCCATGTGAAGTGTGAGGG + Intergenic
994195613 5:96919888-96919910 ATGGGCCTTGTGAAGAATGGGGG - Intronic
996687351 5:126297360-126297382 CTGGGCCTGTTGAAGTCTGAGGG + Intergenic
997600482 5:135135189-135135211 CTGGGGCATGGGACGTGTGGTGG - Intronic
1001602961 5:172940839-172940861 CAGGGCAATCTAAAGTCTGGGGG - Intronic
1001603335 5:172943347-172943369 CTGGGCCCTGGAAAGGCTGGGGG - Intronic
1002372253 5:178764373-178764395 CTGGGCCATGTGCTGTATGAAGG - Intergenic
1002585572 5:180244918-180244940 CTGGGCCTTGTGATGGCTGCTGG - Intronic
1003698821 6:8439630-8439652 CTGGCCCTTGGGAAGTTTGGTGG + Intergenic
1004186842 6:13428350-13428372 CTGGGCCGTGTGAAAACTGGGGG + Intronic
1006434540 6:34019401-34019423 TTGGGGCTTGTGAAGTCAGGAGG - Intronic
1008141856 6:47840904-47840926 CTGATCCATGTGAAATGTGGAGG + Intergenic
1013467564 6:110430778-110430800 CTGGGCAAGGCGAATTCTGGGGG - Intronic
1014182262 6:118398030-118398052 CTGGGCTATGAGAAATCTGCAGG - Intergenic
1017266754 6:152455019-152455041 CTGTGTCACTTGAAGTCTGGTGG - Intronic
1018371795 6:163175418-163175440 GTGGGACCTGTGAAGGCTGGGGG + Intronic
1019122360 6:169813319-169813341 CTAGGCCTTGCGAAGCCTGGTGG - Intergenic
1019890513 7:3942297-3942319 CTGGTCCATGTGAAATAAGGAGG - Intronic
1022536578 7:31102258-31102280 ATGGGCCAGGTGCAGCCTGGGGG + Intronic
1022989722 7:35695296-35695318 CTGGGCGACGCGAAGCCTGGCGG - Intronic
1027184624 7:75963543-75963565 CAGGGCCCAGTGAAGTCAGGAGG - Intronic
1029025614 7:97414000-97414022 CTGGGACATGGGGTGTCTGGAGG - Intergenic
1029490775 7:100868739-100868761 CAGGCCGAGGTGAAGTCTGGGGG + Exonic
1030025772 7:105323098-105323120 CTGAGGCATGTGAACTCAGGAGG + Intronic
1032860785 7:135877237-135877259 CTTGGCCAGGTGAAGCCTGGAGG - Intergenic
1034453642 7:151151819-151151841 ATGGGCCAGGTGGAGTGTGGAGG - Intronic
1034829637 7:154298204-154298226 CTGGCAGATGTGAAGTCTGCAGG - Intronic
1034945512 7:155259390-155259412 CTGGGCCGTGTGGAGGCTGAGGG + Intergenic
1035269999 7:157713857-157713879 GTGTGCCATGTGAGGGCTGGAGG - Intronic
1037880906 8:22572957-22572979 AGAGGCCATGTGAAGCCTGGTGG - Intronic
1038548624 8:28445699-28445721 CAGGGCCATCTGAATTCTGTAGG - Intronic
1038876688 8:31558540-31558562 CTGGGCAAGGTGTAGTCTGTTGG + Intergenic
1040386954 8:46920457-46920479 CTTGGCCATGTCAGGACTGGTGG - Intergenic
1040817211 8:51520694-51520716 CTGGGCAATGTGAAGTTTGTTGG - Intronic
1041855881 8:62454389-62454411 CTGGGCCACATGCAGTCTGTGGG + Intronic
1043869126 8:85411227-85411249 CTGTGTCATGTGAAGACTGGGGG + Intronic
1044839073 8:96322719-96322741 CTGGGCCAAGTGAAGACTTTTGG - Intronic
1047376471 8:124301721-124301743 CTGGGACATGTGAAGTTGGCTGG - Intergenic
1047408170 8:124602555-124602577 CTGAGCCATGTGAGGCCTGCAGG + Intronic
1047611119 8:126521820-126521842 CTGGGCCCCTGGAAGTCTGGTGG - Intergenic
1048977007 8:139678723-139678745 CCTGGCCAGGTGAGGTCTGGGGG - Intronic
1049005624 8:139853704-139853726 CTGGGCCAGGGGCAGGCTGGGGG + Intronic
1049118956 8:140716943-140716965 CTGGGCCATGCCATGGCTGGGGG - Intronic
1049354636 8:142181727-142181749 GTGTGCCATGTGCAGTCAGGTGG - Intergenic
1049599782 8:143502074-143502096 CTGGGCCATGTGAAGATGCGTGG + Intronic
1052416680 9:28186883-28186905 CCGTGCCCTGTGAAGTTTGGTGG - Intronic
1056410431 9:86320998-86321020 CTGGGCTATGTAAAGGTTGGTGG - Intronic
1056495839 9:87154501-87154523 ATGGGACATGTGAAGGTTGGAGG - Intronic
1057429408 9:94980219-94980241 CTAGGCCCTGGGAAGTCTGAGGG + Intronic
1058107459 9:100988820-100988842 ATGGGCCAAGTGAAGTGTCGAGG - Intergenic
1059368537 9:113806482-113806504 CTGGGCCATGTGCAGCCTGTGGG + Intergenic
1059521756 9:114949201-114949223 CTGGGCCATATGCAGCCTGCGGG - Intergenic
1059975013 9:119706865-119706887 CTGGGCCACATGCAGTCTGCGGG - Intergenic
1060152419 9:121297064-121297086 CTGGCCCAGGTTCAGTCTGGGGG + Intronic
1060793033 9:126498440-126498462 CTGGGCCAGGTGAGGACAGGTGG - Intronic
1061525895 9:131161925-131161947 CTGGGCCACATGAAGCCTGCAGG - Intronic
1062105858 9:134754416-134754438 CTGGGCCACATGAAGCCAGGTGG + Intronic
1203694427 Un_GL000214v1:83329-83351 TTGGTCTATGTGAATTCTGGAGG - Intergenic
1203641846 Un_KI270751v1:20734-20756 TTGGTCTATGTGAATTCTGGAGG + Intergenic
1186031949 X:5377846-5377868 CCGGGTCATTTGATGTCTGGAGG + Intergenic
1186427886 X:9478508-9478530 TTGGGCCAGGTGAACTTTGGAGG + Intronic
1187268043 X:17755408-17755430 CTGGGCCATCTGAAGGCAGAGGG - Intergenic
1187321207 X:18238875-18238897 CTGGGCCATCTGAAGGCAGAGGG + Intergenic
1187387792 X:18864225-18864247 CTGGGCTATGTGTGGTCTGCAGG + Intergenic
1189322680 X:40096242-40096264 CTGGGCAATGGGGAGTCTGGTGG - Intronic
1190890068 X:54560058-54560080 CTGGAGGAGGTGAAGTCTGGGGG + Intronic
1191775170 X:64805979-64806001 CTGGGCCAGGAAAAATCTGGAGG + Intergenic
1195698605 X:107685087-107685109 CGGGGCCATGTGAGGTCAGGAGG + Intergenic
1195963867 X:110413013-110413035 CTGGGGGATGTGAAGCCTGGTGG - Intronic
1197981989 X:132226955-132226977 CTGGGGAATGAGAAGTTTGGAGG + Intergenic
1198099022 X:133407715-133407737 CTGGGCCTTGTGAAACCTAGTGG + Intronic