ID: 1143769913

View in Genome Browser
Species Human (GRCh38)
Location 17:9162042-9162064
Sequence CTGAGCAATGCTCATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143769913 Original CRISPR CTGAGCAATGCTCATGGGGA GGG Intronic
900096914 1:943479-943501 CTGCGCACTGCTTTTGGGGAGGG - Intronic
900948574 1:5844907-5844929 CTGAGCAGTGCCCATGGCAAGGG - Intergenic
901033293 1:6321061-6321083 CTGAGCTATGGCCATGGGGAAGG + Intronic
901311070 1:8270041-8270063 CTGGGCAATGGTGGTGGGGATGG - Intergenic
902722622 1:18314260-18314282 CTGGGCTATGCTTATGAGGAAGG - Intronic
903017217 1:20368949-20368971 CTGGGCAAGCATCATGGGGAAGG + Intergenic
903266701 1:22162233-22162255 CTTAGCAAAGATCATGTGGATGG + Intergenic
903362224 1:22783850-22783872 CAGAGCTGTTCTCATGGGGAAGG + Intronic
905247839 1:36627113-36627135 CTGATAAATCCTCATGGAGAGGG - Intergenic
907240615 1:53079042-53079064 CTGAGCCATGCCCATGGAGGGGG + Intronic
907326784 1:53643523-53643545 CTGTACAATGACCATGGGGAGGG + Intronic
907755254 1:57304599-57304621 CTCAGCAACGCTTATGGGTAAGG - Intronic
908023791 1:59926731-59926753 CTGAGCCATGCTCGCGGCGATGG - Exonic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
917064903 1:171081713-171081735 CTCAGCAATTCTCATGGTGAGGG + Intergenic
917401736 1:174657017-174657039 GAGAGCAATGCTCATGTGCAGGG - Intronic
920915190 1:210253096-210253118 CTGAGCAGTCCTCCTGGAGAGGG + Intergenic
921125986 1:212178605-212178627 CTAAGCAATTGTCATGTGGATGG - Intergenic
923882870 1:238122813-238122835 CTGAGTAAAGCACATGTGGATGG - Intergenic
1064250955 10:13706029-13706051 CTGTCCAGAGCTCATGGGGAGGG + Intronic
1065429662 10:25640471-25640493 CTGGGCAGGGCTCATGGAGAAGG + Intergenic
1065597481 10:27329321-27329343 ATTTACAATGCTCATGGGGAAGG - Intergenic
1067315669 10:45159216-45159238 ATTTACAATGCTCATGGGGAAGG + Intergenic
1067554578 10:47259640-47259662 CTGGGCAGGGCTCAGGGGGACGG + Intergenic
1067721877 10:48733597-48733619 CCAAGCAATGCTGATGGGGCTGG - Intronic
1067841875 10:49687702-49687724 CTGAGGAAGGCTCATTGCGAAGG + Intronic
1069142585 10:64845123-64845145 CTGAGCAATTCTCTAGAGGAGGG - Intergenic
1069649242 10:70032241-70032263 CAGAGCAATGCAGATAGGGATGG - Intergenic
1072242838 10:93513303-93513325 TTGAGCAAAGCTCCTGGGTATGG - Intronic
1072692003 10:97578154-97578176 CTGAGCTAAGCTGGTGGGGAGGG - Intronic
1075783476 10:125032469-125032491 CTGAGAAAGGTTCATGGGGGAGG - Intronic
1076561270 10:131366321-131366343 AGGAACAAGGCTCATGGGGAAGG + Intergenic
1077938993 11:6819303-6819325 ATGAGCAATACTCATGCGGAAGG + Intergenic
1079615707 11:22490202-22490224 CTGAGCACTGCTAATAGGTAGGG + Intergenic
1080316886 11:30959517-30959539 CTATGGAATGCTCATGGGTATGG + Intronic
1084683481 11:70680443-70680465 CTGAGGAATGATCATGGGTCAGG - Intronic
1085314370 11:75535434-75535456 CTGAACACTCCTCAAGGGGAGGG - Intergenic
1089884540 11:121806928-121806950 CTGAGCGAAGAGCATGGGGATGG + Intergenic
1089962802 11:122630650-122630672 CAGGTCATTGCTCATGGGGATGG + Intergenic
1090227116 11:125078340-125078362 CTCAGAAATGCTCATCTGGATGG - Intronic
1091102551 11:132888426-132888448 GTGAGGGATGCTCATGGAGAAGG + Intronic
1091394598 12:146252-146274 CTGAGGAATTCCCATGAGGAAGG + Intronic
1091649325 12:2298192-2298214 CTGAGCACTTGTCATGGGGAGGG - Intronic
1091657159 12:2354097-2354119 CTCTGAAATGCTGATGGGGATGG + Intronic
1091887571 12:4027716-4027738 CTGGGCAAAGCTGGTGGGGAGGG - Intergenic
1096761619 12:53846281-53846303 CTGAGCCTTACTCTTGGGGAAGG + Intergenic
1101307945 12:103548775-103548797 CTGAGTAATTTTGATGGGGATGG + Intergenic
1102757426 12:115354369-115354391 CTGAGCAATGCTCCAGGGCTGGG - Intergenic
1102927357 12:116836337-116836359 CCGAGGACTGCCCATGGGGAAGG - Intronic
1105226090 13:18433331-18433353 ATTTACAATGCTCATGGGGAAGG + Intergenic
1105693708 13:22867039-22867061 CAAAGCAATGCACATGGGCAAGG + Intergenic
1113466295 13:110515652-110515674 CTGAGTATTTCTCAGGGGGAAGG - Intergenic
1113520562 13:110937635-110937657 CTGAGCATTCCTCACAGGGAAGG - Intergenic
1113896642 13:113768713-113768735 CTGAGCATGGCTCCTGGGTAAGG - Intronic
1114010532 14:18361681-18361703 ATTTACAATGCTCATGGGGAAGG + Intergenic
1114407064 14:22466841-22466863 CTGAGCAGTGCTCCTGGAAAAGG - Intergenic
1117108234 14:52420810-52420832 CTGAACAATGCTCAGGGGCAGGG + Intergenic
1118455786 14:65944859-65944881 CTGTGCATTCCTCATGGGCAGGG + Intergenic
1119138012 14:72238472-72238494 CAGAGCAATGCTTGGGGGGAAGG - Intronic
1119738071 14:76996608-76996630 CTGGGCAGTGCTGATGGGAATGG + Intergenic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1121260656 14:92563763-92563785 CTGTGCTATGCTAATGGGAAAGG + Intronic
1122035707 14:98947885-98947907 CAGAACAAATCTCATGGGGATGG - Intergenic
1122290607 14:100678532-100678554 CTGGGCAAGGCTCATGCCGAGGG + Intergenic
1122334593 14:100962567-100962589 CTGAGCAAAGGAAATGGGGAAGG + Intergenic
1122782908 14:104151111-104151133 CAGAGCAAAGCTCACTGGGAGGG - Intronic
1122961924 14:105097868-105097890 CCCAGCATTGCTTATGGGGAGGG + Intergenic
1127011952 15:54641080-54641102 CTTTGCAAAGCACATGGGGAAGG - Intergenic
1127255232 15:57285256-57285278 CACAGCAATGCTCTTAGGGACGG - Intronic
1127322411 15:57859829-57859851 CTTAGCAATCATCATGGGAAAGG + Intergenic
1127546563 15:59998777-59998799 CAGAGCAAAACTTATGGGGAGGG + Intergenic
1128438073 15:67675478-67675500 ATGAGGAATCCTCATGGTGATGG + Intronic
1131995348 15:98127694-98127716 ATGACCAATGCTAATGAGGAAGG - Intergenic
1132630418 16:914611-914633 GTCACCAATGGTCATGGGGAGGG - Intronic
1133135729 16:3710202-3710224 ATGAGCAAAGCTCAGGGTGAGGG - Intronic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1139343497 16:66287305-66287327 CAGAACAATGATCATGCGGATGG + Intergenic
1140035304 16:71367318-71367340 CCAAGCAAGGCTCATGCGGATGG - Intronic
1140220252 16:73038517-73038539 CTGAGCACTGGACATGGGGCTGG + Intronic
1141213022 16:81998643-81998665 CAGAGCAATCCTCGAGGGGATGG - Exonic
1143176100 17:4956044-4956066 CTGGGCAATCCTCTTGGGGTTGG - Exonic
1143276180 17:5712663-5712685 CTGGGAAATGCTCCTGGTGAGGG + Intergenic
1143558104 17:7675062-7675084 CTGAGCAGCGCTCATGGTGGGGG + Exonic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1144954037 17:19010254-19010276 CTGGGCATTGGCCATGGGGAGGG + Intronic
1145045924 17:19615824-19615846 GTGGGCAATGCTCTGGGGGAAGG + Intergenic
1146806820 17:35871437-35871459 GTGCCTAATGCTCATGGGGAAGG + Intergenic
1147324715 17:39664740-39664762 CTGACCACTGGCCATGGGGAAGG + Exonic
1147933829 17:43999869-43999891 TGGAGCAATGCTCAGGAGGAAGG + Intronic
1151883679 17:76910975-76910997 CTGGGGAATTCTCCTGGGGAGGG - Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1154476627 18:14766154-14766176 ATTTACAATGCTCATGGGGAAGG + Intronic
1154481126 18:14825916-14825938 ATGGGGAATGCTCATGGGGAAGG + Intronic
1154527301 18:15306184-15306206 ATTTACAATGCTCATGGGGAAGG - Intergenic
1156463783 18:37336143-37336165 CTGAGCGAGGCTCCTGGGGCTGG - Intronic
1157798888 18:50602452-50602474 CTGAGCTAGGCTCAGGGGGCAGG - Intronic
1159898365 18:74019025-74019047 CTGAGCAATGGCCATGTAGAAGG + Intergenic
1159952085 18:74492033-74492055 CTGAGCAATGGCCAAGAGGATGG + Intergenic
1161104284 19:2435545-2435567 CTGGGGACTGCTGATGGGGAGGG + Intronic
1161219066 19:3109642-3109664 CTGAGCAAAGCTCTGGGGAAGGG + Intronic
1161644736 19:5446070-5446092 CTGACCATTCTTCATGGGGATGG + Intergenic
1162123239 19:8485237-8485259 CTGAGAAATGCTCCAGGGGGAGG - Intronic
1164945576 19:32290512-32290534 CTGAGCACTTCTCATGTGCAGGG + Intergenic
1166132553 19:40754899-40754921 CTGAGCAAGATTCATGGGGATGG + Intronic
1166433075 19:42742499-42742521 CTGAGCAGTGCACATGGGCTTGG + Intronic
1166590317 19:43991994-43992016 CAGAGCAATGCAAATGGGCATGG - Intronic
1168650122 19:58087238-58087260 CTGAGCACTGGTGATGGGGAGGG + Intronic
926212859 2:10884042-10884064 CCGAGAAATGCTCATGGCAAAGG - Intergenic
927770499 2:25856778-25856800 CTGGGCAATCCTCTTGGGGTTGG + Intronic
929082133 2:38131673-38131695 CTGACCAATGCCCGTGGGTAGGG - Intergenic
931651564 2:64473243-64473265 CTGAGCAGTCCACATGGGGGAGG + Intergenic
932890294 2:75589966-75589988 CTAAGGAACCCTCATGGGGAGGG - Intergenic
937168235 2:119841719-119841741 CTGAGTAATGAGCATGGGAAGGG - Intronic
937246766 2:120498884-120498906 CTGGGCTCTGCTCATGGGGGTGG + Intergenic
937426422 2:121803021-121803043 ATGAGTAATGCTCATGGAGAAGG - Intergenic
938526390 2:132137644-132137666 ATTTACAATGCTCATGGGGAAGG - Intergenic
938696288 2:133838099-133838121 CTGTGCAGTGCACATGAGGATGG - Intergenic
940321251 2:152379111-152379133 CTGAGCCCTGCTGATGAGGAAGG + Intronic
941078311 2:161031466-161031488 CTGAACAATGGCCATGAGGATGG + Intergenic
941131213 2:161651906-161651928 CTGAGCAATACTCAGGCAGAAGG + Intronic
943090117 2:183364166-183364188 ATGATAAATGCTCATGGTGATGG - Intergenic
945440678 2:209875324-209875346 CTGAGCAAAGGTCGTGGAGAGGG - Intronic
947036337 2:225861818-225861840 CTGAGAAATACTTATTGGGATGG + Intergenic
947575800 2:231273244-231273266 CTGCGCAAGGCTGCTGGGGATGG + Intronic
947790117 2:232861321-232861343 ATGAGAAATGCTCCTGGGAATGG + Intronic
1168854770 20:1001004-1001026 CTGAGCAAGGATAAAGGGGAAGG - Intronic
1171570980 20:26251515-26251537 CTGGGCAATGCGCATGCGGGAGG - Intergenic
1171958517 20:31476968-31476990 CTGCACAATGGTCAAGGGGAGGG + Intronic
1172061175 20:32188409-32188431 CTGGGCAAAACTCATGGGAAAGG + Intergenic
1172658133 20:36549321-36549343 CTGAGCGAGGGTCATGGGCAGGG - Exonic
1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG + Intronic
1174408403 20:50317948-50317970 GTGAGCTTTGCTCATGGGGCAGG - Intergenic
1176770139 21:13062334-13062356 ATTTACAATGCTCATGGGGAAGG + Intergenic
1176799478 21:13410699-13410721 ATGGGGAATGCTCATGGGGAAGG - Intergenic
1178141215 21:29685963-29685985 CTGACCCATGCTCAGGAGGAAGG + Intronic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180435025 22:15292482-15292504 ATTTACAATGCTCATGGGGAAGG + Intergenic
1180517231 22:16156295-16156317 ATTTACAATGCTCATGGGGAAGG + Intergenic
1180573151 22:16748528-16748550 CTGGGCAATGCGCATGCGGGAGG - Intergenic
1181643147 22:24215305-24215327 CTGAGCAGTCTTCATGGGCAGGG - Intergenic
1182683030 22:32097282-32097304 CTGGGAAAGGCTCCTGGGGAAGG + Intronic
1182771034 22:32796610-32796632 CTGGCCAGAGCTCATGGGGATGG + Intronic
1182860323 22:33554130-33554152 CTGAGCAGAACTCATGAGGAGGG - Intronic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1184888696 22:47366454-47366476 CAGAGCAGTGCTCATGGGGTTGG + Intergenic
950982927 3:17328384-17328406 CTGACCAATGATCATGGAAATGG - Intronic
953601648 3:44371713-44371735 CTGGGCAATGCTCATGCTTAGGG - Intronic
954945816 3:54423529-54423551 GAGAGCAATGCTTATGTGGAGGG + Intronic
956046828 3:65204622-65204644 TTCAGCAATCCTCATGGTGAAGG - Intergenic
962015097 3:131431314-131431336 CTGAGCTGTGCTCCTGGGGTTGG - Intergenic
962241251 3:133753124-133753146 CTGAGCAAAGGTCATGGGCTAGG + Intronic
962828165 3:139118056-139118078 CTGAGCCATACTCATGGGTCAGG + Intronic
966043791 3:175525683-175525705 ATGAGCAATCCTCAAGGGGTGGG + Intronic
966128491 3:176608090-176608112 TAGAGCAATGCTCTTGGGAAGGG - Intergenic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
976545053 4:86325945-86325967 CTGAGAAATTCTCAAGGGTAAGG - Intronic
978423117 4:108554912-108554934 CTCAGCCATGAACATGGGGAAGG + Intergenic
983898476 4:173106507-173106529 CTAAGCAATGCCCATGCTGAAGG + Intergenic
988962737 5:36385887-36385909 ATGATCAATGTTCATGGTGATGG + Intergenic
989169642 5:38461741-38461763 TTGAACAAGGCTCATGGGGCTGG + Intronic
990339744 5:54810394-54810416 GTGAGCATTGGTGATGGGGATGG + Intergenic
992887827 5:81176572-81176594 CTGATCATTGCACATGTGGACGG + Intronic
993453058 5:88096024-88096046 CTGAATAATGCTGCTGGGGATGG - Intergenic
993462112 5:88195780-88195802 CTGAGCCATGCTTTAGGGGAGGG - Exonic
994352875 5:98767570-98767592 CTGAGCAATATTTATGGGAAAGG + Intergenic
994656438 5:102599804-102599826 CTGACCTAGGTTCATGGGGAAGG - Intergenic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
998537210 5:142944931-142944953 CTGAGCAATGGGGTTGGGGAGGG - Intronic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1001038648 5:168316126-168316148 CTGAGAAACGCTGAGGGGGAAGG - Intronic
1001415283 5:171541380-171541402 CCCAGCAATGTTCCTGGGGAGGG - Intergenic
1001566916 5:172705685-172705707 TTCAGCACTGCTCATGAGGAGGG - Intergenic
1001595583 5:172896760-172896782 ATGAGCAATCCTCCTGGGGCTGG - Intronic
1003440590 6:6137855-6137877 ATGATGAATGCTCATGGTGATGG + Intergenic
1003957123 6:11174391-11174413 CTGAGCAAAGCGCATGAGGGAGG - Intergenic
1005368436 6:25103676-25103698 CTGAGCAACTCTCCTGGTGAAGG - Intergenic
1006412992 6:33886060-33886082 CCTAGCAAGGCTCATGGGGCAGG + Intergenic
1008039792 6:46785107-46785129 CTGATGAATGCTCCTGAGGAGGG + Intergenic
1010056387 6:71570388-71570410 CTGAGGAATGCTCTGGGGAATGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1013615486 6:111839239-111839261 CTGGGGCATGCTCATGGGAATGG - Intronic
1021379899 7:19954472-19954494 TTGAGCAAGGCTCGTGGGCATGG + Intergenic
1022397450 7:30002176-30002198 CTGGGCAAACCTCATGGGAATGG + Intergenic
1024997066 7:55280038-55280060 CTGAGGGGTGCCCATGGGGAAGG + Intergenic
1025205644 7:56992079-56992101 CTGAGCCATGCTCCTGTGGTCGG + Intergenic
1025666296 7:63584859-63584881 CTGAGCCATGCTCCTGTGGTCGG - Intergenic
1026979047 7:74515987-74516009 CTGTGCCATGCTCAGGGTGATGG - Intronic
1027137810 7:75637728-75637750 CTGAGCATTGCCCCTGGGGTTGG - Intronic
1031878845 7:127173383-127173405 CAGAGCAAAGGTCATGGGGAAGG + Intronic
1032007087 7:128311269-128311291 ATGAGCAGTGTTCTTGGGGAGGG - Intronic
1032486296 7:132290002-132290024 CTGGGCAATGCCTATGGGCAGGG + Intronic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1033816757 7:145083007-145083029 CTCAGCCCTGCTCATGGGGCTGG - Intergenic
1034527970 7:151678104-151678126 CTGCTCCATCCTCATGGGGAAGG + Intronic
1035030642 7:155856326-155856348 CTGAGCCATGCTAATGGGACAGG - Intergenic
1035039984 7:155920362-155920384 GTGAACAATGCCCCTGGGGAGGG - Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1040417461 8:47207782-47207804 CTGAGCCAGGCTCAGGGAGAAGG - Intergenic
1040555326 8:48472961-48472983 CTGAGCAATGCTCAAGGGCCCGG - Intergenic
1040858011 8:51970301-51970323 CTGCCCATTGCTTATGGGGATGG + Intergenic
1041568489 8:59308558-59308580 CTGATCAATGCACATGTGGAGGG + Intergenic
1041732316 8:61075157-61075179 CTGTGGACTGCTCAAGGGGAAGG + Intronic
1041956052 8:63558982-63559004 GTGAGCAATACTCAGGGAGAAGG - Intergenic
1044494972 8:92866496-92866518 CTAAGCAATGCTCAAGGAAAAGG + Intergenic
1049708518 8:144053534-144053556 CTGAGCCAGGCTCAAGGAGAGGG - Intronic
1052363323 9:27583368-27583390 CTGAGCAATTACCATGGGGCAGG - Intergenic
1053108503 9:35435934-35435956 ATGAGCAATGCTCAGGGCCAGGG - Intergenic
1055436720 9:76298992-76299014 CTGATAGATGCTCATGGGGTTGG - Intronic
1055486641 9:76762748-76762770 CACAGCCATGCTCATGGCGAAGG - Intronic
1058746025 9:107991583-107991605 CTGAGCAGTTCTTATGGGGCTGG - Intergenic
1059506960 9:114807915-114807937 AGGAGCAATAGTCATGGGGAAGG - Intergenic
1061814003 9:133182341-133182363 AGGAGCACTGCCCATGGGGACGG - Intergenic
1187948673 X:24451120-24451142 CTGAGGGTTGCTCCTGGGGAGGG - Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189537716 X:41953830-41953852 CTCAGCAATGCCCTTGGGGAGGG - Intergenic
1190335342 X:49258432-49258454 CTGGGCGAGGCTCCTGGGGATGG + Exonic
1190411722 X:50143214-50143236 CAGAGCAATGGCCATGGGCATGG - Intergenic
1193331178 X:80237281-80237303 ATGAGTATTCCTCATGGGGAAGG - Intergenic
1195924525 X:110012523-110012545 CTGAGCAAGGCACATGAGAAAGG - Intronic
1198274921 X:135091034-135091056 CTGAGCCACCCTAATGGGGAAGG + Intergenic
1199675462 X:150185496-150185518 CTGAGAAATGCACATGGGATGGG - Intergenic
1201237361 Y:11923998-11924020 CTGAGCATGGCTCATGGGCCTGG - Intergenic