ID: 1143770726

View in Genome Browser
Species Human (GRCh38)
Location 17:9166850-9166872
Sequence ACCCATATGCTGCTGGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143770722_1143770726 -2 Left 1143770722 17:9166829-9166851 CCTGGGCAGGGGGCCGAGGCCAC 0: 1
1: 0
2: 4
3: 43
4: 469
Right 1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG 0: 1
1: 0
2: 1
3: 16
4: 156
1143770715_1143770726 14 Left 1143770715 17:9166813-9166835 CCCAGACTTTACAGGGCCTGGGC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG 0: 1
1: 0
2: 1
3: 16
4: 156
1143770716_1143770726 13 Left 1143770716 17:9166814-9166836 CCAGACTTTACAGGGCCTGGGCA 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG 0: 1
1: 0
2: 1
3: 16
4: 156
1143770713_1143770726 15 Left 1143770713 17:9166812-9166834 CCCCAGACTTTACAGGGCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 205
Right 1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG 0: 1
1: 0
2: 1
3: 16
4: 156
1143770709_1143770726 23 Left 1143770709 17:9166804-9166826 CCTCTTTACCCCAGACTTTACAG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG 0: 1
1: 0
2: 1
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143770726 Original CRISPR ACCCATATGCTGCTGGTGAT TGG Intronic
900870164 1:5296689-5296711 ACCCATTTGCTGCCGGTGCTGGG - Intergenic
900884819 1:5407703-5407725 ACCCATATGCTTGTGATAATGGG - Intergenic
902047800 1:13538890-13538912 TACCATATGCTGTTGGTCATGGG - Intergenic
902792012 1:18775764-18775786 TCCCAGATGCTGCCGTTGATGGG - Intergenic
904900746 1:33855279-33855301 ACCCATAGGCTACAGCTGATTGG + Intronic
905603096 1:39270817-39270839 AGCCTTATGCTGCTAGTGATAGG - Intronic
906573124 1:46862024-46862046 ACCCCTCTGCTGGGGGTGATAGG - Intergenic
906598747 1:47105138-47105160 ACCCCTCTGCTGGGGGTGATAGG + Intronic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
910064824 1:83140692-83140714 ACCAAAATGCTGATAGTGATAGG + Intergenic
910133415 1:83936836-83936858 ACCAATAAGCTGCTGCTGAGTGG + Intronic
911142703 1:94523348-94523370 ACACAAATGCTGCTGGTCTTGGG + Intergenic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
916006773 1:160668982-160669004 ACACATATTCTGCTGTTGTTGGG + Intergenic
917189787 1:172402958-172402980 TCCCAGATGCTGCTGGTCCTGGG - Intronic
917831379 1:178892341-178892363 TCCCTTATGGTGTTGGTGATTGG + Intronic
1065275102 10:24077799-24077821 ACACATTTCCTGCTGTTGATGGG - Intronic
1067531637 10:47078428-47078450 ACAAGTTTGCTGCTGGTGATGGG + Intergenic
1073126345 10:101152619-101152641 GTCCATAAGCTGCTGCTGATGGG + Intergenic
1075426432 10:122345272-122345294 ACTCATATGCTGCTAGTGGGAGG + Intergenic
1081270620 11:41078123-41078145 ACCAAAATGCTGATAGTGATAGG - Intronic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1082249065 11:49960110-49960132 ACTCAAGTGCTGGTGGTGATAGG - Intergenic
1082943722 11:58735737-58735759 ACCCTTAGTCTGCTGGTGAATGG - Intergenic
1083593141 11:63906838-63906860 ATCCAGATGCTGCTGGTGGCAGG - Intronic
1085911312 11:80829956-80829978 ACAAATATCCTGCTGATGATGGG + Intergenic
1087647390 11:100824138-100824160 ACCCACATGCTGCCGGTGGGTGG - Intronic
1087961926 11:104362551-104362573 AGCCATCTGCTGCTGGGGTTGGG - Intergenic
1093512473 12:19945594-19945616 ACCCAGATGCTAATGGTGCTGGG - Intergenic
1093796036 12:23312462-23312484 ACACATATGCTGCTATTGTTGGG - Intergenic
1093892903 12:24545163-24545185 ACACATATGGTGGTGGTGATGGG - Intergenic
1096645692 12:53033751-53033773 AGCCATCAGCTTCTGGTGATTGG + Intronic
1097325930 12:58276933-58276955 ACCAAAATGCTGATAGTGATAGG + Intergenic
1097476078 12:60057918-60057940 ACCAAAATGCTGATAGTGATAGG + Intergenic
1099666186 12:85632228-85632250 TCCCATATGCTGCTACCGATAGG - Intergenic
1100747580 12:97662399-97662421 ACCAACATGCTGATAGTGATAGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102428093 12:112860388-112860410 TGCCATTTGCTGCTGCTGATAGG + Intronic
1103874455 12:124116403-124116425 ACCCCTGTGCTGCTGGTGCCTGG + Intronic
1104602832 12:130164464-130164486 ATCTTTATGCTGCTGGTGGTGGG + Exonic
1106195943 13:27493889-27493911 ACCCATTTGCAGATGCTGATTGG + Intergenic
1107644227 13:42477551-42477573 ATCCACCTGCTGATGGTGATGGG + Intergenic
1107883949 13:44858424-44858446 CCCAATATGCTGCTGATGAATGG + Intergenic
1111823760 13:93243931-93243953 ACTCAGATGTTGCTGGTGATGGG + Intronic
1114770491 14:25425264-25425286 ATTCTTATGCTGCTGCTGATGGG - Intergenic
1119076440 14:71644694-71644716 ACCCTTAGGCTCATGGTGATAGG + Intronic
1119774089 14:77237803-77237825 ACCCATGCTCTGCTGGGGATGGG + Intronic
1120978709 14:90272658-90272680 ACCCACAGGCTGCTGTTGAGCGG - Exonic
1122527934 14:102401844-102401866 ATCCAAATGTTGCTGGTGAAAGG + Intronic
1122918099 14:104868042-104868064 ACCCATGAGCTGCTCCTGATGGG + Intronic
1128616989 15:69118028-69118050 ATGCAGATGCTGCTGGGGATGGG - Intergenic
1132153108 15:99476067-99476089 ACCCAGATGCTCCTGCTTATAGG - Intergenic
1132914025 16:2332451-2332473 ATCCATATACTTCTGGTAATAGG + Intronic
1137645502 16:50069814-50069836 TCCCATTTGCAGCTGGAGATTGG + Intronic
1139802567 16:69535433-69535455 GCCCATATTCTGCAGATGATGGG - Intergenic
1141787987 16:86214447-86214469 ACACCTATGCTGCTGGTGTGGGG - Intergenic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1153211339 18:2768390-2768412 TCCCATATACTGCTGGTGAGAGG + Intronic
1157514368 18:48300428-48300450 AACCATATGCTGGTGGAGCTGGG + Intronic
1160416727 18:78717198-78717220 ACCCACATGGTGTTGGTCATGGG - Intergenic
1162956413 19:14101054-14101076 ACCCTTATCCTGCTGTTAATGGG + Intronic
1166970925 19:46567060-46567082 ACATATATGCTGCTGGAGTTTGG - Intronic
926449600 2:12986313-12986335 TCCCACATGCTGGTTGTGATAGG + Intergenic
926649499 2:15326855-15326877 ACTCACATGCTGCTGGAGAGAGG - Intronic
932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG + Intergenic
932079486 2:68698816-68698838 ACCCATCTGCTTCTGGGAATAGG + Intronic
934115180 2:88783074-88783096 ACCCTGATGCTGCTGGTCCTTGG + Intergenic
934631468 2:95928901-95928923 ACCCTGATGCTGCTGGTCCTTGG - Intronic
934802565 2:97180082-97180104 ACCCTGATGCTGCTGGTCCTTGG + Intronic
939474267 2:142666323-142666345 ATCCCTGTGCTGATGGTGATAGG + Intergenic
940368753 2:152877442-152877464 ACCCAGATGCAGCAGCTGATGGG + Intergenic
940595492 2:155786955-155786977 ACACATATGCTGGTTGGGATGGG - Intergenic
940877682 2:158914377-158914399 TCCCATTTCCTGCTGGTGTTGGG + Intergenic
941619405 2:167759200-167759222 AGTCATATGCTGCTGGTCTTAGG - Intergenic
945568102 2:211429503-211429525 CCACATATCCTGCTGATGATGGG + Intronic
946278565 2:218649264-218649286 ACCCATCTGCTGCGGGAGCTGGG - Exonic
948800520 2:240431356-240431378 AGCCATGAGCTGCTGGTGCTGGG + Intergenic
1169888435 20:10428246-10428268 TGCCATTTGATGCTGGTGATTGG + Intronic
1170108690 20:12780984-12781006 ACTTATATGCTGCTGGTGGGAGG - Intergenic
1170580956 20:17699227-17699249 TCCCTTTTGCTGCTGGTGCTTGG - Intronic
1172361918 20:34318766-34318788 CCACATCTGCTTCTGGTGATTGG + Intergenic
1172626573 20:36350843-36350865 CCCCAGAGGCTGCTTGTGATTGG + Intronic
1174168221 20:48599807-48599829 ACCCATATCCTCAAGGTGATGGG + Intergenic
1174366168 20:50057742-50057764 CCCTAAATGCTGCTGGTGGTTGG - Intergenic
1177390006 21:20455599-20455621 ACCCAAATGCTGGTGAGGATAGG - Intergenic
1177895415 21:26851477-26851499 ACCCGTTTGCTGGTGGTGAATGG + Intergenic
1178958770 21:37045291-37045313 CCCCAGCTGCTGCTGCTGATAGG - Intergenic
1180009598 21:45040664-45040686 GCCCATGTGCTGCTGGGGATAGG + Intergenic
950560699 3:13720450-13720472 ACGCATATTCTGCTGTTGTTGGG + Intergenic
952790468 3:37196496-37196518 ATCCATATACTTCTGGTAATAGG - Intergenic
958160207 3:89809236-89809258 ACCAAAATGCTGATAGTGATAGG - Intergenic
964268033 3:154922024-154922046 ACCAAAATGCTGATAGTGATAGG - Intergenic
964426473 3:156559478-156559500 ACACATATGCTACTGTTGACAGG + Intergenic
968795965 4:2704657-2704679 ACTCAGATGCTGCTGGTGGGTGG - Intronic
975762562 4:77633492-77633514 ACCCACATGGTGTTGGTGCTGGG + Intergenic
976202396 4:82592376-82592398 ACCCATATGTTGCTGGGGCAGGG + Intergenic
980304356 4:131038289-131038311 CACCAAATTCTGCTGGTGATGGG - Intergenic
980458714 4:133077096-133077118 ACCAAAATGCTGATAGTGATAGG - Intergenic
981083284 4:140656753-140656775 ACCTAAATGTTGCAGGTGATTGG - Intronic
982799928 4:159692791-159692813 ACCAATATACTGATAGTGATAGG + Intergenic
983877599 4:172895056-172895078 ACCCATATACTGAAGGTGATGGG - Intronic
986549749 5:8939199-8939221 ACGCATATTCTGTTGGTGTTGGG - Intergenic
987003704 5:13687934-13687956 ACCAAAATGCTGATAGTGATGGG + Intergenic
988671419 5:33385833-33385855 ACCAACATGCTGATCGTGATAGG - Intergenic
988876864 5:35456642-35456664 AACAAAATGCTGATGGTGATAGG + Intergenic
989132866 5:38124927-38124949 ACCAAAATGCTGATAGTGATTGG - Intergenic
989393372 5:40925413-40925435 ACCAAAATGCTGATAGTGATAGG - Intronic
989559942 5:42838525-42838547 TCCCTGATGCTGGTGGTGATTGG - Intronic
991217454 5:64171851-64171873 ACCCAGATGCTGTTAGTTATTGG - Intronic
991776251 5:70088776-70088798 ACCAAAATGCTGATGGTGATAGG + Intergenic
991855538 5:70964223-70964245 ACCAAAATGCTGATGGTGATAGG + Intergenic
991869549 5:71097001-71097023 ACCAAAATGCTGATGGTGATAGG + Intergenic
992079629 5:73222905-73222927 ACCCTTCTGCTGCTTGTGGTGGG + Intergenic
993208716 5:84920831-84920853 ACCCAAATGCTGATGGTGATAGG + Intergenic
993812673 5:92501837-92501859 AGGCATATGCTGATGGTGGTTGG + Intergenic
995588597 5:113674726-113674748 ACTCTGATGCTGCTGGAGATGGG + Intergenic
996637119 5:125706192-125706214 ATGCATATTCTGCTGTTGATGGG - Intergenic
997147171 5:131448093-131448115 AACCAAAAGCTGCTGGTGCTGGG - Intronic
997850244 5:137325992-137326014 TCCCAGATGCTGCTGATGAGTGG - Intronic
998675684 5:144405319-144405341 AACCATATTTTGCTGGAGATTGG + Intronic
1002472105 5:179441595-179441617 TCCCATATGGAGCTGCTGATGGG - Intergenic
1002817837 6:695384-695406 ACCCACATCCTGCTGATGATTGG - Intergenic
1003002863 6:2352236-2352258 TACCCTATGCTGCTGGTGAAAGG + Intergenic
1005813347 6:29532180-29532202 ACCCATGGGCTGCTGGAGCTGGG - Intergenic
1006512397 6:34528780-34528802 ACCCATGATCTGCTTGTGATAGG - Exonic
1007310868 6:40945201-40945223 ACCCACATTCTTCTGGTGCTGGG + Intergenic
1012202630 6:96424825-96424847 ACCAAAATGCTGGTAGTGATAGG - Intergenic
1013847768 6:114475078-114475100 ACTCATATACTGCTGGTGGCAGG + Intergenic
1015027316 6:128551291-128551313 TACCATATGCTCCTGGTGAGAGG + Intergenic
1015094560 6:129399429-129399451 ACGCTGATGCTGCTGGTGAATGG + Intronic
1016244670 6:141967785-141967807 ACCAATATGCTGATAGTGATAGG - Intergenic
1016295909 6:142573509-142573531 ACCAAAATGCTGATAGTGATAGG + Intergenic
1016322695 6:142864243-142864265 TCCTGTAGGCTGCTGGTGATGGG - Intronic
1016588191 6:145713610-145713632 ACTCATACACTGCTGGTGAGTGG + Intronic
1018040919 6:159921503-159921525 ACAAAAATGCTGATGGTGATAGG + Intergenic
1019760699 7:2810381-2810403 ACCCTTAAGGTGCTGGTGTTAGG - Intronic
1020027094 7:4906869-4906891 ACCCATGTGCTGCACTTGATTGG + Exonic
1020516830 7:9132437-9132459 ACTTATATGCTGCTGGTAAGAGG + Intergenic
1022982542 7:35617997-35618019 ACCCATAGGCTGATGATGAAGGG - Intergenic
1023138692 7:37079678-37079700 TGTCATATGCTGCAGGTGATGGG - Intronic
1024312672 7:47983756-47983778 ACCCACATGCTCCTGCTGACTGG + Intergenic
1027279286 7:76594057-76594079 ACCAAAATGCTGATAGTGATAGG - Intergenic
1032280658 7:130498023-130498045 ACCTATGTGGGGCTGGTGATGGG + Intronic
1032687735 7:134252659-134252681 GCCCATGTGCTGCTGGGCATAGG - Intronic
1033231470 7:139601432-139601454 AGCCATATGCTTCTGGTGTTAGG + Intronic
1033463383 7:141568081-141568103 AACCAAGTGCTGCTGGTGACTGG + Intronic
1034940798 7:155228918-155228940 GCACATGTGCTGCTGGTGGTTGG - Intergenic
1035391006 7:158504969-158504991 ACTCATATTCTGTTGGTGACAGG - Intronic
1036518350 8:9467294-9467316 ACCAAAATGCTGATAGTGATAGG + Intergenic
1040540117 8:48346344-48346366 ACCAAAATGCTGATGGTGATAGG + Intergenic
1041762256 8:61379389-61379411 ACCCATTTGGTGGTGGAGATGGG - Intronic
1042527040 8:69774229-69774251 ATCCATAGGCTCCTGGTGCTAGG + Intronic
1043701889 8:83299314-83299336 GCCCATCTGCTTCTGGTCATGGG + Intergenic
1045422298 8:102027921-102027943 ACCCCCATGCTGCTGGTCTTTGG - Intronic
1046625563 8:116573209-116573231 AGCCATATGCTGGTCTTGATCGG + Intergenic
1050887793 9:10787165-10787187 ACCCATGTACTGCTAGTAATGGG + Intergenic
1053424074 9:37999663-37999685 TCCCACGTGCTGCTGGTGGTTGG - Intronic
1057320011 9:94004069-94004091 ACTCCTATGCTGCAGGTGCTGGG - Intergenic
1060132846 9:121121728-121121750 CCGCAGAGGCTGCTGGTGATTGG + Intronic
1061451626 9:130670101-130670123 ACCCACAGGCTGCTGGGGGTAGG + Intronic
1061946693 9:133912488-133912510 ACCCATATGTCACTGGTGCTGGG + Intronic
1203582552 Un_KI270746v1:24865-24887 ACCCTGATGCTGCTGGTCCTTGG + Intergenic
1187508588 X:19897462-19897484 TCCCACATGCTGCTGCTGCTGGG - Intergenic
1187526441 X:20059332-20059354 TCCCAGGTGCTGCTGGTCATGGG + Intronic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1189815687 X:44822433-44822455 ACCAAAATGCTGATAGTGATAGG + Intergenic
1193682378 X:84538579-84538601 ACAGACATGCTGCTGGTGGTGGG - Intergenic
1194064093 X:89240892-89240914 ACCAAAATGCTGATAGTGATAGG + Intergenic
1197040341 X:121929252-121929274 ACCAAAATGCTGATAGTGATAGG + Intergenic
1198274574 X:135088866-135088888 ACCAAAATGCTGATAGTGATAGG + Intergenic
1198632524 X:138656645-138656667 ACCCATATGCTTCTAGTGTTTGG - Intronic
1200716492 Y:6552052-6552074 CCGCATATGCTTCTGGTGAGTGG - Intergenic
1200718268 Y:6574991-6575013 ACCAAAATGCTGATAGTGATAGG + Intergenic
1202093812 Y:21222593-21222615 ACCAATGTGCTGATAGTGATAGG + Intergenic