ID: 1143771681

View in Genome Browser
Species Human (GRCh38)
Location 17:9173141-9173163
Sequence CAGGGCAGACAGAGAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 760
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 703}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143771681_1143771694 27 Left 1143771681 17:9173141-9173163 CCCTGGTCTCTCTGTCTGCCCTG 0: 1
1: 0
2: 4
3: 52
4: 703
Right 1143771694 17:9173191-9173213 CTTCGCCGCCACCTTACATTAGG 0: 1
1: 0
2: 0
3: 3
4: 43
1143771681_1143771687 1 Left 1143771681 17:9173141-9173163 CCCTGGTCTCTCTGTCTGCCCTG 0: 1
1: 0
2: 4
3: 52
4: 703
Right 1143771687 17:9173165-9173187 CCCCAAAAGCCCTGCCTGCCTGG 0: 1
1: 0
2: 4
3: 48
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143771681 Original CRISPR CAGGGCAGACAGAGAGACCA GGG (reversed) Intronic
900512154 1:3065863-3065885 CTGGGCAGAGAGGGAGTCCATGG - Intergenic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
900793954 1:4696422-4696444 CAGGGCAGCCAGGCAGCCCAGGG - Intronic
901448904 1:9324458-9324480 CTGGGCACAGAGAGACACCATGG - Intronic
901773160 1:11541284-11541306 GAGGGGAGGCAGAGAGAGCAGGG + Intergenic
901829258 1:11882099-11882121 CAGGGAAGGCAGTGTGACCACGG + Intergenic
902385308 1:16072785-16072807 CAGGTCAGACACAGAGAGAAAGG + Intronic
902638656 1:17751736-17751758 GAGGGCACAGGGAGAGACCATGG - Intergenic
902696780 1:18145537-18145559 ATGGGCAGGCAGAGAGTCCAGGG + Intronic
903004037 1:20286672-20286694 CAGGGCTGTCAGAGAGACTAGGG - Intergenic
903106408 1:21084363-21084385 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903309689 1:22444918-22444940 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
904213654 1:28902633-28902655 CAGGCCAGGCATAGAGACCCAGG - Intronic
904276011 1:29384719-29384741 CAGGGCTGGCAGAGTGACCAAGG + Intergenic
904941893 1:34169663-34169685 GAGGGCAGAAATAGAGGCCAAGG + Intronic
905232853 1:36525851-36525873 GAGGGCAGAAGGAGAAACCATGG - Intergenic
905267548 1:36765139-36765161 TAGGACAGACAGACAGACAAGGG - Intergenic
905902396 1:41590218-41590240 CTGGGCAAAGAGAGAGGCCAAGG + Intronic
906525306 1:46490099-46490121 GGGGACAGACAGAGAGACCCAGG + Intergenic
906698891 1:47843283-47843305 CAGGGCAGACGCAGGGACCCTGG + Intronic
906831380 1:49035320-49035342 TAAGGCAGAAGGAGAGACCAAGG + Intronic
908114171 1:60924918-60924940 AAGGGCAGAGAGAGAGAGGACGG - Intronic
908566567 1:65363068-65363090 CAGGACAGAGAAAGAGAGCAAGG + Intronic
908948088 1:69524301-69524323 CATGGCAGAGTGAGAGACCAAGG + Intergenic
909200429 1:72685232-72685254 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
909300065 1:74001973-74001995 CAGTGCTGTCAGAGAGAGCATGG - Intergenic
909344034 1:74564649-74564671 CAGGAGAGAGAGAGAGAGCAAGG + Intergenic
909833497 1:80224376-80224398 CAGGGAAGAGAGAGAGAAAAGGG - Intergenic
910285932 1:85553955-85553977 CAGGGCAGGCACAGAGGCCTGGG - Intronic
910964255 1:92792401-92792423 CAGAGAAGACAGAGAGACTGGGG + Exonic
911159283 1:94668250-94668272 TAAGGCAGAATGAGAGACCACGG - Intergenic
911726468 1:101246439-101246461 CAGGGCAGAAAGAAAAACCTTGG + Intergenic
912449354 1:109759796-109759818 CAGGGGAGTCAGAGAGTCCAGGG - Exonic
912497666 1:110101943-110101965 CAGGACAGACAGAGACACGCAGG - Intergenic
912549598 1:110476457-110476479 AAGAGCAGAAGGAGAGACCAAGG + Intergenic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
913422668 1:118689636-118689658 CTAGGCAGAGTGAGAGACCAAGG + Intergenic
914375932 1:147073594-147073616 AAGGACAGAGAAAGAGACCAAGG - Intergenic
914830581 1:151168153-151168175 AAAGGGAGACAGAGGGACCAGGG - Exonic
915006605 1:152644184-152644206 CAGGGCTGAGAGAGTGACCGGGG + Intergenic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915106936 1:153540658-153540680 CAGGGCAAAGAGAGAGTCCAGGG + Intronic
915465887 1:156097717-156097739 CAGGGCAGGCAGGGAGGCTAGGG - Intronic
915571324 1:156746830-156746852 CAGGAGAGACAGAAAGGCCAAGG + Intronic
915584058 1:156834192-156834214 CGGGGAAGCCACAGAGACCAAGG + Intronic
915898556 1:159829828-159829850 TGGGGCAGGCAGAGTGACCAGGG + Intronic
915938269 1:160101488-160101510 CAGGCCAGACTGAGACACGAAGG + Intergenic
916079498 1:161223612-161223634 CAGGGCAGGCACAGACACCAAGG - Exonic
917442550 1:175080122-175080144 CAGGGCAGAGAGGGTGAGCAAGG - Intronic
917488182 1:175474346-175474368 CAGGGCATCCAGAGGCACCAGGG + Intronic
917491955 1:175505370-175505392 CAGGGCTGACTGAGCGAGCAGGG + Intronic
917737935 1:177937329-177937351 CAGGGCAGACAGGGACACCGAGG - Exonic
917838011 1:178956101-178956123 TGGGACACACAGAGAGACCAGGG + Intergenic
919088316 1:192948151-192948173 TATGCCAGACAGAGAGACCCTGG - Intergenic
920087806 1:203430576-203430598 CAGTGCAGACAAAGTAACCAGGG - Intergenic
920431330 1:205921124-205921146 CAGGCCAAACAGAGAGCCCACGG - Intronic
920618947 1:207525055-207525077 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920620727 1:207543611-207543633 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920622509 1:207562168-207562190 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920988768 1:210915537-210915559 CAGGGAAGGCAGGGAAACCAGGG + Intronic
921456292 1:215376072-215376094 CAAGACAGAGAGAGACACCAAGG + Intergenic
921456361 1:215376685-215376707 AAGTACAGACAGACAGACCATGG + Intergenic
923102091 1:230824752-230824774 CAGGGCAGCAAGAGAGACCATGG - Intergenic
923661090 1:235958005-235958027 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
923961681 1:239091703-239091725 CAGGGCAGTGAGAGAGTCGAAGG + Intergenic
1063018814 10:2105381-2105403 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1063125387 10:3132439-3132461 CAGGTGAGAGAGAGAGACCAGGG + Exonic
1063364511 10:5481576-5481598 TACGGCAGAAAAAGAGACCAAGG + Intergenic
1063944935 10:11166651-11166673 CATGCCAGACAGAAACACCAAGG - Intronic
1064219776 10:13430939-13430961 CAGGGGAGACAGAGGCGCCAAGG - Intergenic
1065944401 10:30593708-30593730 CAGAGAAGGCAGAGTGACCAAGG - Intergenic
1065990584 10:31006036-31006058 TAGGGTAGACAGAGATTCCAGGG - Intronic
1066044381 10:31583098-31583120 CTGGGCTCACAGAGAGGCCATGG - Intergenic
1066289265 10:33998959-33998981 TAGGGCAGAAGGAGAGACCAAGG + Intergenic
1067071762 10:43137915-43137937 CGTGGGAGACAGAGAGCCCAGGG + Intergenic
1067162784 10:43841725-43841747 CAGGTCAGACAGTGACCCCAAGG + Intergenic
1067231606 10:44415895-44415917 CAGGACATACACACAGACCAGGG - Intergenic
1067399120 10:45954865-45954887 TAAGGCAGAATGAGAGACCAAGG - Intergenic
1067832778 10:49620010-49620032 CAGGGCAGAAGGAGAGATGAGGG + Intronic
1067867441 10:49924081-49924103 TAAGGCAGAATGAGAGACCAAGG - Intronic
1068866680 10:61902387-61902409 CAGGGCAGAAATAGCGACCATGG + Exonic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069830479 10:71279536-71279558 CATTACAGACAGAGAGGCCAAGG - Intronic
1069837159 10:71316760-71316782 CAGGGCAGACTCAGAGCTCAGGG + Intergenic
1069935483 10:71912773-71912795 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070721583 10:78760824-78760846 TAGGCCAGCCAGAGAGGCCAGGG - Intergenic
1070725434 10:78784520-78784542 TATGGAAGACAGATAGACCAGGG - Intergenic
1070847257 10:79533416-79533438 TACGGCAGAATGAGAGACCAAGG + Intergenic
1070926543 10:80226876-80226898 TACGGCAGAATGAGAGACCAAGG - Intergenic
1071027621 10:81134803-81134825 CAGGGAAGACAGACAGAATAAGG + Intergenic
1072150504 10:92679124-92679146 CAGGGCTGTCAGAGAGAGCTTGG - Intergenic
1072520065 10:96223410-96223432 TAAGGCAGAAGGAGAGACCAAGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073038176 10:100578817-100578839 GAGGGGAGACAGAGAGAAAAGGG + Intergenic
1073859512 10:107721572-107721594 CAGGAGAGAGAGAGAGAGCAGGG - Intergenic
1074541926 10:114372223-114372245 CAGGGCATCCCCAGAGACCAAGG - Intronic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075355446 10:121768771-121768793 TAGGGCATACATACAGACCATGG - Intronic
1075703854 10:124486815-124486837 CTGGTCAGACTGAGAGAGCAGGG + Intronic
1075741885 10:124701076-124701098 CTGGGCAGGCAGAGATACCAAGG - Intronic
1076101276 10:127780886-127780908 CATGGCAGAAAGAGAAACCCAGG - Intergenic
1076284969 10:129286047-129286069 CGGGGCAGACAAACAGATCAAGG + Intergenic
1077489462 11:2853739-2853761 CGGTACAGACAGGGAGACCAAGG + Intergenic
1077725945 11:4675133-4675155 CTGGGAAGTCAGAGAGACCTGGG + Intergenic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078149503 11:8746700-8746722 TAGGGCAGAAAGAAAGACCAGGG + Intronic
1078290454 11:10005565-10005587 TAAGGCAGAGTGAGAGACCAAGG - Intronic
1078291966 11:10020595-10020617 TAAGGCAGAGTGAGAGACCAAGG - Intronic
1079129786 11:17740785-17740807 CAGGGCAGAGAGACAGACACAGG - Intronic
1079240440 11:18718686-18718708 CCTGGAAGACAAAGAGACCAAGG - Exonic
1079829328 11:25242620-25242642 CATGGCAGACAGAGAGGAAAAGG + Intergenic
1080305263 11:30828247-30828269 CAAAGCAGACAGAGATACCTGGG - Intergenic
1080543862 11:33296764-33296786 CAGAGGAGAAGGAGAGACCAAGG - Intronic
1081742357 11:45449562-45449584 GGGGGCAGAGAGAGAGACAAGGG - Intergenic
1082645464 11:55719661-55719683 CAGGGCAGACTGAGTAAACAAGG - Intergenic
1082768364 11:57186459-57186481 CAGGGAAGATAGGGAGCCCAGGG + Intronic
1082942727 11:58725619-58725641 GAAGGCAGAAGGAGAGACCAAGG + Intronic
1083431723 11:62616763-62616785 CAGGCCACACTGAGACACCACGG + Exonic
1083512598 11:63225722-63225744 GAAGGCAGAGAGAGAGACAAGGG - Intronic
1084129048 11:67119395-67119417 CAGGAAAGACAGAGCGGCCACGG - Intronic
1084178184 11:67434126-67434148 CAGGGCAGAGGGAGTGACCGGGG + Intronic
1084733759 11:71091453-71091475 CAAGGTAGCCAGAGAAACCATGG + Intronic
1085320727 11:75572328-75572350 CAGGGCAGGCAGAATGACTATGG - Exonic
1086974332 11:93115234-93115256 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
1087104767 11:94398447-94398469 TAGTGCAGACAGAGGGACCAGGG - Intronic
1087362425 11:97177842-97177864 CATGGCAGGAAGAGAGAGCAAGG + Intergenic
1087797753 11:102472470-102472492 TAAGGCAGAGTGAGAGACCAAGG + Intronic
1088241974 11:107782423-107782445 CAAGGCAGAGTGAGAGACCAAGG + Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088429617 11:109744771-109744793 CAGCGGAGACAGCGAGACCTGGG - Intergenic
1088812732 11:113402382-113402404 AAGGGCACAGAGAGAAACCATGG - Intergenic
1089560548 11:119341064-119341086 CAGGGCAGTGGCAGAGACCAAGG + Exonic
1090247511 11:125226945-125226967 AAGGCCTGACAGAGAGAGCAAGG - Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090514609 11:127412077-127412099 CAGAGATGACAGAGAGACGATGG - Intergenic
1090936120 11:131344170-131344192 CAGTGCAAACAGAGAGAAAAGGG + Intergenic
1091178631 11:133583221-133583243 CAGTGGAGACAGAGATACAAAGG + Intergenic
1091322067 11:134658707-134658729 CAAGGCAGCCAGAGAGGCCCTGG - Intergenic
1091673211 12:2467570-2467592 GAGGGCAGCCAGAGACAGCAGGG + Intronic
1091805771 12:3354884-3354906 AAGGGAAGGCACAGAGACCATGG + Intergenic
1092231760 12:6779701-6779723 CAAGACAGACAGACAGAGCAGGG - Intergenic
1092260558 12:6951436-6951458 CTGGGCAGGCAGAGAGCTCAGGG - Exonic
1092267370 12:6992692-6992714 CAGGGCAGTCAAGGAAACCAGGG - Intronic
1093140618 12:15506583-15506605 CAGGACAGAGAGAGAGAGCAGGG + Intronic
1093880236 12:24395895-24395917 CAGGCCAGACAGAGATGTCAGGG - Intergenic
1094063498 12:26340087-26340109 GAGGGGAGACAGAGGGTCCAGGG - Intronic
1094514948 12:31120720-31120742 CAGGGCAGACACACACCCCAAGG + Intergenic
1094692127 12:32779809-32779831 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
1094724150 12:33095364-33095386 CAGGAAAGAGAGAGAGAGCAAGG + Intergenic
1095314749 12:40746442-40746464 TAAGGCAGAAAAAGAGACCAAGG + Intronic
1096718676 12:53505755-53505777 CAGGGCACCCAGGGAGCCCAGGG - Exonic
1097286681 12:57882944-57882966 CAGGGAATTCAGAGAGGCCAAGG + Intergenic
1098387677 12:69935954-69935976 CACGGCTGACAGAAACACCATGG - Intronic
1098882142 12:75927484-75927506 CAGGGCAGACAGAGAGCAAAGGG + Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099837212 12:87921820-87921842 TAGGGCAGATAGAGTGAGCATGG + Intergenic
1100135793 12:91551983-91552005 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101446468 12:104740381-104740403 CAGGGCAGAGTGAGAGGGCAGGG - Intronic
1101466852 12:104958143-104958165 CAGACCAGACCGAGACACCAGGG + Intronic
1101938478 12:109080216-109080238 CAGGGCTGGTGGAGAGACCAGGG - Intronic
1101953455 12:109194060-109194082 CAGCGCCTTCAGAGAGACCACGG - Intronic
1102216765 12:111167148-111167170 CCTGGCAGAAAGAGAGGCCAAGG - Intronic
1103817169 12:123668030-123668052 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
1103882991 12:124180736-124180758 TAGGCGAGAGAGAGAGACCAGGG + Intronic
1104279132 12:127357786-127357808 CAGGGAGAACAGTGAGACCAAGG - Intergenic
1104718953 12:131034014-131034036 CGGGGTAGACAGTGAAACCAGGG - Intronic
1106404379 13:29461181-29461203 CAGGACAGAGAGAGAGAGAAGGG + Intronic
1106525472 13:30536987-30537009 CAGGGAAGACAGAGGACCCATGG - Intronic
1107670671 13:42743507-42743529 CAGGTGAGAAGGAGAGACCAAGG + Intergenic
1108048190 13:46403151-46403173 CAGGGCCCACAGAGAGCCCTTGG - Intronic
1108071963 13:46637293-46637315 TAGGGCAGGCAGGGAGGCCAGGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108718388 13:53105034-53105056 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1109176831 13:59167485-59167507 TAAGGCAGAAACAGAGACCAAGG + Intergenic
1110079446 13:71292152-71292174 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1110284212 13:73730834-73730856 TAGGGCAGACAGGATGACCAGGG + Intronic
1110930693 13:81212310-81212332 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
1111233422 13:85375065-85375087 CAGTGCAAACAGAGTGACCTTGG + Intergenic
1111476829 13:88760991-88761013 AAAGGCAGAGTGAGAGACCAGGG + Intergenic
1111699744 13:91671885-91671907 CAAAACAGACATAGAGACCAAGG + Intronic
1111838153 13:93414655-93414677 CTGGGCAGAGGAAGAGACCACGG + Intronic
1112247662 13:97749208-97749230 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
1112812068 13:103230533-103230555 AAGGGCAGAAAGACAAACCAAGG - Intergenic
1113398257 13:109968721-109968743 CAGGGGAGACAGAGAAGCTACGG + Intergenic
1113884746 13:113652572-113652594 CAGGGCAGCCAGAGATGCCAGGG - Intronic
1115887955 14:37994615-37994637 TAAGGCAGAGTGAGAGACCAAGG - Intronic
1116477853 14:45362535-45362557 CAGGTCACAGAGAGAAACCAGGG + Intergenic
1116749648 14:48867645-48867667 CATGGCAGAAAGAGAAAGCAGGG + Intergenic
1117410130 14:55442869-55442891 CTGGACACACAGAGACACCAGGG + Intronic
1117966616 14:61213092-61213114 CACGGCAGGCAAAGAGACAAGGG - Intronic
1118355249 14:65008402-65008424 CAGGGAAGCCAGAGTGAGCAAGG + Intronic
1118648719 14:67867389-67867411 CAGTGATGACAGAGAGACCTAGG + Intronic
1119459095 14:74783317-74783339 CACGGCAGGCAGGGAGGCCAAGG - Intronic
1119573868 14:75700742-75700764 TAAGGCAGAGTGAGAGACCAAGG - Intronic
1119714409 14:76848669-76848691 CAAGGGAGACATAGAGTCCAAGG + Intronic
1119946911 14:78704665-78704687 CAGTGCAGTCAGAGAGATAAGGG + Intronic
1119968915 14:78947724-78947746 CAGGGCAGGCTGAGGGACCATGG - Intronic
1120263656 14:82221059-82221081 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1121081196 14:91109659-91109681 CAGGGCAGAGAAAGAGAGAAAGG + Intronic
1121180584 14:91925827-91925849 CAGGACAGCCACAGCGACCATGG + Intronic
1121908764 14:97770257-97770279 CAGGGCAGACAGAGCTGACAGGG - Intergenic
1122154026 14:99739558-99739580 CAGGGCAGACAGAGCCAGCCTGG - Intronic
1122814468 14:104305685-104305707 CAGGGCTGACACAGCCACCAGGG - Intergenic
1122820024 14:104337565-104337587 AAGGCCAGACAGAAAGTCCAGGG - Intergenic
1122964489 14:105115760-105115782 CAAGGCAGAAGGAGAGACCGAGG + Intergenic
1123028370 14:105439192-105439214 CAGGGCTGCCTGAGTGACCAGGG - Intronic
1123092765 14:105749113-105749135 CTGGGCAGACAGAAAACCCAAGG + Intergenic
1124378004 15:29140832-29140854 CAGGGCAAACAGAGCCACCTGGG - Intronic
1124554513 15:30712079-30712101 CAGGGCTGACAGCGGGCCCAGGG - Intronic
1124676736 15:31693598-31693620 CAGGGCTGACAGCGGGCCCAGGG + Intronic
1125041136 15:35188602-35188624 GAAGGCAGAAGGAGAGACCAAGG - Intergenic
1125115530 15:36086801-36086823 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
1125594947 15:40878903-40878925 CAGCTCAGACAGAGGGACCTAGG - Intergenic
1125833400 15:42731423-42731445 CAGGACAGACAGGGAGGCCCAGG + Intronic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1127855908 15:62953460-62953482 CAGGGTAGATAGGGAGACTATGG + Intergenic
1127932454 15:63605888-63605910 CAGTGCCGGCAGAGAGACCAGGG + Intergenic
1128649489 15:69400212-69400234 AAGGGCAGAGAGAGAGGCCAAGG + Intronic
1128662691 15:69513751-69513773 CAGGGCAGTCACAGTGACAAAGG + Intergenic
1128822386 15:70670533-70670555 TAAGGCAGAGGGAGAGACCAAGG - Intronic
1128888808 15:71312436-71312458 TAGGACATACAGAGACACCAGGG + Intronic
1129164468 15:73768435-73768457 CAAGGCAGATAAAAAGACCAAGG + Intergenic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129901669 15:79156361-79156383 GAGGGGAGACAGAGAGATGAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130275861 15:82476076-82476098 CTGGGCAGTCAGAAAGCCCAGGG - Intergenic
1130418411 15:83715789-83715811 CAGGGCACACAGAGAGAAATGGG - Intronic
1130468220 15:84203468-84203490 CTGGGCAGTCAGAAAGCCCAGGG - Intergenic
1130496044 15:84470074-84470096 CTGGGCAGTCAGAAAGCCCAGGG + Intergenic
1130590513 15:85208066-85208088 CTGGGCAGTCAGAAAGCCCAGGG - Intergenic
1130667259 15:85880184-85880206 CAGGGTGGAAAGAGAGATCACGG - Intergenic
1130740339 15:86592325-86592347 TAAGGCAGAGGGAGAGACCAAGG + Intronic
1131138508 15:89958205-89958227 CAGGGCAAACAGGGCGAACAGGG - Intergenic
1131308141 15:91264052-91264074 AAGGGCAGACAGGCAGAACAGGG - Intronic
1131326938 15:91456665-91456687 CAGGGGACGCAGAGAGCCCACGG + Intergenic
1131509489 15:93041824-93041846 CAGGGCTCCCAGAGAGAACACGG - Intronic
1132130166 15:99269832-99269854 CATGGCAGAGAGAGAAACAAAGG + Intronic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132636442 16:952137-952159 CAGGCCAGACAGTGTCACCAGGG - Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132770948 16:1563024-1563046 CAGAGCAGACAAAGAGCCCTAGG + Intronic
1132818281 16:1846396-1846418 CAGGGCAGAGAAAGAAACAAGGG + Intronic
1132989754 16:2786679-2786701 GAGGACAGACAGAAGGACCACGG - Exonic
1133228495 16:4354854-4354876 CAGGGGAGACAGGGTGCCCAGGG + Exonic
1133301146 16:4783675-4783697 CAGGGCCGACAGCCTGACCATGG - Exonic
1135304353 16:21355737-21355759 CAGAGCAGACAGAGACATAATGG - Intergenic
1135375946 16:21947598-21947620 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1135771415 16:25221112-25221134 CAGGTCAGATTGAGATACCAAGG - Intronic
1136421012 16:30133059-30133081 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1136543520 16:30942405-30942427 CAGGGCAGAGACAGAGAGCCAGG - Exonic
1136569250 16:31086936-31086958 AAGGGTAGACAGTGACACCATGG + Intronic
1136592169 16:31224163-31224185 CAGCGCTGCCAGAGAGAACACGG - Exonic
1136928556 16:34397313-34397335 CAGGGGAGACAGAGGCACCGAGG + Intergenic
1136976018 16:35014491-35014513 CAGGGGAGACAGAGGCACCGAGG - Intergenic
1137405474 16:48185818-48185840 CAGGGGCCACAGAGTGACCAGGG - Intronic
1138311570 16:56028117-56028139 CAGGCCAAAAAGAGGGACCAGGG - Intergenic
1138518609 16:57555955-57555977 CAGGGGAGAGAGAGAGAGAAGGG - Intronic
1138815624 16:60199968-60199990 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1139013185 16:62658675-62658697 GAGGATAGACAGAGAGGCCAGGG - Intergenic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139377580 16:66509794-66509816 CAGAGCAGTCATAGACACCATGG - Exonic
1140139942 16:72245962-72245984 AATGGCAGAAAGAGAGATCATGG + Intergenic
1140459697 16:75129836-75129858 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1140478694 16:75251322-75251344 CAGGGCAGAAGGAGATCCCAGGG + Intronic
1140977068 16:80070183-80070205 CAGAGGGGACAGAGAGACCCAGG - Intergenic
1141159913 16:81622383-81622405 CCGGGCACAAAGAGAGACCCAGG - Intronic
1141785361 16:86196304-86196326 CGAGGCACACAGACAGACCATGG + Intergenic
1141812587 16:86385335-86385357 CAGGCCAGACAAAGAGACCCTGG - Intergenic
1142126553 16:88413491-88413513 CAGGGCTGCCACAGAGCCCAGGG - Intergenic
1142219130 16:88844495-88844517 CAGGCCAGACAGAGGGGCCTCGG - Intronic
1142540570 17:655541-655563 CAAGGCAGACAGAGTGACACAGG - Intronic
1142955044 17:3515855-3515877 TAGCGAACACAGAGAGACCATGG + Intronic
1143116327 17:4583867-4583889 AAGGGCAGACAGAGAAAGAAGGG - Intergenic
1143571234 17:7759996-7760018 CAGGCCAGGAGGAGAGACCAGGG + Intronic
1143733361 17:8893919-8893941 GAGGGCAGTCAGAGAGGCCACGG - Intronic
1143771681 17:9173141-9173163 CAGGGCAGACAGAGAGACCAGGG - Intronic
1144065844 17:11623383-11623405 CAGGGCAAACAAAGAGGTCAGGG - Intronic
1144365435 17:14540184-14540206 CAAGGCAGAAGGAGAGACCAAGG + Intergenic
1144518843 17:15940953-15940975 CAGAGCAGAAAGAGAGAACCTGG + Intergenic
1144650809 17:17005660-17005682 CAGAGCAGTCAGGGAGAGCATGG + Intergenic
1145749877 17:27347891-27347913 AAAGACAGACAAAGAGACCATGG + Intergenic
1145886217 17:28384241-28384263 CAGGGCAGATGGAGAGACTTTGG + Intronic
1146409205 17:32567582-32567604 CAGGGCAGAGAAAGAGTACAAGG - Intronic
1146430649 17:32790763-32790785 CAGGGCAAAGAGAGAGAAGAGGG + Intronic
1146608028 17:34278771-34278793 AAGGGCAGCCAGAGAGAGAAAGG + Intergenic
1146686635 17:34845597-34845619 CAGGGAAGACAGAGAAGCGACGG + Intergenic
1147556931 17:41485641-41485663 GAGGGCAGTCAGGGAGAGCAGGG - Intergenic
1147627616 17:41910110-41910132 GAGGACAGTCAGAGGGACCAGGG - Intronic
1147937602 17:44022028-44022050 CTGGGGAGAGAAAGAGACCATGG - Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149075505 17:52593097-52593119 AAGGAGAGACAGAGAGACCAGGG - Intergenic
1149299049 17:55287418-55287440 CAGGGCTTACACAGTGACCATGG - Intronic
1149451735 17:56754986-56755008 CAGGGCAGACAGAGTGGCTCCGG + Intergenic
1149545400 17:57499813-57499835 CAGCTCATGCAGAGAGACCATGG - Intronic
1149762402 17:59244021-59244043 TAAGGCAGAAGGAGAGACCAAGG + Intronic
1150724970 17:67644253-67644275 CGTGGCAGACAGAGATAGCATGG - Intronic
1150827893 17:68492745-68492767 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1151051116 17:70979403-70979425 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
1151328776 17:73394607-73394629 GAGGGCTGGCAGAGGGACCAGGG + Intronic
1151562445 17:74877935-74877957 CAGGGGGCACAGAGAGAACAGGG - Exonic
1151925751 17:77194965-77194987 CAGAGCAAACAGAGAGAAAACGG - Intronic
1152084123 17:78207049-78207071 CCGGGCAGACAGACACAGCAAGG - Exonic
1152355400 17:79804382-79804404 CAGGGCGGCCGGAGAGAGCAAGG - Intergenic
1152403559 17:80083534-80083556 CAGGGCAGACACAGGGCCCGAGG + Intronic
1152905336 17:82967332-82967354 CAGGTCAGGCAGAGACACAATGG + Intronic
1153267892 18:3289012-3289034 CATGACAGACACATAGACCATGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153689497 18:7577796-7577818 GATGACAGACAGAGAGACGAGGG - Intronic
1154044819 18:10894816-10894838 CAAGGCAGAAAAAGAGGCCAAGG - Intronic
1154964884 18:21346812-21346834 CAGAGAAGAGAGAGAGAACAAGG - Intronic
1155499514 18:26472824-26472846 CAGGTGAAACAGAGAGACCTAGG - Intronic
1155571409 18:27197751-27197773 CAGGGGTGAGAGAGAGAACATGG + Intergenic
1156870497 18:41939802-41939824 CATGGAAGACACAGAGCCCAAGG + Intergenic
1157815681 18:50728130-50728152 CAGGCCCAACAGATAGACCAAGG - Intronic
1158416957 18:57257038-57257060 CAGGAGAGGCAGAGAGGCCATGG + Intergenic
1158812909 18:61058450-61058472 CAAGGCAGAAAGAGAGACCAAGG + Intergenic
1159416496 18:68155840-68155862 CAAGGCAGACAGAGAACCAAGGG + Intergenic
1159429361 18:68331548-68331570 CATGGCGGACAGATAAACCAAGG + Intergenic
1159654422 18:71014774-71014796 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1159892727 18:73967933-73967955 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1160019746 18:75171361-75171383 CAGGGGAGACTGAGCGGCCAGGG - Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160391954 18:78540611-78540633 CAGAGCAGAGAGAGGGGCCAGGG + Intergenic
1160521789 18:79512084-79512106 CATGGCGGACAGAGAGGCCCAGG + Intronic
1160600572 18:80009584-80009606 TAAGGCAGAGATAGAGACCAAGG + Intronic
1160700108 19:502025-502047 CTGGGCAGACGGGGAAACCAAGG - Intronic
1161355870 19:3819368-3819390 CAGTGCACACAGAGAGCCCCGGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161697668 19:5778613-5778635 CAGGGCAGGCACAGAGCCCCCGG + Exonic
1162221469 19:9180455-9180477 CAAGGCAGAAAAAGAAACCATGG - Intergenic
1162416393 19:10540615-10540637 CAGGGAAGAGAAGGAGACCAAGG + Intergenic
1163626363 19:18392126-18392148 CTGGGGGGACAGACAGACCAGGG + Intronic
1163747983 19:19059332-19059354 CAGGGGAGACGGGGACACCACGG - Intronic
1163770697 19:19189344-19189366 CAGGGGAAGCAGAGAGGCCAGGG - Intronic
1164180077 19:22810615-22810637 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
1164520215 19:28973319-28973341 GAGGGCAGAAGGAGAGACGAGGG - Intergenic
1165183409 19:33994007-33994029 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
1165484671 19:36088525-36088547 CAAGGCACACAGAGAGGACAGGG - Intronic
1166508810 19:43389910-43389932 CAGTGGAGACAGGGAGACCCGGG - Intergenic
1166800124 19:45451376-45451398 CAGGGGAGACAGACAGACAAGGG + Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167131593 19:47589853-47589875 GAGGGCAAGCAGGGAGACCAGGG - Intergenic
1167576629 19:50320797-50320819 GGGGTCAGACAGAGAGACAAAGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1168165354 19:54543383-54543405 CATGGCAAACACAGAGCCCACGG + Exonic
1168327413 19:55545322-55545344 AAGGACACACAGCGAGACCAAGG - Intronic
925628369 2:5864570-5864592 TAGAGCTGACAGAGAGAGCATGG + Intergenic
925901807 2:8514181-8514203 CATGGTAGCAAGAGAGACCAGGG + Intergenic
925970592 2:9104012-9104034 CTCAGTAGACAGAGAGACCAGGG - Intergenic
925990284 2:9249303-9249325 TGGGGCAGACAGACAGGCCACGG - Intronic
926800658 2:16657256-16657278 CAGGGCTGAAAGAGTGAGCATGG - Intronic
926926827 2:17995800-17995822 CAGGGCAGTCTCAGGGACCAAGG + Intronic
927137869 2:20110569-20110591 CAAGCCACACAGAGAGGCCACGG - Intergenic
927519293 2:23689441-23689463 CTGGGCAGACGGACAGTCCATGG - Intronic
927576433 2:24205474-24205496 CAGGGCAGAAAGAGCAAGCAGGG - Intronic
928601653 2:32909410-32909432 CAAGGCAAACAGCAAGACCAAGG - Intergenic
929510484 2:42562547-42562569 CAAGGCAGACCGGGAAACCAAGG - Intronic
929858061 2:45652057-45652079 CGGGGCAGACGGAGTGACCCCGG + Exonic
930061602 2:47294176-47294198 CATGCCACACAGAGAGACAAGGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930504013 2:52258994-52259016 AGGGGCTGGCAGAGAGACCAAGG + Intergenic
931961883 2:67491770-67491792 CAGGACAGGGAGAGAGACCTGGG + Intergenic
932166466 2:69512138-69512160 GAGGAGGGACAGAGAGACCACGG + Intronic
932449196 2:71798856-71798878 CAGGGGAGAAAAAGGGACCATGG + Intergenic
932698768 2:73978795-73978817 CAGCGCCCACAGAGAGACCCAGG - Intergenic
932870224 2:75390961-75390983 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
933069186 2:77836321-77836343 TAGGGCAGAGGGAGAGATCAAGG - Intergenic
933436590 2:82257411-82257433 AAAGGCACACAGAGAGACCCGGG - Intergenic
933563119 2:83913826-83913848 TAAGGCAGAGGGAGAGACCAAGG - Intergenic
934052871 2:88224974-88224996 CAGGGCAGTGAGGGAGGCCAAGG - Intergenic
934085901 2:88509291-88509313 CAGGTCAGACAGGGAGAGAACGG + Intergenic
934665679 2:96168316-96168338 GAGGGCAGAAAAAGAGATCAAGG - Intergenic
935214799 2:100967646-100967668 CAGGGCAGAAAGATGGACTACGG - Intronic
935434028 2:103008796-103008818 CAGTGCAAACAAAGAGACCAAGG + Intergenic
935889850 2:107664309-107664331 TACGGCAGAGAGAAAGACCAAGG - Intergenic
935959839 2:108413989-108414011 CAGGGCAAACAAGGAAACCAGGG + Intergenic
936022889 2:109008493-109008515 CAGGGCAGGGACAGAGACCTGGG + Intergenic
936075645 2:109399980-109400002 CAGGGCAGCCAGAGGGACTCTGG - Intronic
936736054 2:115445075-115445097 CAGGAAAGAGAGAGAGAGCAGGG - Intronic
936846065 2:116835016-116835038 CAGGGCAGACTGAGGGACTTGGG - Intergenic
936861930 2:117029465-117029487 CAGAGCACACACAGAGACCCAGG + Intergenic
937275808 2:120683362-120683384 CAGGGCAGGCCAAGAGCCCAAGG - Intergenic
937513837 2:122629798-122629820 GAGTGCATGCAGAGAGACCAAGG + Intergenic
937523237 2:122736615-122736637 TAGGGCAGAGAGAGAGACTGAGG - Intergenic
937714610 2:125017158-125017180 CCAGGCAGAAGGAGAGACCAAGG - Intergenic
938256388 2:129862898-129862920 CAGTGCAGAGAGAGAGAAGAGGG - Intergenic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
939091160 2:137781455-137781477 CAGGGCTGAGAGAGAGACTGGGG + Intergenic
939191366 2:138920317-138920339 CAAGGGAGAGAGAGAGAGCATGG - Intergenic
939559635 2:143717301-143717323 CATGCCAGCCAGAGAGGCCACGG - Intronic
939577170 2:143909557-143909579 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
940148436 2:150572960-150572982 CAGGGAAGACAGCAAGACAAAGG + Intergenic
940919997 2:159295650-159295672 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
943189096 2:184653449-184653471 TAAGGCAGAAAAAGAGACCAAGG + Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943633579 2:190280930-190280952 TAAGGCAGAGTGAGAGACCAAGG - Intronic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
944914515 2:204344406-204344428 TAAGGCAGAGAGAGAGACAAGGG - Intergenic
945450154 2:209984975-209984997 CAGAGAAGACAGAGAGACAGAGG - Intronic
946375869 2:219308756-219308778 CTGGGCAGAGAGAGAGGCCAGGG - Intronic
946748475 2:222869337-222869359 CAGGGGAGCCAGAGAGATGAAGG - Intronic
947415274 2:229888943-229888965 AAGGGAAGGCAGAGAGACAAAGG + Intronic
947527682 2:230889229-230889251 CAGGAGAGAGAGAGAGAGCACGG + Intergenic
947718148 2:232352070-232352092 CGGGGCAGAGACAGAGACGAGGG - Intergenic
947971949 2:234332155-234332177 CGGGACAGACAGAGAGACATGGG - Intergenic
947971982 2:234332385-234332407 CAGGACAGACAGAGAGACATGGG - Intergenic
947971999 2:234332495-234332517 CAGGACAGACAGAGAAACACGGG - Intergenic
947972032 2:234332704-234332726 CAGGACAGATAGAGAGACATGGG - Intergenic
947972057 2:234332836-234332858 CGGGACAGACAGAGAAACCCAGG - Intergenic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948791831 2:240383246-240383268 CAGGGCAGCCAGAGAGTGCGAGG + Intergenic
948928980 2:241118775-241118797 CAGGGCAGACAGCCTGGCCAAGG + Intronic
1169404840 20:5314756-5314778 CTGGGCAGACAAAGAGGCCCTGG - Intergenic
1170019242 20:11817351-11817373 GAAGGCAGAGAAAGAGACCAAGG + Intergenic
1170129470 20:13003063-13003085 CAGGAAAGAGAGAGAGAGCAGGG + Intergenic
1170139903 20:13115299-13115321 CAGGGCACACACAGAGTCCTAGG - Intronic
1170497477 20:16940159-16940181 GAAGGCAGAAAAAGAGACCAAGG - Intergenic
1172810080 20:37641201-37641223 CAGGGGAGACACAGAGAAAAGGG - Intergenic
1172831957 20:37843448-37843470 CAGGCCAGAGTGAGAGACTAGGG + Intronic
1172883039 20:38213873-38213895 CAGGGAAGAGAGGGAAACCAGGG - Intronic
1173049944 20:39549787-39549809 CAGGGCAGGGTGAGACACCAAGG - Intergenic
1173825684 20:46046296-46046318 CAGGGGAGACAGAGATGCAAAGG - Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1175127961 20:56766541-56766563 CAGGGGAGAGAGAGAGAGAAAGG - Intergenic
1175146383 20:56899581-56899603 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1175242145 20:57557530-57557552 CACAACAGATAGAGAGACCATGG - Intergenic
1175507970 20:59499793-59499815 AAGGGAAGACAGAGAGAACAAGG + Intergenic
1175631006 20:60536396-60536418 GAAGGCAGAAGGAGAGACCAAGG + Intergenic
1175683124 20:61005860-61005882 CTGGGGAGACAAAGAGACAAGGG + Intergenic
1175850250 20:62086764-62086786 CTGGGCACACAGAGAGACTGGGG + Intergenic
1175929057 20:62485043-62485065 CAGGGCAGTAAGAAAGTCCACGG + Intergenic
1176060798 20:63171993-63172015 CAGGGGAGACACAGAGACCGGGG + Intergenic
1176060804 20:63172034-63172056 CAGGGAAGAGACAGCGACCAGGG + Intergenic
1176060808 20:63172052-63172074 CAGGGGAGAGACAGAGACCAGGG + Intergenic
1176060811 20:63172070-63172092 CAGGGAAGAGACAGTGACCAGGG + Intergenic
1176060815 20:63172088-63172110 CAGGGGAGAGACAGAGACCAGGG + Intergenic
1176060820 20:63172106-63172128 CAGGGGAGAGACAGAGACCGGGG + Intergenic
1176060864 20:63172385-63172407 CAGGGGAGACACAGAGACAGGGG + Intergenic
1176060867 20:63172402-63172424 CAGGGGAGAGACAGAGACCGGGG + Intergenic
1176060870 20:63172419-63172441 CCGGGGAGAGACAGAGACCAGGG + Intergenic
1176060874 20:63172437-63172459 CAGGGGAGAGACAGTGACCAGGG + Intergenic
1176060909 20:63172609-63172631 CAGGAAAGAGACAGAGACCAGGG + Intergenic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176140883 20:63544566-63544588 CAGGGCTAACGGAGAGCCCACGG - Intronic
1176893640 21:14349893-14349915 CGGGACAGACAGAAAGAACAGGG - Intergenic
1177014054 21:15761874-15761896 TAGGGCAGAGAGAGACATCAAGG - Intronic
1177530843 21:22355849-22355871 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1177905598 21:26967787-26967809 CTGGACAGCCAGAGAGCCCAGGG + Intergenic
1178000137 21:28152676-28152698 CAGGAGAGACAGAGAGACTGAGG - Intergenic
1178911143 21:36674646-36674668 CAGAGGAGAGAGAGAGACCATGG + Intergenic
1179012322 21:37565276-37565298 CAGGGCAGACAGATATGGCAGGG - Intergenic
1179254822 21:39706515-39706537 TAAGGCAGAGGGAGAGACCAAGG + Intergenic
1179488921 21:41727919-41727941 CAGCGCAGACAGGAAGAGCACGG + Intergenic
1179575057 21:42302753-42302775 CAGTGCAGACACACAGACGATGG - Intergenic
1179585813 21:42373497-42373519 CAGGGCACACTGAGAAACCCTGG - Intronic
1179712674 21:43272379-43272401 CAGGGCCAGGAGAGAGACCAGGG + Intergenic
1180194599 21:46185035-46185057 CAGGGCAGAGAGAGAAGCGAGGG + Intergenic
1180615314 22:17122205-17122227 CACAGTAGACAGAGACACCAAGG + Intronic
1180742502 22:18063717-18063739 CAGGGCAGAAAGGGATTCCAGGG + Intergenic
1181564159 22:23723961-23723983 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1181728575 22:24828215-24828237 CAGGCCATACAGAGAGGCCTAGG + Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182761600 22:32726707-32726729 TAATGCAGACAAAGAGACCAGGG - Intronic
1183365459 22:37404386-37404408 CAGGATGGAGAGAGAGACCAAGG + Intronic
1183429808 22:37758737-37758759 CAGTGCAGGCAGGGAGGCCACGG - Intronic
1184247940 22:43245109-43245131 TAGGCCAGCCAGGGAGACCAGGG - Intronic
1184401841 22:44278998-44279020 CAGGGCAGGCACTGAGACTAGGG + Intronic
1185039167 22:48495646-48495668 CAGCCCAGACAGAGAGAGGACGG - Intronic
949174389 3:1041307-1041329 CAAGGCAGGCAGAGAGTACAAGG - Intergenic
949592007 3:5504432-5504454 TAAGGCAGAGGGAGAGACCAAGG - Intergenic
949676455 3:6459855-6459877 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
950423198 3:12910637-12910659 CAGGGCATACAGGGAGTGCAGGG + Intronic
950581473 3:13865127-13865149 CTGGGCAGTCAGTGAGTCCAAGG + Intronic
951154970 3:19340883-19340905 TAAGGCAGAGGGAGAGACCAAGG + Intronic
951250727 3:20391480-20391502 CAGAGCAGAAAAAGAGACCAAGG + Intergenic
952454134 3:33457125-33457147 TAAGGCAGAAAAAGAGACCAGGG + Intergenic
952750022 3:36817478-36817500 CAGGGCTGTCAGGGAGACCTCGG - Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953406448 3:42662266-42662288 CAAGGCAGACAGTGAGCCCCTGG + Intronic
953995186 3:47513928-47513950 CTGGGCAGAGAGCGAGGCCAAGG - Intergenic
954349981 3:50035178-50035200 TAAGGCAGAAGGAGAGACCAAGG + Intronic
954579675 3:51696491-51696513 GAGGGAAGACAGGGTGACCATGG - Intronic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
957275082 3:78080729-78080751 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
957279708 3:78134717-78134739 CAGGGCAGCAGGAGAGACAATGG - Intergenic
958159079 3:89793242-89793264 CAAGGCAAACAGAGAGATCCAGG - Intergenic
958474789 3:94567738-94567760 CAGAGCAGAGAGAGAGAAAAGGG - Intergenic
959442009 3:106388605-106388627 CTGGGTATTCAGAGAGACCATGG - Intergenic
959555052 3:107707263-107707285 CAGCTCAGACACACAGACCAAGG - Intronic
959649531 3:108738111-108738133 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
960557661 3:119046729-119046751 AAGGGCAGCCAGAGAGAGAAAGG + Intronic
960632557 3:119747201-119747223 CAGGGCAGAAATAGAGAAGATGG + Exonic
961356463 3:126343039-126343061 CAGGGCAGACAGAGCCAGAAGGG - Exonic
961481006 3:127180773-127180795 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
961652490 3:128423869-128423891 CAGGGCAGAGAGAATGGCCATGG - Intergenic
961786464 3:129350036-129350058 CAGGGCTGACAGGCAGAGCAGGG - Intergenic
961863597 3:129937692-129937714 GAGTGCAGATAGGGAGACCAGGG - Intergenic
962027151 3:131560335-131560357 CAGGGATGATAGAGAGAGCATGG - Intronic
962059799 3:131913682-131913704 TAAGGCAGAAGGAGAGACCAAGG - Intronic
962298055 3:134211887-134211909 CAGCACTGACAGAGAGGCCATGG + Intronic
962507279 3:136060544-136060566 CAGGGGAGAGACAGAGAACAAGG - Intronic
963684834 3:148420234-148420256 TAAGGCAGAGGGAGAGACCAAGG + Intergenic
964690193 3:159441767-159441789 CAGAGCAGAGGGAGAGATCAAGG + Intronic
964739395 3:159949716-159949738 CAGGGCACTCAGACAGACAAAGG + Intergenic
964790983 3:160453027-160453049 CAGGCCACACTGAGACACCACGG - Intronic
965000246 3:162943837-162943859 TACAGCAGAAAGAGAGACCAAGG - Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
967120867 3:186381713-186381735 CAGGGCAGAGTGAGAGACCAAGG - Intergenic
967643041 3:191890508-191890530 AAGGGCAGACAGAGAAACAGTGG + Intergenic
968447401 4:658610-658632 CCGTGCAGACAGAGGGACCTCGG - Intronic
968449402 4:668142-668164 CAGTGCAGGGAGAGAGGCCACGG + Intronic
968481423 4:834763-834785 GATGGGACACAGAGAGACCAGGG + Intergenic
968813341 4:2809784-2809806 CAGGGCAGGCAGAGGGCCAAGGG - Intronic
969350817 4:6596961-6596983 CCGGGCAGGCAGCGAGCCCAGGG - Intronic
969433294 4:7168632-7168654 CTGGGCAGCCACAGAGAGCAAGG - Intergenic
969723161 4:8904464-8904486 CAGGAGAGACAGAGAGAAAAGGG + Intergenic
969922420 4:10552798-10552820 CACTGCATAAAGAGAGACCAGGG - Intronic
969947030 4:10793833-10793855 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
970047958 4:11877151-11877173 CAGGGGAGAGAGAGAGCTCAGGG + Intergenic
970087096 4:12362034-12362056 CAGGAGAGACAGAGAGCACAGGG + Intergenic
971279365 4:25229853-25229875 TAAGGCAGAAAAAGAGACCAAGG + Intronic
971969715 4:33605713-33605735 CAGGACAGAGAGAGAGACAAAGG + Intergenic
972323956 4:37997871-37997893 CTGTGCAGACAGTGAAACCAGGG - Intronic
973637089 4:52870403-52870425 CAGGGCAGACATAGCGGGCATGG - Intergenic
974204382 4:58681756-58681778 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
974664232 4:64937274-64937296 TATGGCAGAAAAAGAGACCAAGG + Intergenic
974876571 4:67710172-67710194 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
976008546 4:80459547-80459569 TAAGGCAGAAGGAGAGACCAAGG - Intronic
976201977 4:82587957-82587979 TAGGACACACAGAGACACCAGGG - Intergenic
976329348 4:83811488-83811510 CAGGGCAGCCCGACTGACCAAGG - Intergenic
976818269 4:89175201-89175223 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
976947298 4:90786143-90786165 CTGGGCAGATAGAAAGACGATGG + Intronic
977096500 4:92751065-92751087 CAAAGCAAACATAGAGACCATGG + Intronic
977212704 4:94239535-94239557 CAGGGCAGCTAGAGAGACTCCGG - Intronic
977523102 4:98110705-98110727 TAAGGCAGAGTGAGAGACCAAGG - Intronic
979065208 4:116122889-116122911 TAAGGCAGAAAGAGGGACCAAGG + Intergenic
979358357 4:119732217-119732239 AAAGGCAGAGGGAGAGACCAAGG - Intergenic
979397244 4:120203262-120203284 TAAGGCAGAATGAGAGACCAAGG + Intergenic
980005869 4:127541950-127541972 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
980810718 4:137875706-137875728 CAAGGCAGAGTGAGAGAACAAGG + Intergenic
981011809 4:139933028-139933050 CACAGCAGACAGACAGGCCAAGG + Intronic
981928846 4:150168493-150168515 TAAGGCAGAAGGAGAGACCAAGG - Intronic
982096317 4:151926673-151926695 CAATGCAGACAGAAAGAGCAGGG - Intergenic
982103747 4:151993609-151993631 TAAGGCAGAATGAGAGACCAAGG + Intergenic
982511906 4:156293008-156293030 CAGGGCAGGGAGAAAGACAAAGG - Intergenic
983525163 4:168753373-168753395 CGGGGGAGAGAGAGAGACAAAGG - Intronic
983713032 4:170743509-170743531 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
983884725 4:172967551-172967573 AAGTGCAGAAAGTGAGACCATGG - Intronic
984084481 4:175292004-175292026 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
985574899 5:669483-669505 CAGGACAGACAGAGGCCCCAAGG - Intronic
985626971 5:994133-994155 GAGAGAGGACAGAGAGACCAGGG + Intergenic
985779681 5:1863748-1863770 GAAGGCAGAAGGAGAGACCAAGG + Intergenic
986127789 5:4899432-4899454 CAGGGAAGTCAGAAGGACCAGGG - Intergenic
986275393 5:6270759-6270781 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
986408690 5:7453537-7453559 GAAGGCAGAAGGAGAGACCAAGG + Intronic
986424476 5:7616903-7616925 TAGGACACACAGAGACACCAGGG + Intronic
986476785 5:8142670-8142692 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987129065 5:14843618-14843640 CAGGGCAGACTAACAGACCCTGG + Intronic
988136376 5:27176316-27176338 CAGGAGAGACAGAGAGCCCAGGG + Intergenic
988580012 5:32460632-32460654 CAGGACAGAGAGAAAGAGCAGGG + Intergenic
988846366 5:35131937-35131959 CAGGACAGACACAGAAACCCTGG + Intronic
989820823 5:45794260-45794282 TAAGGCAGAAGGAGAGACCAAGG + Intergenic
990318686 5:54608831-54608853 GAGGGCAGGGAGAGACACCAAGG - Intergenic
993050002 5:82915530-82915552 CAGGTCAGAGCAAGAGACCAGGG - Intergenic
993251121 5:85524350-85524372 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
994061093 5:95477258-95477280 CAAGGCAGACTGACAGAGCAAGG + Intronic
994117718 5:96079614-96079636 AAGGGGAGACAGAGAGAACTAGG - Intergenic
994754015 5:103772814-103772836 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
994897363 5:105722581-105722603 CAGAGCAGTGAGAGAGAACATGG + Intergenic
995576183 5:113537450-113537472 CAGGGGAGACTGAGAAAGCATGG - Intronic
996998132 5:129724492-129724514 TAAGGCAGAAGGAGAGACCAAGG + Intronic
997880180 5:137582325-137582347 CATGCCAGGCAGAGAGAACAGGG - Intronic
998869578 5:146538651-146538673 CAGGGCAGACATAGAAAGAAGGG + Intergenic
999521271 5:152352899-152352921 CAGGACAGAGATAGAGACCCAGG + Intergenic
999666478 5:153917737-153917759 CAGGAGAGACAGAGAGCCAAGGG - Intergenic
1000328938 5:160192640-160192662 CAGGGCAGCCACAGAGACACAGG + Intronic
1001232932 5:170005259-170005281 CAGGGCAGACAGAAAAATCTGGG + Intronic
1001451688 5:171830535-171830557 TAGGGCACAGAGAGAGACAATGG + Intergenic
1001920831 5:175598000-175598022 CAGGGGAGCAGGAGAGACCAAGG + Intergenic
1002334057 5:178466003-178466025 GAGGGGAGACTGAGGGACCAGGG - Intronic
1002417865 5:179130199-179130221 GGGGGCAGCCAGAGAGACAAGGG - Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1002564253 5:180100990-180101012 CAGGGCAGGGTGAGGGACCATGG + Exonic
1002565194 5:180109043-180109065 CAGGGCAGAGAGGGAGAAAAGGG - Intronic
1002775479 6:324544-324566 CAGGGCAGAAAGAACGTCCACGG - Intronic
1002941281 6:1718481-1718503 CATGGCAGAGATGGAGACCATGG - Intronic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003236312 6:4298102-4298124 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
1003351263 6:5319664-5319686 TAAGGCAGAGTGAGAGACCAAGG - Intronic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003510971 6:6780052-6780074 GAGGGAAGACACAGAGAACAAGG + Intergenic
1003852176 6:10236439-10236461 CAGGGAAGACAGAGATCCCTGGG + Intergenic
1004252536 6:14034008-14034030 CAGGGCAGACAGAGACAATATGG - Intergenic
1004901734 6:20200715-20200737 CAGAGCAGACAGTGTCACCATGG + Intronic
1005094964 6:22104452-22104474 CTGGGCAGACAGTGAGTCCTGGG - Intergenic
1005437652 6:25832264-25832286 CTGGGCAGGGAGAGAGACTAAGG - Intergenic
1005794428 6:29343582-29343604 GAGGGCAGAGAGAGAGGCAAGGG - Intergenic
1006029142 6:31166315-31166337 AAGGACAGAAAGAGAGACCCTGG + Intronic
1006057313 6:31395006-31395028 CAGGGAAGCCAGAGCCACCATGG - Intergenic
1006280525 6:33049582-33049604 CAGGCCACACACAGACACCAAGG - Intergenic
1006869391 6:37236947-37236969 GAGCCCACACAGAGAGACCATGG - Intronic
1007378344 6:41471076-41471098 GAGGGAAGAGAGAGAGGCCAAGG + Intergenic
1007823896 6:44583615-44583637 CAGGGCTTATAGAGAGACAACGG - Intergenic
1008020198 6:46567748-46567770 CAGGGCACACACACAGACTAGGG + Intronic
1008033516 6:46722466-46722488 TAGGGCAGTCAGAGAGAGAAGGG + Intronic
1008291626 6:49722712-49722734 TAAGGCAGAAAGAGAGAACAAGG - Intergenic
1008713224 6:54255137-54255159 CAGGGAAGACAGAGAGACAGGGG - Intronic
1010012203 6:71061210-71061232 CGTGGCAGACAGAGGCACCAAGG - Intergenic
1010121554 6:72381210-72381232 CAGGCCTCACAGAGACACCAGGG - Intronic
1010344355 6:74794435-74794457 CAGGGAACCCAGAGAGTCCACGG - Intergenic
1010366751 6:75060097-75060119 CAAGACAGAGAGAGAGATCAAGG + Intergenic
1011164217 6:84427733-84427755 TAGGGCTGACAGGGACACCAGGG + Intergenic
1012529117 6:100213232-100213254 AAGGGCAGACATAGAAAACAGGG + Intergenic
1012865303 6:104611467-104611489 CAGGACAGAGAGAAAGTCCAGGG + Intergenic
1013010338 6:106114832-106114854 CAGAGGACACACAGAGACCAAGG + Intergenic
1013299165 6:108786970-108786992 CAGGGCAGGCAGCAAGTCCAGGG + Intergenic
1016847299 6:148581118-148581140 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017754260 6:157516442-157516464 CATGGCAGACACACAGAGCACGG - Intronic
1017779833 6:157707297-157707319 CAAGGCAGAAAAAGAGACCGAGG + Intronic
1018455852 6:163951601-163951623 TAGGGCAGAGTGAGAGACCAAGG + Intergenic
1019270979 7:149116-149138 CAGGGCTGCCCGAGAGACCCAGG + Intergenic
1019593665 7:1848337-1848359 CAGGGCAGACGGACAGCCCGGGG + Exonic
1019729956 7:2624142-2624164 CAGGCCAGACAGAGACACAGTGG + Intergenic
1019749319 7:2718842-2718864 CAGGGGAGTCACAGAAACCACGG + Intronic
1020699084 7:11455116-11455138 CAAGGCAGAGAGAGAAAGCAAGG - Intronic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021313006 7:19116399-19116421 GAGGGGAGACAGAGACACCCAGG - Intronic
1022789763 7:33675230-33675252 AAGGGCAGACAGAAAAACCAGGG - Intergenic
1023189975 7:37570032-37570054 TAAGGCAGAGTGAGAGACCAAGG + Intergenic
1023684310 7:42719067-42719089 TAAGGCAGAAGGAGAGACCATGG + Intergenic
1024283467 7:47737820-47737842 CAGGGCAGACAGTGGCAACAGGG + Intronic
1025148669 7:56527246-56527268 CATGGGAGACAGAGAGCTCAGGG + Intergenic
1026250959 7:68670294-68670316 CACAGCAGACAGAGTGACCCTGG - Intergenic
1027293141 7:76736457-76736479 CAGGTCATAGAGAGAAACCATGG + Intergenic
1027546248 7:79530842-79530864 AAGACCAGACAGAGAGAACATGG - Intergenic
1029608760 7:101615408-101615430 CAGGGCAGACGCAGGGTCCAGGG + Intronic
1030134605 7:106234815-106234837 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1030257743 7:107529785-107529807 TAAGGCAGAAAAAGAGACCAAGG - Intronic
1030959966 7:115906174-115906196 CAGGGCAGAAAGAGAGAGTGGGG + Intergenic
1031989564 7:128188873-128188895 GAAGGCAGACAGCGAGGCCAGGG + Intergenic
1032660752 7:133981248-133981270 CATGGCAGTCAGAGTGGCCATGG + Intronic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033643799 7:143286163-143286185 CAATGCAGACTGAGAGCCCAGGG + Exonic
1034557717 7:151860535-151860557 CAAGACAGAGAGAGAGAGCACGG + Intronic
1034568722 7:151937181-151937203 AAGGACAGACACACAGACCAGGG + Intergenic
1034731428 7:153390765-153390787 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
1034732112 7:153397001-153397023 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
1035311330 7:157970858-157970880 CTGGGCAGAGAGGGGGACCAGGG - Intronic
1035409066 7:158623992-158624014 GAAGGCAGACAGAGACACGAAGG + Intergenic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1036124470 8:6050190-6050212 CAGGGCAGCAAGAGAGATAATGG + Intergenic
1037020158 8:13960157-13960179 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1039235177 8:35495159-35495181 CGGGGCAAAGAGAGAGACCGAGG + Intronic
1039429677 8:37516049-37516071 CATGGGAGACAGAGAAACAAGGG + Intergenic
1039500060 8:38009563-38009585 TAAGGTAGAAAGAGAGACCAAGG - Intergenic
1039729095 8:40255443-40255465 GAAGGCAGAAGGAGAGACCAAGG + Intergenic
1040698568 8:50033676-50033698 TAGGACACACAGAGATACCAGGG - Intronic
1041375104 8:57204617-57204639 CAAGGCAGAGGGAGAGACCGAGG + Intergenic
1042223312 8:66494483-66494505 CAAGGCTGACAATGAGACCAGGG - Intronic
1043227797 8:77754158-77754180 CAGGGCAGAATGAGAGTCCTGGG - Intergenic
1044362905 8:91309628-91309650 TAAGGCAGAAGGAGAGACCAAGG + Intronic
1044520351 8:93192381-93192403 GAGTGCAGACAGAGACATCATGG + Intergenic
1044789676 8:95834673-95834695 CAGAGAAGACAGAGAGAATATGG + Intergenic
1045919950 8:107518052-107518074 TAAGGCAGAGTGAGAGACCAAGG - Intergenic
1047152943 8:122285003-122285025 TAAGGCAGAAAGAGAGACCAAGG - Intergenic
1047626907 8:126665794-126665816 TAGAGCCGTCAGAGAGACCAGGG + Intergenic
1048639214 8:136334093-136334115 TAAGGCAGAATGAGAGACCAAGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1048991716 8:139764381-139764403 CAGTCCAGAAAGAAAGACCAGGG + Intronic
1049376172 8:142290177-142290199 CTGGGGCGACAGAGAGGCCAAGG + Intronic
1049445535 8:142628937-142628959 CAGCCCAGAAAGAGAGACCAGGG - Intergenic
1049496727 8:142939106-142939128 CAGGTCAGCCACAGTGACCAAGG + Intergenic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050073190 9:1838051-1838073 TAGGGCGAACAGAGAGAACACGG - Intergenic
1051080547 9:13288754-13288776 TACGGCAGAAAAAGAGACCAAGG - Intergenic
1051458052 9:17283581-17283603 CAGGGAAGACAAAGAAACAAAGG - Intronic
1051499230 9:17758975-17758997 CAGGGAAGACCCAGAGACCCTGG - Intronic
1051658420 9:19404481-19404503 CAGGGCAGACTCAGAGCCCCTGG + Intergenic
1051997316 9:23233435-23233457 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1052160759 9:25255682-25255704 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
1052610797 9:30771062-30771084 GAGGGCAGTCAGGGAGAACATGG - Intergenic
1053435481 9:38070860-38070882 GAGGGCAGACAGCAAGGCCAGGG + Intergenic
1053518115 9:38749195-38749217 CAGAGCACACAGGGAGAACATGG - Intergenic
1053519597 9:38764348-38764370 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
1053546903 9:39032671-39032693 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1053811222 9:41854324-41854346 CAGGAGAGAGAGAGAGAACAGGG - Intergenic
1054619372 9:67333115-67333137 CAGGAGAGAGAGAGAGAACAGGG + Intergenic
1055356843 9:75446469-75446491 CAGGGAAGAGAGAGACACAAAGG + Intergenic
1056143708 9:83708387-83708409 CAGAGTAGACAGAGAGGCAAGGG - Intergenic
1056751289 9:89353307-89353329 TAGGGGAGACAGAGACACCCAGG - Intronic
1057517554 9:95734955-95734977 CTGGGCAGCCACAGAGAACAGGG - Intergenic
1057765146 9:97910101-97910123 CAGGGCAGAGACACAGCCCATGG - Exonic
1057857192 9:98610712-98610734 CAGGGCCTCCAGAGAGACCCTGG + Intronic
1057887376 9:98840172-98840194 CAGAGCAGACCCAGAGGCCAGGG - Intronic
1057904076 9:98971132-98971154 CAGTGTAGACACATAGACCAGGG - Intronic
1058099479 9:100903115-100903137 CAGAGCTGACAGAGAGACCCAGG + Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058349988 9:104010035-104010057 CAGGAGAGAGAGAGAAACCAGGG - Intergenic
1058703421 9:107619749-107619771 CTGGGCAGACAGAGGAACCAGGG + Intergenic
1058816490 9:108687593-108687615 CATGGCAGAAACAGATACCATGG - Intergenic
1058924410 9:109648115-109648137 CAGGACAGAGAGAAAGAGCAGGG - Intronic
1059062752 9:111050821-111050843 CTGGGGAGACAGAAAGACCCTGG + Intergenic
1059115979 9:111600112-111600134 CAGGGCTGACGGGGAGCCCAGGG - Intergenic
1059645802 9:116265794-116265816 CTGGGCAGACAAAGAGAGAATGG - Intronic
1059653295 9:116334834-116334856 CAGGGGAGACAGAGGGGCCGAGG - Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060762959 9:126271438-126271460 GGGAGCAGACAGAGAGGCCAGGG + Intergenic
1060926169 9:127456917-127456939 CAGGGCTGGCAGAGGGGCCAGGG - Intronic
1061200670 9:129136697-129136719 CAGGGCAGACAGTGACAGCTTGG + Intronic
1061295375 9:129674146-129674168 CAGGGCAGCGAGAGCAACCAGGG - Intronic
1062161037 9:135080018-135080040 CAGGGCAGACGAGAAGACCAGGG + Intronic
1062246355 9:135569022-135569044 CAGGGCCTGCAGAGAGACCCTGG + Intergenic
1062333292 9:136053879-136053901 CAGGGCTGACACAGACAGCAAGG + Intronic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1062606006 9:137349164-137349186 CCAGGCACAGAGAGAGACCAGGG - Exonic
1185757505 X:2663396-2663418 TAAGGCAGAGAGAGAGACCCGGG - Intergenic
1185785677 X:2889117-2889139 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1187613600 X:20969397-20969419 TAAGGCAGAAGGAGAGACCAAGG - Intergenic
1187690005 X:21856840-21856862 CGAGGCCGACAGAGAGGCCAGGG - Exonic
1188752180 X:33918628-33918650 CAAGGCAGAAAAAGAGACCAAGG + Intergenic
1189986025 X:46553922-46553944 GAAGGCAGAGTGAGAGACCAAGG + Intergenic
1190173049 X:48127012-48127034 CAGGGCATACACACAGACTAGGG + Intergenic
1190188714 X:48257603-48257625 CATGGCTAACTGAGAGACCATGG - Intronic
1190544494 X:51511394-51511416 CAGAGAAGAGAGAGAGACCAAGG - Intergenic
1190657601 X:52625359-52625381 CATGGCTAACTGAGAGACCATGG - Intergenic
1190665277 X:52691092-52691114 CAGGGCATACACACAGACTAGGG - Intronic
1190674145 X:52767327-52767349 CAGGGCATACACACAGACTAGGG + Intronic
1191914695 X:66188753-66188775 CTATGCAGTCAGAGAGACCAAGG - Intronic
1193066690 X:77267797-77267819 AAAGGCAGAGTGAGAGACCAAGG - Intergenic
1193251954 X:79301475-79301497 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1193518725 X:82503026-82503048 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1193730829 X:85100847-85100869 AAGGACAGACATATAGACCAAGG + Intronic
1193934588 X:87601143-87601165 TAAGGCAGAGAGAGAGACTAAGG + Intronic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194088661 X:89559715-89559737 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1194555164 X:95349500-95349522 CAGGCAAGTCAGAGAAACCAAGG + Intergenic
1195220434 X:102741138-102741160 TAAGGCAGAAAAAGAGACCAAGG + Intronic
1196188601 X:112771601-112771623 CAGTGAAGGCAGAGAGGCCAAGG + Intergenic
1196814255 X:119652631-119652653 CAGGGCAGAAAGACAGCTCAGGG + Intronic
1198429792 X:136553852-136553874 AAGGGTAGTCAGAGAGACCTTGG + Intronic
1198642164 X:138768157-138768179 CAGGCCTGAAAGAGTGACCATGG - Intronic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200257637 X:154592962-154592984 GAAGGCAGCCAGACAGACCAAGG + Intergenic
1200281967 X:154784741-154784763 CAGGCCAGAGGGAGAGGCCAGGG - Intronic
1200441338 Y:3215768-3215790 TAAGGCAGAAAAAGAGACCAAGG + Intergenic
1200988693 Y:9328294-9328316 CAGGGAAGACATAGGGACCTTGG - Intergenic
1201244279 Y:11987294-11987316 CAGGCCAGACGGAGAGACGCTGG + Intergenic
1201288174 Y:12396704-12396726 TAAGGCAGAAAAAGAGACCAAGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202013816 Y:20379046-20379068 CAGAGCAGACACTGAGGCCAAGG - Intergenic