ID: 1143774415

View in Genome Browser
Species Human (GRCh38)
Location 17:9188580-9188602
Sequence TGGAGCATAGGCAGCAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143774410_1143774415 -7 Left 1143774410 17:9188564-9188586 CCTGGAGACAAGGCACTGGAGCA 0: 1
1: 0
2: 3
3: 22
4: 242
Right 1143774415 17:9188580-9188602 TGGAGCATAGGCAGCAATGGGGG 0: 1
1: 0
2: 0
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143774415 Original CRISPR TGGAGCATAGGCAGCAATGG GGG Intronic
900298013 1:1961983-1962005 TGGAGCCTGGGCAGCAAGGGGGG + Intronic
902396325 1:16134039-16134061 TGGAGCTTGGGCAGCAAAAGCGG - Intronic
902397336 1:16139468-16139490 TGGTGCATACCCAGCACTGGGGG - Intronic
903085595 1:20854998-20855020 TGGGGAAAAGGCAGCAGTGGTGG - Exonic
903288538 1:22292269-22292291 TGGCTCAAAGGCAGAAATGGAGG - Intergenic
909224733 1:73005059-73005081 TGGAAGAAAGGTAGCAATGGAGG + Intergenic
909941569 1:81617160-81617182 TGGAGCTCAGGCAGCAATGCCGG - Intronic
910508398 1:87976789-87976811 GGTAGCATTGGCAGAAATGGAGG - Intergenic
911361075 1:96877112-96877134 TGGAGCAGAGGCAGTTGTGGTGG - Intergenic
911792156 1:102031246-102031268 TGGAGCTTAGGCAGTGATGCTGG + Intergenic
916606436 1:166347136-166347158 TGATGCAGAGGCAGAAATGGTGG - Intergenic
918368791 1:183837943-183837965 TGGAGCTCAGGCAGTAATGCTGG + Intronic
920246094 1:204588816-204588838 TGGACCAGATGCAGGAATGGGGG - Intergenic
920366748 1:205451992-205452014 TGGAGCACAGGCAGAACCGGAGG + Intronic
923147939 1:231210750-231210772 TGGGGCTTAGGCTGGAATGGTGG + Intronic
924941359 1:248814266-248814288 TGGAATATGGGAAGCAATGGAGG + Intronic
1067737371 10:48868471-48868493 TGCAGCACAGTCAGCAATGTTGG - Intronic
1068735220 10:60406563-60406585 TGAAGCATAGGCAGTAATGCTGG + Intronic
1069967774 10:72135680-72135702 TGGAGGACAGACAGCAGTGGAGG + Intronic
1071431239 10:85608720-85608742 TGGAGCATACCCAGCAAGGGGGG + Intronic
1071531594 10:86393570-86393592 TGGAGCTGTGGCAGCAAGGGTGG + Intergenic
1072483048 10:95828159-95828181 TGGAGCTCAGGCAGTAATGTGGG - Intronic
1078570920 11:12457513-12457535 AGGAACTGAGGCAGCAATGGAGG - Intronic
1079352488 11:19703546-19703568 TGGAGCTGAGGCGGCATTGGGGG + Intronic
1079515160 11:21258847-21258869 TGAAGCATAGGCAGAGATAGAGG + Intronic
1080280659 11:30553067-30553089 TGGAACACAGGCAGCAGAGGTGG - Intronic
1081872778 11:46391055-46391077 TGGAGGCTGGGCAGCAAAGGGGG + Intergenic
1082179382 11:49100124-49100146 TGGAGGGCAGGCAGGAATGGTGG - Intergenic
1082862739 11:57871355-57871377 GGGAGGAGAGGCAGCAAGGGCGG - Intergenic
1083277581 11:61605943-61605965 TGGAGCACAGGCAGACATAGGGG - Intergenic
1084006549 11:66326389-66326411 TGGGGCAGAGGCCGCAGTGGGGG + Intergenic
1084615526 11:70233241-70233263 TGGAGCACAGGCAGCTATATTGG + Intergenic
1085311881 11:75521762-75521784 TGGAGCAGAGGCAGGGATGGCGG + Intronic
1086685902 11:89732795-89732817 TGGAGGGCAGGCAGGAATGGTGG + Intergenic
1091100572 11:132869073-132869095 TGGAGCAAAAGCACCACTGGGGG + Intronic
1092198375 12:6563845-6563867 TGGAGCATAGGAAGCCACTGGGG - Intronic
1095406164 12:41869672-41869694 TGGAGAAAAGGCAGGAATGCAGG - Intergenic
1098227981 12:68344481-68344503 TGGAGCAGAGGAAGCTTTGGGGG + Intergenic
1099093625 12:78343679-78343701 TTCAGGACAGGCAGCAATGGAGG + Intergenic
1099335215 12:81347638-81347660 TGTAACAGAGGCAGTAATGGAGG + Exonic
1099660300 12:85549641-85549663 AGGCACTTAGGCAGCAATGGTGG - Intergenic
1100092801 12:90992240-90992262 TGGAGCTCAGGCAGTAATGCTGG + Intronic
1100626378 12:96337501-96337523 TCCATCATAGGCAGAAATGGAGG + Intronic
1103708776 12:122895762-122895784 TGGTGCTTAGGCAGGAATAGGGG - Intronic
1104013665 12:124948912-124948934 TGGACCAGAGGCAGCCAGGGTGG - Intronic
1104071020 12:125345407-125345429 TGGACCTTAGTCAGCACTGGTGG - Intronic
1104168939 12:126261116-126261138 AGGAGAGGAGGCAGCAATGGGGG + Intergenic
1104832654 12:131764447-131764469 TGGAGCAAAGGAAGCTATTGAGG - Exonic
1105032023 12:132890586-132890608 TGGAGAAGAGGGAGGAATGGAGG - Intronic
1105605791 13:21925677-21925699 AGGAGGATAGGCAGGAATGGAGG - Intergenic
1106418984 13:29569895-29569917 TGGAGCCTGGCCAGCCATGGAGG - Intronic
1107876617 13:44796410-44796432 TGAAGCATGGGTAGAAATGGAGG - Intergenic
1110046691 13:70841436-70841458 GGGGGCAAAGGCAGCAGTGGTGG - Intergenic
1110979707 13:81880707-81880729 AGGACCAGATGCAGCAATGGAGG + Intergenic
1112327212 13:98449881-98449903 GGGAGCATAGGGAACAGTGGGGG - Intronic
1114040441 14:18673386-18673408 AGGAGCACAGGCTGCAATGTGGG - Intergenic
1114799066 14:25751260-25751282 TGGATGATAGGCAGTAATTGTGG + Intergenic
1115053959 14:29099625-29099647 TGGAGAATAGGGAGGAAGGGTGG - Intergenic
1119563106 14:75606527-75606549 TGTACCCTAGGCAGGAATGGTGG - Intronic
1122407563 14:101509320-101509342 TGGAGCACAGGAAGCTCTGGTGG + Intergenic
1124598396 15:31110697-31110719 TGGAGGATGGGGAGCAATAGAGG - Intronic
1128864788 15:71106313-71106335 TGGAGAATACTCAGGAATGGTGG - Intronic
1128878786 15:71224219-71224241 TGGAGCACAGGCTGCAAATGAGG + Intronic
1129369035 15:75076527-75076549 TGGTCCATGGGCAGCCATGGTGG + Intronic
1129485114 15:75863234-75863256 TGGAGCAAAGCCAACAAAGGTGG - Intronic
1129537744 15:76327924-76327946 GGGAGCAAAGGCAGGAATGCAGG - Intergenic
1129851556 15:78796731-78796753 GGGAGCAGCGGCAGCAGTGGCGG - Exonic
1132699462 16:1216146-1216168 GGGTGCATAGGCAGCCGTGGGGG - Intronic
1135189904 16:20346300-20346322 TGGAGCACAGGCTGGAATGTGGG - Exonic
1135679268 16:24442915-24442937 TGGAGCTTAGACAGTAATGCTGG + Intergenic
1138845261 16:60557333-60557355 TGCAGAAGAGACAGCAATGGTGG - Intergenic
1139403944 16:66703583-66703605 TTGAGCAGAGGCAACAGTGGAGG + Intergenic
1139592578 16:67941751-67941773 TGTGGCTTATGCAGCAATGGGGG + Intronic
1142523107 17:518874-518896 TGAAGCAGAGGCAGCAGTGGAGG - Exonic
1142800630 17:2343132-2343154 TGGAGAATAGGGAGAAAAGGAGG + Intronic
1143774415 17:9188580-9188602 TGGAGCATAGGCAGCAATGGGGG + Intronic
1143993618 17:10988177-10988199 TGGAGGAAGGGCAGCAATGTGGG - Intergenic
1144714513 17:17424638-17424660 TGGTCCATGGGCAGCCATGGGGG - Intergenic
1144847553 17:18227815-18227837 TGAAGCGTGGGCAGCAGTGGTGG + Intronic
1144940628 17:18937528-18937550 TGGAGCTCAGGCAGTAATGATGG + Intergenic
1147975731 17:44247235-44247257 TGGAGCTTGGGCAGCAGGGGAGG - Intergenic
1149563770 17:57627714-57627736 TGGAGGAAAGGAAGCAAGGGCGG - Intronic
1150593929 17:66586927-66586949 TGGAGCAAAGGCAGAGTTGGTGG + Intronic
1151923832 17:77178770-77178792 TGGAGCTCAGGCAGTAATGCTGG + Intronic
1152512965 17:80802893-80802915 TAGAGAAGAGGCATCAATGGGGG - Intronic
1157728807 18:49986279-49986301 TGGAGCATAGGATGCAAGGTGGG - Intronic
1158420378 18:57287791-57287813 GGGAGAATAGGCAGCAAAGCAGG - Intergenic
1161512475 19:4679318-4679340 TGGAGCCTTGGCAGCAACGTGGG - Intronic
1163705003 19:18807444-18807466 AGGCGCACAGGCAGCTATGGAGG + Intergenic
1165350648 19:35273302-35273324 TGGAGCCCAGACAGCAAAGGAGG - Intronic
1166170776 19:41026350-41026372 TGGAGCATAGGGAGGGAAGGAGG + Intergenic
1166736225 19:45086730-45086752 AACAGCATAGGCAGCAATTGGGG + Intronic
1167024428 19:46904887-46904909 CGGAGCATAGGCACATATGGTGG - Intergenic
1168381135 19:55924506-55924528 TTCAGCATAGGCAGCAAATGTGG + Intronic
926291674 2:11536108-11536130 TGGAGCATACACAGGAGTGGTGG + Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
928755199 2:34516370-34516392 AGGAGCAAAGGTAGCAATGGAGG - Intergenic
929590501 2:43142751-43142773 TGAGGCATGGGCAGCCATGGAGG - Intergenic
930476245 2:51886287-51886309 TGGTGCATAGGAAGCACTTGTGG - Intergenic
930840440 2:55839381-55839403 TGTTGCTTAGGCAGGAATGGGGG + Intergenic
931558031 2:63526559-63526581 TGGAGGATAGTCAGCTATGGAGG - Intronic
931743074 2:65266430-65266452 TGGAGCAGAGTGAGCAAGGGAGG + Intronic
932606784 2:73170593-73170615 TGCAGCCTGGGCAGGAATGGAGG + Intergenic
933925644 2:87089849-87089871 TGCAGCCTGGGCAGGAATGGAGG - Intergenic
934735702 2:96688847-96688869 AGGCCCAGAGGCAGCAATGGTGG - Intergenic
934853044 2:97713294-97713316 CGGAGGGTAGGCAGCAGTGGTGG - Intergenic
935191274 2:100780587-100780609 TGGAACACAGGCAGAAATGCAGG - Intergenic
935849144 2:107199596-107199618 TCCAGCACAGGAAGCAATGGGGG - Intergenic
937198288 2:120179882-120179904 TGGAGGATGGGCAGCAGTGGAGG + Intergenic
937371513 2:121301031-121301053 TGGAGCTCAGGCAGCCATGTTGG + Intergenic
937951878 2:127394493-127394515 TGGGGCATACACAGGAATGGTGG + Intergenic
938269749 2:129959150-129959172 AGGAGCACAGGCTGCAATGTGGG + Intergenic
939925859 2:148172717-148172739 TGGTCCATGGGCAGCCATGGCGG - Intronic
941368769 2:164638307-164638329 TGGAGCATTAACAGAAATGGAGG + Intergenic
942657169 2:178226064-178226086 TGGGCCATAAGCAGCAAGGGAGG + Intronic
943643169 2:190381042-190381064 TGGAGCATGTGCATGAATGGAGG + Intergenic
946330422 2:219005901-219005923 TGGAGCATGGGCAGCAGCAGTGG - Intronic
1170367197 20:15610772-15610794 TGGAGAACAGGCTGCAGTGGAGG - Intronic
1171536756 20:25899140-25899162 TGGTCCATGGGCAGCCATGGGGG - Intergenic
1172972580 20:38884146-38884168 TGGAGCACCTGGAGCAATGGAGG - Intronic
1174505391 20:51014499-51014521 TGAAGCAGAGGCTGCGATGGGGG + Intronic
1175832395 20:61973251-61973273 GGGAGCAGAGGCAGCAAGAGTGG + Intronic
1181046047 22:20214785-20214807 TGGAGGAAAGGCAGAAAGGGCGG + Intergenic
1183216317 22:36482228-36482250 TGGAGCAGGGGTAGCAATGGAGG + Intergenic
1185275803 22:49949805-49949827 TGGAGCCCGGGCAGCAATGCCGG - Intergenic
949143983 3:672932-672954 TGGAGCAAAGGGAGCAAAGCTGG + Intergenic
949848714 3:8399108-8399130 TGTAGCAGAGGTAGCAATGAGGG + Intergenic
949870333 3:8582726-8582748 TGGAGCACAGTGAGCAAGGGAGG - Intergenic
950526334 3:13526398-13526420 TGAAGAAAAGGCAGCCATGGGGG + Intergenic
950867341 3:16199703-16199725 TGGAGCACAGGCTGCACTGCGGG + Intronic
951652159 3:24962576-24962598 TGGAGCTCAGGCAGTAATGCTGG - Intergenic
952053545 3:29415723-29415745 TGCAGCATAGGCAGGACTTGGGG + Intronic
953421489 3:42756845-42756867 GGGAGCACAGGGAGCAATGAGGG - Intronic
955520643 3:59772362-59772384 AGGAACATATGCAGCAATGCAGG + Intronic
958012688 3:87900471-87900493 TGGAGGATCTGAAGCAATGGAGG + Intergenic
960777471 3:121274566-121274588 TGGTGCACAGTCAGCAATGCTGG + Intronic
962182524 3:133223443-133223465 TGGAGCATGGGTTGCAAGGGTGG + Intronic
962933510 3:140058958-140058980 TGGAGGATAAGAAGCTATGGAGG + Intronic
963804900 3:149713757-149713779 AGGGGCATGGGCAGTAATGGAGG + Intronic
966207056 3:177415649-177415671 TGGAGAATGGGTAGCAATGGTGG + Intergenic
967098593 3:186197328-186197350 TGGAGCCCAGGCATCAAAGGAGG - Intronic
967106249 3:186257060-186257082 TGGAGCACAGGCAGCATTTTTGG + Intronic
969126162 4:4949772-4949794 TGTAGCATTGGCTGCAGTGGAGG + Intergenic
969138850 4:5051838-5051860 TGTAGCAGCGGCAGCAACGGCGG + Exonic
969263346 4:6047379-6047401 AGGAGCCTAGGCAGCCACGGAGG + Intronic
969937447 4:10696328-10696350 TGGAGCAGATGCAGCAAAGGGGG - Intergenic
970854668 4:20638034-20638056 TGGGGCTCAGGCAGCAATGATGG - Intergenic
971743884 4:30553628-30553650 TGGAGCTCAGGCAGTAATGCTGG - Intergenic
978737872 4:112104756-112104778 TGGAGCTTAGTGAGCAGTGGGGG + Intergenic
980505610 4:133716435-133716457 TGAAGCAAAGGCAGAACTGGAGG + Intergenic
980560597 4:134468560-134468582 TTGAGCATAGGCAGGACTTGTGG - Intergenic
981678446 4:147366226-147366248 TAGCGCATAGGCAGGAATAGTGG + Intergenic
981932210 4:150202541-150202563 TTGAGCAGAGGCAGAAATTGTGG - Intronic
982537139 4:156620829-156620851 TGGAGGACAGGTAACAATGGGGG + Intergenic
982696738 4:158610686-158610708 GTGAGCATAGGGAGCAATAGTGG + Intronic
982761579 4:159290652-159290674 TGGAGCATTGGCAGAAGTGAGGG + Intronic
984259876 4:177432193-177432215 AGAAGAATAGGGAGCAATGGTGG - Intronic
984934936 4:184881825-184881847 TGGAGCAGAGGGAGCAAGTGGGG + Intergenic
984955064 4:185036988-185037010 AGGTGCAGAGGCAGCAATGTGGG - Intergenic
985041639 4:185896981-185897003 TGCAGCATCTGCAGCAATTGCGG + Intronic
986021406 5:3807498-3807520 TGGAGCTCAGGCAGTAATGCGGG - Intergenic
986843332 5:11723660-11723682 TGGAGCAGTGCCAGCCATGGAGG - Intronic
987247267 5:16061248-16061270 AGGAGCAGTGGCAGCCATGGAGG - Intergenic
990272752 5:54162165-54162187 TGGCGAATAGGCAGCAGAGGAGG - Intronic
991316183 5:65309428-65309450 TGGAGCTCAGGCAGTAATGTGGG + Intronic
992146809 5:73858897-73858919 TGGAGCAGAGGGAGTAAGGGAGG - Intronic
995248922 5:109967009-109967031 TGGAGCAGTGGCAGCAGAGGGGG - Intergenic
996320635 5:122211407-122211429 TGGAGGATTTTCAGCAATGGAGG + Intergenic
996369842 5:122741572-122741594 TGGAGCAGTGGGAGCATTGGTGG - Intergenic
996679493 5:126215784-126215806 TACAGGATAGGCAGGAATGGAGG + Intergenic
997447711 5:133953526-133953548 TGGAACATCGGCAGCAGTGCCGG + Intergenic
998463189 5:142324345-142324367 TCGAGCATAGGCCGCTACGGCGG + Intronic
998563029 5:143189251-143189273 AGGAGCTTAGGCAGAAATGGGGG + Intronic
999662797 5:153883168-153883190 TGGCGCATAGGGAACAAGGGAGG - Intergenic
999726447 5:154442277-154442299 TAGAGCAGAGGCACTAATGGTGG - Intergenic
999816177 5:155178661-155178683 TGGAACATAGGAAGCAGGGGAGG + Intergenic
1001065894 5:168534878-168534900 TGCAGCAGAGGCAGCGAGGGTGG + Intergenic
1003133685 6:3416884-3416906 GGGAGCAGAGGCAGGATTGGAGG + Intronic
1003395147 6:5746643-5746665 TGGAGAATAGGCAGAGGTGGGGG + Intronic
1007241825 6:40432019-40432041 GGCAGCATTGGCAGCAATGCAGG + Exonic
1007700997 6:43766514-43766536 TGGAGCAGAGGAAGCCAAGGAGG - Intergenic
1008692671 6:53998619-53998641 TGGATCATAGGCACAAAGGGTGG + Intronic
1009785152 6:68327044-68327066 TGGAGCCTGGGCAGCAACAGAGG + Intergenic
1012555203 6:100503225-100503247 TGGAGCATATGCACCAATCCTGG + Intergenic
1012866666 6:104626115-104626137 AGGGGCATAGTCAGCAATGATGG - Intergenic
1015713533 6:136167024-136167046 TGGAGCAAAGGCCTCAAGGGAGG - Intronic
1020271513 7:6599401-6599423 TGGGGCAGTGACAGCAATGGTGG - Intronic
1020682199 7:11251134-11251156 TGGAGTATCGGCAGCAAAAGAGG + Intergenic
1024649955 7:51394886-51394908 TTGGGTATATGCAGCAATGGGGG - Intergenic
1026586093 7:71657473-71657495 AGGAGCCTAGGCAGCCAGGGAGG - Intronic
1028512743 7:91643139-91643161 TGGAGCATAGGAAAAACTGGCGG - Intergenic
1031075740 7:117210521-117210543 AGGAGAATAGGCTGTAATGGTGG + Intronic
1031921685 7:127606769-127606791 TGGGGAATAGGCAGCACTGTTGG - Intergenic
1031948762 7:127869275-127869297 TGGAGCAGAGGGAGCAAAGGTGG + Intronic
1032022875 7:128419751-128419773 TGGAGCATAGTCAGAAAGGGTGG + Intergenic
1033870190 7:145744739-145744761 TGGAGCAAAGGGAGCAGTGCAGG + Intergenic
1034172503 7:149073091-149073113 TGAAACATTGGCAGAAATGGGGG - Intronic
1035042030 7:155936001-155936023 GGGACCCTAGGCAGCAAGGGAGG + Intergenic
1035713744 8:1738380-1738402 TGGACTGTAGGCAGCAAAGGAGG + Intergenic
1035898245 8:3428997-3429019 TGGAGCAGAGGATGGAATGGTGG + Intronic
1038363080 8:26902367-26902389 TGGAGCTTAGGAAGCCATGCAGG - Intergenic
1039723916 8:40194630-40194652 TGGAGGATATGCAGAGATGGAGG - Intergenic
1041710440 8:60889494-60889516 TGGAGTAAAGGCTACAATGGTGG - Intergenic
1044253330 8:90030194-90030216 TGGAGCTCAGGCAGTAATGCTGG + Intronic
1044287679 8:90428052-90428074 TGGAACAGAGTCAGCAAGGGTGG + Intergenic
1047816828 8:128473808-128473830 TGGGGAACGGGCAGCAATGGTGG - Intergenic
1051788601 9:20773965-20773987 TGGAGTTTAGGCAGTAATGCTGG - Intronic
1055001711 9:71458088-71458110 TGGAACAGGGGCAGCAATTGTGG + Intergenic
1055650593 9:78403285-78403307 TGCAGCAGAGGCAGCAGTGATGG + Intergenic
1060535952 9:124388352-124388374 TGGAGCATAGCCTGCATTTGTGG - Intronic
1061893161 9:133633357-133633379 TGGAGCAGAGGCAGCAGGGGTGG + Intergenic
1061938695 9:133872568-133872590 TGGAGCAGAGGCAGGAAGGCTGG + Intronic
1062537313 9:137026726-137026748 GGGAGCAGAGGCTGGAATGGTGG - Intronic
1186699003 X:12069390-12069412 TAGACTATAGGCAGCAAGGGTGG + Intergenic
1187953711 X:24495294-24495316 TGGAGCAAATGAAGCAAAGGAGG - Intronic
1190247733 X:48701549-48701571 TGGAGCATGGGCAGAAGTGATGG - Intronic
1190515832 X:51222918-51222940 TGCAGCATAAGCAGCAGAGGTGG + Intergenic
1190930982 X:54949677-54949699 TGGAGCATGGGGATCAGTGGAGG - Intronic
1195618140 X:106929061-106929083 TTGAGCAAAGGCAGAAATGGGGG + Exonic
1197017675 X:121647218-121647240 TGGAGCAGGGGCAGACATGGTGG + Intergenic
1197442645 X:126510543-126510565 TGGAGCTCAGGCAGAAATGCTGG - Intergenic
1197925983 X:131647294-131647316 TGGAGCATAAACAGCAGTGTGGG + Intergenic
1198598035 X:138258387-138258409 TGGAGGAAAGGAAGCAAAGGTGG - Intergenic
1200760293 Y:7031914-7031936 TGGAGCATGGGGAGAAACGGAGG + Intronic
1201943987 Y:19490939-19490961 TGGAGCTTAGACAGTAATGCTGG + Intergenic