ID: 1143775357

View in Genome Browser
Species Human (GRCh38)
Location 17:9195518-9195540
Sequence CCTTGCTGGCAGAGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 365}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143775352_1143775357 2 Left 1143775352 17:9195493-9195515 CCATGTCACACAGCTGTCACAGC 0: 1
1: 0
2: 2
3: 29
4: 224
Right 1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG 0: 1
1: 0
2: 1
3: 37
4: 365
1143775348_1143775357 16 Left 1143775348 17:9195479-9195501 CCTTGGACCCACCTCCATGTCAC 0: 1
1: 0
2: 0
3: 25
4: 217
Right 1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG 0: 1
1: 0
2: 1
3: 37
4: 365
1143775349_1143775357 9 Left 1143775349 17:9195486-9195508 CCCACCTCCATGTCACACAGCTG 0: 1
1: 1
2: 1
3: 30
4: 339
Right 1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG 0: 1
1: 0
2: 1
3: 37
4: 365
1143775351_1143775357 5 Left 1143775351 17:9195490-9195512 CCTCCATGTCACACAGCTGTCAC 0: 1
1: 0
2: 4
3: 21
4: 251
Right 1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG 0: 1
1: 0
2: 1
3: 37
4: 365
1143775350_1143775357 8 Left 1143775350 17:9195487-9195509 CCACCTCCATGTCACACAGCTGT 0: 1
1: 1
2: 4
3: 31
4: 358
Right 1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG 0: 1
1: 0
2: 1
3: 37
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143775357 Original CRISPR CCTTGCTGGCAGAGGCTGGC AGG Intronic
900326958 1:2113062-2113084 CACTGCTGGCCGAGGCTGGCCGG + Intronic
900338509 1:2176675-2176697 CCACGCTGGCCGAGGCTGCCTGG - Intronic
900626343 1:3610417-3610439 CCTTGCTGGCAGGGGTGGGTGGG - Intronic
902330029 1:15726800-15726822 CTTTGCTGGCAGGGGCGGGGTGG - Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903189869 1:21650572-21650594 TCTTGCTGGCAGAGTTGGGCTGG - Intronic
903297038 1:22350558-22350580 CCCTGCTGGCAGAGCCGGCCAGG + Intergenic
903326977 1:22574479-22574501 GCTGGCTGCCAGGGGCTGGCAGG - Intronic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
904670629 1:32162413-32162435 ACTTGCTGGCAGATGCTTGCTGG + Exonic
905702182 1:40025802-40025824 CCTGGCTGACTGAGGCTGGAAGG - Intergenic
906061745 1:42953488-42953510 CCATGATGGCGGAGGCTGGGAGG - Intronic
911389426 1:97220323-97220345 TCTTGCTGGCAGAGACTCTCTGG - Intronic
912008686 1:104933516-104933538 CCGTGCTGGCAGAGGGCGGGAGG - Intergenic
912491255 1:110064008-110064030 GCTGGCTGGGAAAGGCTGGCTGG - Intronic
912491259 1:110064022-110064044 CCTGGCTGGGAAAGGCTGGCTGG - Intronic
912520256 1:110240249-110240271 CCTTGGTGTCAGTGGCAGGCTGG - Intronic
915085374 1:153384624-153384646 CCTTCCTGGCAGAGTATGTCAGG + Intergenic
915635076 1:157180750-157180772 CCCTGCTGGCAGACACTGGGTGG - Intergenic
916418033 1:164610717-164610739 CCTTGCTGTGATGGGCTGGCAGG + Intronic
916745575 1:167682512-167682534 CCCTGCTGGAAGTGGCTGGGAGG + Intronic
917980911 1:180268483-180268505 ACTTGCTGTCAGAAGCTGGCTGG + Intronic
919483942 1:198122888-198122910 CTTTGCTGGCAGAGGGTAGGAGG + Intergenic
919790273 1:201285990-201286012 CCTTGCTGGAAGAGGCGGTTTGG + Intronic
922502863 1:226109998-226110020 ACTCGCGGGCAGGGGCTGGCTGG + Intergenic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
924237564 1:242012029-242012051 GCTTTCTGGCAGTGGATGGCGGG - Intergenic
924496424 1:244594789-244594811 CCATGCTGGCAGAGGCCTGCAGG - Intronic
1062837325 10:644283-644305 AGTTTCTGCCAGAGGCTGGCGGG - Intronic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1063556548 10:7085744-7085766 CCATGCAGGCACAGGCAGGCAGG - Intergenic
1065773555 10:29099653-29099675 GCATGCAGGCAGAAGCTGGCTGG + Intergenic
1066370235 10:34814302-34814324 CCCTGCTGGTAGGGGCCGGCAGG - Intronic
1066463487 10:35633154-35633176 CCTGGCTGGCAGAGGCCTGAGGG - Intergenic
1067156167 10:43782980-43783002 CCTTGCTGGCTGAGTCTGTGGGG - Intergenic
1067582201 10:47452854-47452876 CCTTGGGTGCAGGGGCTGGCGGG - Intergenic
1067716736 10:48696138-48696160 GCCTGCTGGCAGAGAATGGCAGG - Intronic
1070814658 10:79315154-79315176 GCTTGCTGGTGGAGGCTTGCTGG - Exonic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1074419179 10:113294009-113294031 CCTCTCTGGCAGGGCCTGGCTGG - Intergenic
1074775838 10:116767518-116767540 CCTTGCTGGCTGAGGCTAGTGGG - Intergenic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1076436960 10:130453127-130453149 CAAAGCTTGCAGAGGCTGGCTGG - Intergenic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1077359538 11:2134621-2134643 CCTTACTGGCAGAGGCCGCACGG - Intronic
1078263746 11:9737195-9737217 CCTTCCTGGGAGGGGCAGGCTGG - Intronic
1078762914 11:14265889-14265911 CTCTGCAGGAAGAGGCTGGCTGG - Exonic
1079556002 11:21759663-21759685 GCTTGCTGGCAGAGGTGGGTTGG + Intergenic
1082766463 11:57172141-57172163 CCTCTCTGGCTGAGGCAGGCTGG - Intergenic
1082806351 11:57454128-57454150 CCTTGGGGGCAGAGGTTGCCCGG - Intergenic
1084599524 11:70136582-70136604 ACTTGCTCACAGAGGCTTGCAGG - Intronic
1084604832 11:70166411-70166433 CCATGCTGGCTGAGGATGGGGGG + Intronic
1084776965 11:71383686-71383708 CCTTGGTGGAAGAGGCTCCCAGG + Intergenic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1085863118 11:80257669-80257691 CCTCACTGCCAGGGGCTGGCGGG - Intergenic
1088606754 11:111540604-111540626 CCTCGCTGGAGGAGGCTGTCGGG + Intronic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1088897448 11:114089132-114089154 CTTTGCTGGGAGTGGCGGGCAGG + Intronic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1090640483 11:128725431-128725453 CCTGGCTGCCTGAGGCTGACAGG - Intronic
1091122277 11:133066115-133066137 CTTGGCAGGCAGAGGCGGGCAGG - Intronic
1091569137 12:1669369-1669391 CTCTGCTGGCTGAGGCTGGAGGG - Intergenic
1092578988 12:9819360-9819382 CCTTGCTACCAGTGGCTGGCTGG - Intergenic
1095421499 12:42028838-42028860 AGTTGCTGGGGGAGGCTGGCAGG + Intergenic
1096120900 12:49089012-49089034 CCTTGGTGGCAGGGCCTGGATGG - Intergenic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1096258627 12:50077573-50077595 CGTTGATGGAAGAGGATGGCTGG - Intronic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1098403098 12:70094551-70094573 CCTTAGTGGCAGAGACTGGTAGG - Intergenic
1100387637 12:94118569-94118591 AGTAGCTGGCAGAGGTTGGCTGG + Intergenic
1102624654 12:114225324-114225346 CCATGCTGGCACAGGGAGGCAGG - Intergenic
1103081446 12:118027096-118027118 CCTTGCTGGCAAAGGATGACTGG + Intronic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1105500348 13:20966396-20966418 CATTGCTGGCACAGGTTGGGTGG - Intergenic
1106555480 13:30804753-30804775 CCCATGTGGCAGAGGCTGGCTGG + Intergenic
1106669300 13:31887983-31888005 CTATGCTGACAGAGGCAGGCAGG - Intergenic
1108077718 13:46698963-46698985 GCTTGCTGCCAGGGGCTGCCGGG - Intronic
1109197842 13:59398340-59398362 CCTTTTTTCCAGAGGCTGGCTGG - Intergenic
1111300529 13:86343532-86343554 CCTTGCTGGCAGACTCTCCCAGG - Intergenic
1111354571 13:87080738-87080760 CCGCGGTGGGAGAGGCTGGCCGG - Intergenic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113468294 13:110527204-110527226 CCTTGCTGGGCGATGCTGCCTGG + Intronic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1117280051 14:54230860-54230882 GATTGCTGGCAGAGGTTTGCAGG + Intergenic
1118273072 14:64361544-64361566 CCTTGCTTTCAGAGTTTGGCTGG + Intergenic
1118779136 14:68994650-68994672 GCTTGCTGGCTGAGGCTGGAAGG - Intergenic
1119420243 14:74503849-74503871 ACTGGCTGGCAGGGGCTGGGTGG + Intronic
1120481920 14:85060615-85060637 CCATGCTGGCAGAGACTGAATGG - Intergenic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1121741758 14:96257692-96257714 CTATGGTGACAGAGGCTGGCAGG - Intronic
1121862189 14:97329033-97329055 GTTTTCTGGCAGAGTCTGGCTGG - Intergenic
1122575642 14:102739814-102739836 ACATGAAGGCAGAGGCTGGCAGG + Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122901769 14:104784983-104785005 CGGTGGTGGCAGCGGCTGGCAGG + Intronic
1122935659 14:104954888-104954910 CCCTGCTGGCTGAGCCTGGGAGG - Intronic
1122996471 14:105267972-105267994 CCATGGAGGCTGAGGCTGGCAGG + Intronic
1123105688 14:105840133-105840155 ACGTGCTGGCCCAGGCTGGCTGG - Intergenic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124237671 15:28004010-28004032 CCTGGGTGGCAGCGGCTGGACGG - Intronic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1125533169 15:40427167-40427189 CCTTGCTGGCAGAAGAAGGAAGG + Intronic
1125784190 15:42301092-42301114 TCTTGCTGGCAGCTGCAGGCCGG - Intronic
1127342968 15:58066081-58066103 CGGAGCTGGCAGGGGCTGGCGGG + Exonic
1128326107 15:66725302-66725324 CCTTTCTGGCAGGGGGTGCCAGG - Intronic
1128371726 15:67044599-67044621 GCTTGAGGCCAGAGGCTGGCAGG - Intergenic
1128547898 15:68579719-68579741 CATGGGCGGCAGAGGCTGGCAGG - Intronic
1129694579 15:77733368-77733390 TCTTGCTGGCTGTGGCTGCCTGG + Intronic
1129760979 15:78129211-78129233 CCGGGCTGGCAATGGCTGGCTGG + Intronic
1130665110 15:85862981-85863003 CTTTGCTGGCAGAGAACGGCTGG + Intergenic
1131256042 15:90863110-90863132 CCAGGCTGACTGAGGCTGGCAGG - Intergenic
1132661397 16:1063054-1063076 CCCACATGGCAGAGGCTGGCGGG - Intergenic
1132827726 16:1913461-1913483 CCTGGCTGGCAGGTGCTGCCCGG - Intronic
1132896592 16:2232242-2232264 CCCTGCTGGCGGGGGCTGCCCGG - Exonic
1133308502 16:4827112-4827134 CCTTGATGGCGGAGGCAGGCAGG - Intronic
1133697134 16:8275472-8275494 CCTTTCTGGTAGAGGCCAGCCGG - Intergenic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1134443190 16:14311499-14311521 CCATGCGGGCAGGGGCTGTCTGG - Intergenic
1135087776 16:19488553-19488575 CCTTGTTGGGAGGGGCTTGCTGG - Intronic
1136024356 16:27460454-27460476 ACCTGCTGGCTGAGGCTGGGCGG + Intronic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1137575442 16:49596909-49596931 CCTTGCTGGAACAGAATGGCTGG - Intronic
1137599229 16:49744608-49744630 CCTTGCTGTCACTGGCTGGGGGG - Intronic
1138342964 16:56302724-56302746 CCTAGCAGCCAGGGGCTGGCGGG - Intronic
1139346454 16:66306898-66306920 CCCTGCTGGCCAAGGCAGGCAGG + Intergenic
1139381047 16:66531171-66531193 CCTGGCTGGCTGAGGTTTGCAGG + Intronic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139964416 16:70737562-70737584 ACTTCCTGCCAGGGGCTGGCAGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1141217156 16:82035359-82035381 TCTAGCGGGCAAAGGCTGGCTGG - Exonic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1141815178 16:86404791-86404813 CATTGCTGTGAGAGGCTGCCTGG + Intergenic
1142174147 16:88637237-88637259 CCTTGATCGGTGAGGCTGGCTGG - Intergenic
1142324279 16:89404178-89404200 CCATGCTGCCTGAGGCTGGTGGG - Intronic
1142903874 17:3029671-3029693 CCTTCCTGGAAGCTGCTGGCTGG - Intronic
1143090917 17:4448721-4448743 CCATGCTGGGGGAGGCAGGCAGG + Intronic
1143300868 17:5909852-5909874 ACTTTCTGGGAGTGGCTGGCTGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144636384 17:16911723-16911745 TGGTGCTGGCAGAGGCTGTCTGG + Intergenic
1144776819 17:17788942-17788964 CCTTGGTGACAGTGGGTGGCTGG + Intronic
1144780729 17:17807223-17807245 CCTGGCTGGCAGAGTCACGCTGG - Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1146937882 17:36823937-36823959 CCTCTCTGGCTGAGGCTGGCAGG - Intergenic
1147218648 17:38915302-38915324 CGTAGTGGGCAGAGGCTGGCTGG + Intronic
1147332196 17:39705688-39705710 GATTGCTGGGAGAGGCTGGTAGG - Intronic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148214948 17:45829416-45829438 GGTTGCTGGGAGAGGGTGGCAGG + Intronic
1148443783 17:47725731-47725753 CCCTGCGGGGAGGGGCTGGCTGG - Intergenic
1148746978 17:49924023-49924045 CCTCGCTGGAAGAGGCAGCCTGG + Intergenic
1148844124 17:50518751-50518773 CCTTGCTGCCAGATGGAGGCCGG - Intronic
1148853283 17:50565066-50565088 CCATCCTGGCTGAGGCAGGCAGG - Intronic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1151493183 17:74444509-74444531 CCCGGCTGGCAGAGGCTGTGGGG + Intronic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1151721867 17:75861489-75861511 CCCTCTTGGCAGAGCCTGGCAGG + Intergenic
1151767030 17:76137937-76137959 CCTGGCGGGCAAAGGCTGGGTGG + Exonic
1151852824 17:76701125-76701147 GGTTGCTGGAAGAGCCTGGCAGG + Intronic
1151986663 17:77548256-77548278 CCTTGCAGGCAGAGGCCTGGCGG - Intergenic
1152230828 17:79113214-79113236 CCTTCCTCCCAGAGGCTGCCCGG - Intronic
1152272497 17:79333152-79333174 CCTCCCTGGTAAAGGCTGGCAGG - Intronic
1152785723 17:82246975-82246997 TGGTGCTGGCAGAGTCTGGCAGG + Intronic
1153070367 18:1098331-1098353 CCTCACTGCCCGAGGCTGGCGGG - Intergenic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1155464452 18:26120094-26120116 CCCTGTTGCCAGTGGCTGGCTGG - Intergenic
1156460252 18:37317746-37317768 GATTGCTGGCTGAGGCTGACAGG - Intronic
1156525712 18:37765585-37765607 CCTAGGTGGGAGAGGCAGGCTGG - Intergenic
1158885538 18:61823676-61823698 CCCAGGTGGCAGAGGCAGGCAGG + Intronic
1158938564 18:62386089-62386111 CCATGCTGGCAGAGGCACTCAGG + Exonic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1161175846 19:2841777-2841799 CCTTGGGGCCAGAGGCGGGCGGG - Intronic
1161724001 19:5918118-5918140 CCTTTCGGGGAGAGGCCGGCAGG - Intronic
1162458932 19:10802980-10803002 CCTTCCTGCCTGAGGCAGGCCGG + Intronic
1162796875 19:13091678-13091700 CCCTGCTGGCAGAGGCGGGAGGG + Intronic
1163640846 19:18461193-18461215 CGTGCCTGGCAGAGCCTGGCAGG - Intronic
1163834965 19:19567631-19567653 GCTTGCTGCCATAGGCTGCCTGG + Intronic
1164450733 19:28361990-28362012 CCTTGCTGGTAGAGTTTTGCTGG + Intergenic
1164934195 19:32198420-32198442 CCTGGCTGGCAGTGGCTGCAAGG - Intergenic
1164962195 19:32443158-32443180 CCCTGCTGACACATGCTGGCTGG - Intronic
1165345791 19:35248360-35248382 CCTGGCTGGGAGAGGCTTGTTGG - Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1166322679 19:42028392-42028414 CCCTATTGGCAGAGCCTGGCAGG - Intronic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1168241429 19:55091060-55091082 CCCACCTGGCTGAGGCTGGCGGG + Exonic
924960931 2:33849-33871 CCGTGCAGGCAGAGGCAGGAAGG - Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
927141850 2:20136262-20136284 CCCTGCAGGCTGAGGCGGGCAGG + Intergenic
927205729 2:20609168-20609190 CCTTGGGGGCAGAGGCCGCCAGG + Intronic
927385607 2:22530324-22530346 ACTTGCTGGCAGAGGCTATGAGG - Intergenic
927922314 2:26982499-26982521 CCTTCCTGGTAGGGACTGGCAGG - Intronic
928484693 2:31718162-31718184 CACTGCTGCCAGTGGCTGGCTGG - Intergenic
929313632 2:40452361-40452383 GCTCGCCGGCAGAGGCTGGGAGG - Intronic
931344228 2:61431557-61431579 TTTAGCTAGCAGAGGCTGGCCGG + Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
932046219 2:68352730-68352752 TCTTGCTCCCAGTGGCTGGCTGG + Intergenic
932340485 2:70960165-70960187 CCAAGCAGGCAGGGGCTGGCAGG + Intronic
933844074 2:86311246-86311268 CCATGCGGGCAGAACCTGGCAGG - Intronic
934766503 2:96882958-96882980 CCTTGCTGGCAGCGGCCGCAGGG - Intronic
934951775 2:98580552-98580574 CCCTGCCAGGAGAGGCTGGCAGG - Intronic
935713295 2:105917929-105917951 CCTTGCTGGGTGACACTGGCAGG + Intergenic
935788896 2:106572793-106572815 CCTTGTTGGTATAGGCTGTCTGG + Intergenic
936058546 2:109279772-109279794 CCTCGCTGACAGAGCCAGGCCGG + Intronic
937885249 2:126895078-126895100 CCTGGCTGTCAGAGTCTGGGTGG - Intergenic
942965887 2:181891975-181891997 CCTTGCTGTCAGCGCCCGGCCGG - Exonic
943166081 2:184327902-184327924 CCTTACTGCCTGGGGCTGGCGGG + Intergenic
943520631 2:188944679-188944701 CCTCACTGCCCGAGGCTGGCGGG + Intergenic
943575225 2:189624341-189624363 CCATGCTGGCAGGGCCTGACTGG - Intergenic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
947907614 2:233776836-233776858 CCTGGCTGACAGAGTGTGGCAGG + Intronic
948464032 2:238143657-238143679 CCTTGGCGTCAGCGGCTGGCAGG + Intronic
948976728 2:241468047-241468069 CCTTGATGGCAGGTGCCGGCTGG - Intronic
1168853143 20:990161-990183 CCCAGCTGGCAGGGGTTGGCAGG - Intronic
1169579762 20:7006995-7007017 GGTTGTTAGCAGAGGCTGGCAGG + Intergenic
1169986222 20:11447873-11447895 CCCTGCTGGCAGATGGTGCCAGG - Intergenic
1170575168 20:17657185-17657207 CCCTACTTCCAGAGGCTGGCAGG - Intronic
1171389125 20:24789941-24789963 CTTGGATGGCAGAGGATGGCTGG + Intergenic
1171565507 20:26181583-26181605 CCCTGCTGGCAGAGGCCATCTGG + Intergenic
1172233452 20:33352837-33352859 TCTTGCTGTCAGAGGCTGACCGG - Intergenic
1172753458 20:37267492-37267514 ACTTGGAGGCAGAGGCAGGCAGG + Intergenic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1172951556 20:38726123-38726145 CCGAGCTAGCAGGGGCTGGCAGG + Intronic
1173498040 20:43533269-43533291 CCATGCTTTCAGAGGATGGCAGG + Intronic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173857203 20:46258146-46258168 CCTTGCTGGCAGTGACTTGGTGG + Intronic
1174425795 20:50430843-50430865 CCTTGCTGGCAACGGGTGGGTGG - Intergenic
1174429363 20:50456584-50456606 CCCTGCTGGTAGAGGTGGGCAGG - Intergenic
1175263708 20:57690170-57690192 CCCAGCTGGCAGAGGCAGGGAGG - Intronic
1175415127 20:58795987-58796009 CCCTGCTGGCAGGGGGTGGAGGG + Intergenic
1175823928 20:61926406-61926428 GCTGGCTGGGGGAGGCTGGCAGG - Intronic
1175877025 20:62235221-62235243 CCTGGCTGGCAGCTGCTGGCTGG - Intronic
1175943816 20:62549772-62549794 CCTTGGTGGCAGGGCCTGGCTGG + Intergenic
1176069016 20:63216368-63216390 CCTGGCGGGAAGGGGCTGGCGGG + Intergenic
1176088407 20:63308345-63308367 CCTTGCAGGTAGGGTCTGGCTGG + Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1177150398 21:17449907-17449929 CCAAGCTGGCTGAGGCTGACTGG - Intergenic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179502693 21:41820041-41820063 CCTCGCTGGAGGGGGCTGGCAGG - Intronic
1179551690 21:42147427-42147449 CTTGGCTGGCAGATGCTGGAGGG + Intergenic
1179585957 21:42374230-42374252 CCTTGCTGGGAGAGGCAGCCTGG - Intronic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1179909510 21:44440623-44440645 CCTTGCAGGCCCAGGCAGGCTGG + Intronic
1180670498 22:17548967-17548989 CCTTGGTGGGGGAGGCTGACTGG - Exonic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181462443 22:23093805-23093827 TCTGGCTGTCAGAGGCTGGCAGG + Intronic
1183358495 22:37371697-37371719 CCATGGTGACAGAGGCTGGCTGG + Exonic
1183385071 22:37509818-37509840 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183385114 22:37509937-37509959 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183469961 22:37999965-37999987 CCTAGCGGGCACAGGCTGCCAGG - Intronic
1184304193 22:43584321-43584343 CTTTGGAGGCACAGGCTGGCAGG + Intronic
1184509548 22:44925677-44925699 CTTGGCTGGCACAGCCTGGCGGG + Intronic
1184946671 22:47808736-47808758 CCTTGCGGGCAGAGGCTGCACGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185099404 22:48829737-48829759 CCTTGGTGACTGAGACTGGCAGG - Intronic
1185116129 22:48939460-48939482 CCGCCCTGGGAGAGGCTGGCAGG - Intergenic
949288551 3:2435555-2435577 CCTTGCTGAAACAGGCTGCCAGG - Intronic
949931487 3:9082033-9082055 CATTGGAGGCAGAGCCTGGCAGG + Intronic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
950501319 3:13365669-13365691 CTTCGTTGGGAGAGGCTGGCAGG + Intronic
950664758 3:14488421-14488443 CTGTGCTGGGAGATGCTGGCTGG - Exonic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951262469 3:20526729-20526751 CCTTTATGGTAGAGCCTGGCTGG - Intergenic
952695863 3:36264499-36264521 CCCTGTTGGCGGTGGCTGGCTGG + Intergenic
952820132 3:37479472-37479494 CCTTGGTGGCAGTGGCTTGAAGG + Intronic
953702937 3:45210708-45210730 CCTTGCTGGGAGGTGCAGGCTGG - Intergenic
953982325 3:47418950-47418972 CCATGCTGGGAGAGTCTGGCCGG - Intronic
954375691 3:50193076-50193098 CCTTGCTGGAGGGGGCAGGCTGG + Intronic
954425759 3:50442263-50442285 TCATGCTGGCATAGGCAGGCGGG - Intronic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
955596916 3:60601031-60601053 CCCTGCCAGCAGAGGCTGGAAGG + Intronic
956910398 3:73810153-73810175 CCTACCTGCCAGAGGGTGGCGGG + Intergenic
959528793 3:107408543-107408565 CCTTGGTGGCAAAAGCTGCCAGG - Intergenic
961246743 3:125460539-125460561 ACTTGATGCCTGAGGCTGGCAGG + Intronic
961457186 3:127030070-127030092 CCTGGCTGGCAGATGGGGGCAGG + Intronic
963044705 3:141094114-141094136 CCTTGCTGCCTGAGGTCGGCTGG + Intronic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
967397658 3:189024940-189024962 CGCTGCTGCCAGTGGCTGGCTGG + Intronic
967574672 3:191076550-191076572 CCCTGTTGCCAGTGGCTGGCTGG - Intergenic
968318342 3:197743123-197743145 ACTTGCTAGCTGAGGCGGGCAGG + Intronic
968912027 4:3481270-3481292 GCTTGGAGGAAGAGGCTGGCAGG + Intronic
969089508 4:4683087-4683109 CATAGCTGGGAGAGTCTGGCTGG - Intergenic
969605888 4:8202111-8202133 CCTTGCAGGCAGGGGCTTCCTGG + Intronic
970615281 4:17763119-17763141 CCTTGCTGGCTGGGGTTGACAGG - Intronic
970736340 4:19173431-19173453 CCTTGCTGGTGGAGGCTTGTGGG + Intergenic
971004385 4:22357196-22357218 CCCCTCAGGCAGAGGCTGGCAGG - Intronic
971475693 4:27069608-27069630 ACTTGCTGGAAGAGGCTGAATGG + Intergenic
972990255 4:44815105-44815127 CTTTGATGCCAGTGGCTGGCTGG + Intergenic
973741044 4:53919798-53919820 GCTTGCTGGGAGAGGCGGGGTGG + Intronic
976444471 4:85114761-85114783 GCTTCCTGCCAGAGGCTGCCGGG - Intergenic
977990927 4:103441659-103441681 ACTTGTTGGCAGAGGAAGGCAGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
980698740 4:136395453-136395475 CCTTACTGCCGGGGGCTGGCGGG - Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
984521150 4:180802446-180802468 CCTTGCTGGCAGTGGCAGATAGG + Intergenic
984858656 4:184217747-184217769 TCCGGCGGGCAGAGGCTGGCTGG + Exonic
985345762 4:189002393-189002415 CCCTGGTGCCAGTGGCTGGCTGG + Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
985980177 5:3456341-3456363 CCATCCTGCCAGGGGCTGGCAGG - Intergenic
986760391 5:10875052-10875074 CCTTGCTGGGAGAGGCACCCAGG - Intergenic
987027937 5:13946494-13946516 TCATTCTGGCAGGGGCTGGCGGG - Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
992084452 5:73265457-73265479 CCTATCTGGCAGTGGCAGGCAGG + Intergenic
994714206 5:103302433-103302455 GGTTGCTGTCAGATGCTGGCTGG + Intergenic
997103843 5:130996046-130996068 CCTTGGAGACAGCGGCTGGCGGG - Intergenic
997888795 5:137657183-137657205 CCTTCCTGGAAGAAGCAGGCAGG + Intronic
998220323 5:140272714-140272736 ACTTGATGGGAGAGGCAGGCAGG + Intronic
998252843 5:140564260-140564282 GCGGGCCGGCAGAGGCTGGCGGG - Exonic
1000387077 5:160684908-160684930 CCTTGATGGCAGTGACTGCCAGG + Intronic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1001542346 5:172548396-172548418 TCTAGCTGTCAGAGGCTGGGCGG - Intergenic
1002539595 5:179897518-179897540 CCATGTTGGCAAAGGATGGCTGG + Intronic
1004314517 6:14574146-14574168 CCCTGCTTGCAGAGGCTTTCGGG + Intergenic
1005117742 6:22356659-22356681 CCTCACTGCCAGGGGCTGGCGGG + Intergenic
1006392095 6:33764461-33764483 AGTGGCTGGCAGGGGCTGGCAGG - Intergenic
1006498240 6:34439810-34439832 CAGGGCTGGCAGAGGCTGGGGGG - Intergenic
1011137878 6:84118682-84118704 CCCTGTTGCCAGTGGCTGGCTGG + Intergenic
1011920974 6:92577167-92577189 CCCTGTTGTCAGTGGCTGGCTGG - Intergenic
1015621430 6:135136082-135136104 AATTGCTGGTGGAGGCTGGCAGG - Intergenic
1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG + Intronic
1017994617 6:159521258-159521280 CATTGCTCCCAGTGGCTGGCTGG + Intergenic
1019145794 6:169974900-169974922 ATGTGCTGGCAGAGGCTGGCAGG - Intergenic
1019665427 7:2249836-2249858 CCCTGCGGGCAGAGGTGGGCAGG - Exonic
1019995312 7:4720579-4720601 CGATGCTGGCAGAGCCAGGCCGG + Intronic
1020208034 7:6134579-6134601 CTTTGCTGGGAGGGGCTGTCCGG + Intronic
1023821441 7:43982877-43982899 CCAGGCTGGGAGAGGCAGGCAGG - Intergenic
1024539961 7:50468138-50468160 CCTCGCGGGCAGGGGGTGGCTGG + Intronic
1025271956 7:57530277-57530299 CCTTGCTGGCAGAGGCCATCTGG - Intergenic
1026901424 7:74039518-74039540 CCTTGGTGACAGAGGGTGGGTGG + Intronic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1027228193 7:76258034-76258056 CATCTGTGGCAGAGGCTGGCTGG + Intronic
1027986516 7:85298524-85298546 CCTTGCTGGGGAAGGGTGGCTGG - Intergenic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1028985677 7:97006577-97006599 CCCGGCTGGGAGAGGCCGGCAGG - Intronic
1029731189 7:102439268-102439290 CCTGGCTGCCAGAGACTGGAGGG - Intronic
1029749704 7:102536298-102536320 CCAGGCTGGGAGAGGCAGGCAGG - Intergenic
1029767654 7:102635403-102635425 CCAGGCTGGGAGAGGCAGGCAGG - Intronic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1034492704 7:151402498-151402520 CCCCACTGGCAGCGGCTGGCTGG + Intronic
1035181119 7:157090420-157090442 CCATGCTGCCAGGGGCTGGAGGG + Intergenic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1036229904 8:6990805-6990827 CCATGGTGGCAGGGGCTGCCCGG - Intergenic
1036232355 8:7009908-7009930 CCATGGTGGCAGGGGCTGCCCGG - Intronic
1036570117 8:9972969-9972991 CCATTCTGGCACAGACTGGCAGG + Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038332028 8:26616669-26616691 CCTTGCTTCAAGGGGCTGGCGGG + Intronic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1041101321 8:54398913-54398935 CCTTGATGGAAGAGTCTTGCAGG + Intergenic
1043578577 8:81686409-81686431 CCGGCCTGGCAGAGGCTCGCAGG - Intronic
1047585587 8:126268712-126268734 GCTGGCTGGGAGAGGCTGGCTGG - Intergenic
1049032323 8:140047113-140047135 CTGTGCCGGGAGAGGCTGGCGGG - Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049693115 8:143971405-143971427 CCTTGCCGTCACTGGCTGGCTGG + Intronic
1051913839 9:22184935-22184957 CCCTGCTGCTAGTGGCTGGCTGG - Intergenic
1055353992 9:75418442-75418464 CCATGCTGGGAGAGTATGGCTGG - Intergenic
1056754823 9:89375099-89375121 CTTTGCGGGCAGATGCAGGCAGG - Intronic
1056764086 9:89434177-89434199 CCTGGCTGGCAGCGGGTGACTGG - Intronic
1057294549 9:93827653-93827675 CTGTGCTGGCAGAAGCTTGCTGG - Intergenic
1057546994 9:96026311-96026333 CCCTGTTGGCAGAACCTGGCGGG + Intergenic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1059314118 9:113409995-113410017 CCTGGCTGGGAGTTGCTGGCTGG - Intronic
1060111543 9:120910107-120910129 CCCTTCTGGGAGAGGCTGACTGG + Intronic
1061014436 9:127973736-127973758 CCCTGCTGGCAGAAGTGGGCAGG - Intronic
1061132693 9:128716939-128716961 GTTTGCTGGAAGAGGCAGGCAGG - Intronic
1061589387 9:131588815-131588837 CCGGGCTGCCAGGGGCTGGCTGG + Exonic
1061805309 9:133134422-133134444 TCTTTCTGGCAGAGGCTGTCTGG - Intronic
1062070661 9:134553487-134553509 CCTTGTTGGGACAGGCAGGCTGG + Intergenic
1062262707 9:135670870-135670892 CATGGCTGGCAGAGGCAGGTGGG - Intergenic
1062359837 9:136182465-136182487 GCATGATGTCAGAGGCTGGCAGG - Intergenic
1062376480 9:136264054-136264076 CAGGGCTGGCACAGGCTGGCTGG + Intergenic
1062542456 9:137047677-137047699 CAGTGCTGGTAGAGACTGGCGGG - Intergenic
1062602423 9:137323915-137323937 CCATGCTGGCGGAGGCGGGCTGG - Intronic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1186282091 X:8003528-8003550 CCTCGCTGCCTGGGGCTGGCAGG + Intergenic
1186659513 X:11655058-11655080 ACTTGTTGTCAGAGGCTGGTAGG - Intronic
1186845224 X:13524043-13524065 CCTTCATGGCAGAGTCTGACAGG + Intergenic
1187169416 X:16836607-16836629 CCCTGCTGGCTGTGGCTGGGCGG + Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189581801 X:42414310-42414332 CCCTGTTGCCAGTGGCTGGCTGG + Intergenic
1191993785 X:67068243-67068265 CACTGCTGCCAGTGGCTGGCTGG - Intergenic
1192723523 X:73724640-73724662 CCCTGTTGCCAGTGGCTGGCTGG + Intergenic
1194226688 X:91269104-91269126 CATTGTTGCCAGAGGCTGGGAGG - Intergenic
1197489535 X:127100682-127100704 GCTTGCTGCCACTGGCTGGCTGG - Intergenic
1199929113 X:152500469-152500491 CCTTGCTGTGAAAAGCTGGCAGG + Intergenic
1200074589 X:153544811-153544833 CATTGCTGGAAGAGGAGGGCTGG - Intronic
1200884222 Y:8252694-8252716 CTTTGTTGGCAGAGGCTTTCTGG + Intergenic
1200954494 Y:8930241-8930263 CCTTGTTGGCAGAAGCTTTCTGG - Intergenic
1200986009 Y:9304045-9304067 CCTTGTTGGCAGGGGCTTTCTGG + Intergenic
1202046515 Y:20741390-20741412 GCTTGCTGGCAGAGGCCCGGTGG - Intergenic
1202232622 Y:22671632-22671654 CCTTGTTGGCAGAGTCTTTCTGG - Intergenic
1202310534 Y:23524526-23524548 CCTTGTTGGCAGAGTCTTTCTGG + Intergenic
1202560268 Y:26146068-26146090 CCTTGTTGGCAGAGTCTTTCTGG - Intergenic