ID: 1143775838

View in Genome Browser
Species Human (GRCh38)
Location 17:9198231-9198253
Sequence GCCTGATCACGCGGGAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143775838 Original CRISPR GCCTGATCACGCGGGAGCTT GGG Intronic
900599520 1:3497098-3497120 GCCTGCCCACCCGGCAGCTTTGG - Exonic
906805505 1:48776366-48776388 GACTGACAGCGCGGGAGCTTCGG + Intronic
907714351 1:56913627-56913649 GCCTGAAAAAGTGGGAGCTTAGG - Intronic
909764172 1:79334116-79334138 GCATGAGCTCCCGGGAGCTTAGG + Intergenic
917686846 1:177424941-177424963 CCCTGATCCCACTGGAGCTTGGG - Intergenic
923071797 1:230572455-230572477 GCCAGATCATGCAGGAACTTAGG - Intergenic
1063455263 10:6178460-6178482 GCAAGCTCAGGCGGGAGCTTTGG + Intronic
1065438277 10:25723980-25724002 GTGTGATCACGCAGGAGCTCAGG + Intergenic
1066374337 10:34843920-34843942 GCCTGATCACCCGGGATTATAGG + Intergenic
1082649101 11:55765224-55765246 GCCTTATCCTGTGGGAGCTTTGG + Intergenic
1083266549 11:61549693-61549715 GCCTGACCACTCAGCAGCTTCGG + Intronic
1100391634 12:94149612-94149634 GCCTGGCCACGCAGGAGCTGGGG + Exonic
1103272882 12:119688130-119688152 GGCTGAGCACGTGGGCGCTTGGG + Exonic
1104904203 12:132204841-132204863 ACCTGAGCACGGCGGAGCTTGGG - Intronic
1106242082 13:27920512-27920534 GCCTTTCCACGCGTGAGCTTTGG - Exonic
1122805325 14:104253520-104253542 GCTGGAGAACGCGGGAGCTTTGG - Intergenic
1125504059 15:40256874-40256896 TCCTGCTCACGGAGGAGCTTTGG - Intronic
1131070273 15:89461535-89461557 GCCTAATCCCGTGGGAGCTGTGG - Intergenic
1133038088 16:3046003-3046025 GCCTGGGCACGCGGGGGTTTGGG - Intergenic
1141529817 16:84638368-84638390 GCCTGATCCCCAGGGAGCTGTGG + Intergenic
1143775838 17:9198231-9198253 GCCTGATCACGCGGGAGCTTGGG + Intronic
1147823382 17:43255181-43255203 GCCTGGCCACGGGGGGGCTTAGG - Intergenic
1148002861 17:44400133-44400155 GCCTGAACAAGCAGGAGCCTGGG - Exonic
1149644313 17:58228687-58228709 GCCTGCTCAGCTGGGAGCTTGGG - Intronic
1150714579 17:67560659-67560681 GCCTGGTGAAGCAGGAGCTTTGG + Intronic
1160729638 19:635270-635292 GCCTGACCACACGGGGGCTCGGG + Intergenic
1164100704 19:22052296-22052318 GCCTGAAAAGGCTGGAGCTTAGG + Intergenic
1164226514 19:23250560-23250582 GCCTGAAAACGCTGCAGCTTAGG - Intergenic
1165914011 19:39247163-39247185 GCCTGCTCACGTGGGAGCTCCGG - Intergenic
1165916850 19:39265765-39265787 GCCTGCTCACGTGGGAGCTCCGG + Intergenic
1167565013 19:50250635-50250657 GCCTGATCCCGCAGGTGCCTCGG - Exonic
1167823352 19:51949733-51949755 GCCTGAAGAGGCTGGAGCTTTGG + Intergenic
934188745 2:89766807-89766829 TCCGGACCAAGCGGGAGCTTAGG - Intergenic
934750088 2:96788586-96788608 GCTTAATCCTGCGGGAGCTTGGG + Intronic
947825713 2:233104945-233104967 GCCTGATCTCACAGGAGCTGTGG + Intronic
948621002 2:239234672-239234694 GCCTGTTTGCGTGGGAGCTTAGG - Intronic
1175256827 20:57652747-57652769 GCCTGATCCCGCGGGGGCCCTGG + Intronic
1181566945 22:23744585-23744607 GCCTGAGCAGGTGGGAGCTCTGG + Exonic
1184956902 22:47894041-47894063 GGCTGATCCCGTGGGAGCTCTGG - Intergenic
952605676 3:35144737-35144759 GCCTGATCCCACAGGAGCTCTGG - Intergenic
965630196 3:170725119-170725141 ACCTGATCACACAGCAGCTTTGG - Intronic
975193625 4:71496425-71496447 GCCTGATCCCATGGGAGCTGTGG + Intronic
986623404 5:9700564-9700586 GCATGATCACTCAGGAGCGTTGG + Intronic
1014776184 6:125512245-125512267 GCCTGATCCCATGGGAGCTCTGG - Intergenic
1017116145 6:150978863-150978885 GCCTGATCACCCACAAGCTTTGG - Intronic
1023909160 7:44541463-44541485 GCCTCATCACGCAGGTGCTAGGG + Intergenic
1025766796 7:64463675-64463697 GCCTGAAAAGGCGGCAGCTTAGG + Intergenic
1028863459 7:95680632-95680654 CCATGATCACCTGGGAGCTTTGG + Intergenic
1035098235 7:156374347-156374369 GCCTGTTTACGCGGGGGCTGTGG + Intergenic
1039856017 8:41414977-41414999 GCCTGGTCAGGCAGGAGTTTGGG + Intergenic
1198437274 X:136629580-136629602 GCCTGAGCAAGCAGGAGCTGAGG + Intergenic
1202367288 Y:24174111-24174133 CCCTGATCCCACAGGAGCTTGGG + Intergenic
1202503493 Y:25496012-25496034 CCCTGATCCCACAGGAGCTTGGG - Intergenic