ID: 1143776261

View in Genome Browser
Species Human (GRCh38)
Location 17:9201124-9201146
Sequence CAGAATTTGCATCTTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143776259_1143776261 14 Left 1143776259 17:9201087-9201109 CCTCTAGCAAAAACTCTAGAAAG 0: 1
1: 0
2: 1
3: 9
4: 180
Right 1143776261 17:9201124-9201146 CAGAATTTGCATCTTGAAGAAGG 0: 1
1: 0
2: 0
3: 29
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143776261 Original CRISPR CAGAATTTGCATCTTGAAGA AGG Intronic
901050058 1:6421468-6421490 CAGCATCTGCATCTTGGGGAGGG + Intronic
905903687 1:41600371-41600393 CAGAATTTCCTTCTTTAAGACGG + Intronic
906933624 1:50192881-50192903 CAGATTTGGCTTCTTGCAGATGG + Intronic
909678803 1:78268254-78268276 CAGCATCTGCTTCTTGAAAATGG + Intergenic
911074840 1:93863098-93863120 AAGAATATGCATTTTGAGGATGG - Intergenic
911404545 1:97420257-97420279 CAGTATCTGCATCTGGAAGACGG - Intronic
916064717 1:161126905-161126927 TAGAAAATGCATTTTGAAGATGG - Intronic
917724969 1:177819604-177819626 CAGAATCTGCATTTTAATGAGGG - Intergenic
917886486 1:179390602-179390624 AAGAATTTATATCTAGAAGAAGG + Intronic
921170726 1:212546151-212546173 CAGAATTTCCATTTTTCAGATGG - Intergenic
921575821 1:216833511-216833533 ATGAATCTGGATCTTGAAGAAGG - Intronic
922855026 1:228767830-228767852 CAGAACTTGCCACTTGGAGAAGG + Intergenic
923074467 1:230597403-230597425 CACAGTTTCCATCTTGAATATGG - Intergenic
1063407158 10:5807571-5807593 CAGAACTTGGATTCTGAAGATGG - Intronic
1063844720 10:10113641-10113663 CAGAAATTGGCTTTTGAAGATGG - Intergenic
1064014418 10:11761513-11761535 CAGAATTTGCAATTTGGACAGGG + Intronic
1066263546 10:33752687-33752709 CAGGCTTTCCATCTTGAAGAGGG - Intergenic
1069300730 10:66903921-66903943 AAGAATTTACATCATGAAAATGG + Intronic
1069626622 10:69871890-69871912 CAGTGTTTTCATCTTGAAAATGG - Intronic
1071127579 10:82353182-82353204 CAGAATTTGCTTATAGAAAATGG - Intronic
1072622805 10:97091116-97091138 GAGAATTTGCCTCTTGCAAAAGG + Intronic
1073416591 10:103388550-103388572 CTGAATTTGAATCTTGAAGCAGG - Exonic
1075207923 10:120462746-120462768 CAGAATCTGCATTTTGAACAGGG + Intronic
1075314037 10:121437892-121437914 CAGAGTTTGCACCGTGAAGTGGG + Intergenic
1076185404 10:128443221-128443243 CATAATTTTTAACTTGAAGATGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077348258 11:2074663-2074685 CAGAATTTCCTTCCTGAACATGG + Intergenic
1079567320 11:21898952-21898974 AAGAATATGCATTTTAAAGAAGG - Intergenic
1079590909 11:22181420-22181442 CACCATATGCATCTTAAAGAAGG + Intergenic
1079820363 11:25119622-25119644 CAGAAATTTCATCTACAAGATGG + Intergenic
1080840005 11:35975431-35975453 CAGAACAGGCATCTGGAAGAAGG + Intronic
1081524004 11:43911427-43911449 CAGATTTTGCACGTAGAAGAAGG - Intronic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1082675150 11:56089800-56089822 CAAAATTTGAATCTTGAAAGAGG + Intergenic
1084302477 11:68260540-68260562 CACAATCTCCATTTTGAAGACGG - Intergenic
1084535455 11:69753702-69753724 CAGAATCTGCATCTGGAAATGGG + Intergenic
1084649428 11:70480030-70480052 CAGACTTTGTTTCCTGAAGATGG - Intronic
1087376768 11:97352219-97352241 CAGCATTTGCATTTTCAAGGGGG + Intergenic
1087570859 11:99926157-99926179 AAGCATTTGCATTTTAAAGAGGG - Intronic
1088828251 11:113513849-113513871 TAGAAATTGAAGCTTGAAGATGG + Intergenic
1090003621 11:122981866-122981888 GAGAATTGGCAGCTTGGAGAGGG + Intergenic
1091676792 12:2497133-2497155 CAGACTTTACATCTTTGAGATGG - Intronic
1093133254 12:15417590-15417612 CAGAATCTGCATTTTTAACAAGG + Intronic
1093257388 12:16886852-16886874 CAGAATTAGCATTTATAAGAAGG - Intergenic
1094798544 12:34002872-34002894 GAAAATTTGCAGCTTGATGATGG - Intergenic
1095111298 12:38296959-38296981 GAAAATTTGCAGCTTGATGATGG - Intergenic
1095215991 12:39548521-39548543 CAGCATCTGCATGTTGAAAAAGG + Intergenic
1095329023 12:40934908-40934930 CAGAAAGTGAATCATGAAGAAGG - Intronic
1096895959 12:54820762-54820784 TAGATTTTGCTCCTTGAAGAAGG + Intergenic
1098468439 12:70815613-70815635 CAGATTTAGCATCATGAAAATGG + Intronic
1098672472 12:73248442-73248464 GAAAATTTGCAGCTTGATGATGG - Intergenic
1098889784 12:75997983-75998005 CAGAATCTTCATCTTGAAAATGG - Intergenic
1099790859 12:87331445-87331467 CATATTTTGCATATTGAAAAAGG + Intergenic
1103660094 12:122507432-122507454 CAAAAATTGCATGTTGAAAAAGG - Intronic
1107566363 13:41609499-41609521 CAGAGTTTTCCTCTTGAAGTTGG + Intronic
1108869744 13:54968939-54968961 CAAAATTTGCATCTTAAATAAGG + Intergenic
1108903775 13:55445755-55445777 CAGGTTTTTCATCTTGAAAACGG + Intergenic
1109144044 13:58755175-58755197 CAGAATTTTCTTCTTGTATAAGG + Intergenic
1109318693 13:60782747-60782769 CAGAATTTGCTTCTTTTATAAGG + Intergenic
1110678138 13:78275530-78275552 CAGTGTTTGCATCTTTAAAATGG - Intergenic
1111858022 13:93664580-93664602 CAGAGTATGCTTCCTGAAGATGG - Intronic
1112573021 13:100610952-100610974 CAGAAATAGCTTTTTGAAGAGGG - Intronic
1112640156 13:101264571-101264593 CAGAATCTGTATCTTTAACACGG + Intronic
1113349304 13:109512843-109512865 CTAAATTTGTATCTTGAACATGG + Intergenic
1113793796 13:113045154-113045176 CAGAAATGGCATCATGAATATGG + Intronic
1114319295 14:21533804-21533826 CAGCATTTGCATGTTGTATATGG + Intronic
1114640747 14:24218525-24218547 GAGAATATGCATCTTTTAGAAGG - Intronic
1116046930 14:39754925-39754947 CAGAATTTCCAACCTGAAGGTGG + Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1116956594 14:50929956-50929978 CAGAAGTTGTCTCTGGAAGATGG - Intronic
1117561795 14:56947756-56947778 CAGAATTTTAATCATGAAAAGGG - Intergenic
1119847945 14:77844676-77844698 CAGACTGTCCATCTTGCAGAAGG + Intronic
1119889712 14:78173646-78173668 CAGAATTTTTTTCATGAAGATGG - Intergenic
1119912249 14:78360224-78360246 ATGAACTTGCATCTTTAAGAAGG - Intronic
1120333286 14:83121015-83121037 CACTATTTGCATTTTGGAGAAGG + Intergenic
1120481589 14:85055546-85055568 TAGAAGGTGCTTCTTGAAGAAGG + Intergenic
1120903782 14:89601228-89601250 CATAATCTGCATATTTAAGATGG + Intronic
1121514842 14:94542748-94542770 CAGAAAGTGCTTCCTGAAGAAGG + Intergenic
1121888941 14:97571516-97571538 CAGAATGTGTATATTGAGGAGGG - Intergenic
1124703305 15:31936490-31936512 CAGATTATGCATCTGGAACAGGG + Intergenic
1124813556 15:32965991-32966013 GAGAAGTAGGATCTTGAAGAAGG + Intronic
1125322841 15:38507210-38507232 CAGGATTTGCATTTTGCATATGG - Intronic
1125322930 15:38507903-38507925 CAGAATGGGGATCTTGAAGTCGG + Exonic
1125415025 15:39443448-39443470 CAGAATTTGCATCTAGATCTAGG - Intergenic
1125677290 15:41509228-41509250 CAGCATTTGCATCATGATGCTGG - Intronic
1133490261 16:6261325-6261347 CAGTTTTTCCATCTTGAGGAAGG + Intronic
1135804674 16:25532015-25532037 CAGAATCTGCATCTTTAACAAGG + Intergenic
1137905363 16:52316314-52316336 CAGAGATAGCATCTTTAAGACGG - Intergenic
1138935888 16:61722512-61722534 AACAATTAGCATCTTGTAGATGG + Intronic
1140157210 16:72443571-72443593 CAGAATTTTCATTTTAAAAAGGG - Intergenic
1140610084 16:76588013-76588035 CAGACTTTACCTCTTGAAAATGG + Intronic
1141063285 16:80894724-80894746 CAGAAGTTGCAGCTTTAGGAAGG + Intergenic
1141783311 16:86179924-86179946 CAGTATTTTCATCTTGCGGAAGG + Intergenic
1141986131 16:87581391-87581413 AAACATTTACATCTTGAAGATGG + Intergenic
1142015777 16:87746257-87746279 AAGACTTTGTCTCTTGAAGAAGG + Intronic
1143776261 17:9201124-9201146 CAGAATTTGCATCTTGAAGAAGG + Intronic
1144130544 17:12242574-12242596 CAGACTGTGTATCTTGAAGCAGG + Intergenic
1144157212 17:12517508-12517530 CAGACTCTTCCTCTTGAAGATGG - Intergenic
1144555162 17:16275528-16275550 CAGCAATTCCATCTTGAATAGGG - Intronic
1145778432 17:27545618-27545640 CAGAGTTTCCAGCCTGAAGAGGG + Intronic
1146739036 17:35265166-35265188 CAGAATTTCCGTACTGAAGATGG + Exonic
1146748423 17:35353029-35353051 CAGAATTTCCGTACTGAAGATGG - Exonic
1146756959 17:35441256-35441278 CAGAATTTCCGTACTGAAGATGG - Exonic
1151125134 17:71836696-71836718 TAGAATTTGAATCTTGACCAAGG + Intergenic
1153030416 18:708620-708642 CTGAATGTGCTTCTTGAAGAGGG + Intronic
1154382509 18:13865428-13865450 CAGTATTTGGTTCTTGGAGAAGG + Intergenic
1155364988 18:25040822-25040844 CAGGATTCGCCTCTTGCAGAAGG - Intergenic
1155509962 18:26566607-26566629 CTGAATTTGCAGTTTGAGGAGGG + Intronic
1157223764 18:45845210-45845232 CGGTACTTGCATTTTGAAGAGGG + Intergenic
1157229212 18:45898484-45898506 CAGAATTTGGATCTGCAATATGG - Intronic
1158155699 18:54423273-54423295 CCTGATTTGCATCTTGATGAAGG + Intergenic
1159361112 18:67403962-67403984 TAGAACTAGCATCTGGAAGAAGG + Intergenic
1161002442 19:1917641-1917663 CAGACTTTGTCTCTTGAAGGAGG - Intronic
1162369802 19:10271740-10271762 CAGAATATACATCTTGAGGGGGG - Intronic
1163117400 19:15196770-15196792 CAGTTTTTGCATCTGGAAAATGG - Intronic
1163182433 19:15614133-15614155 CAGATTTTGCATTTGGGAGATGG - Intergenic
1165086023 19:33347980-33348002 CAGACCTTGGATCTTAAAGATGG + Intergenic
925457193 2:4026108-4026130 CAGCATTTGTAGCTTTAAGACGG + Intergenic
925772022 2:7291522-7291544 CATAATTTGTTTCATGAAGAAGG - Intergenic
925962565 2:9031882-9031904 CACAATTTGGATTTGGAAGAAGG - Intergenic
926949137 2:18222346-18222368 CAGAAGAGGCATCTTGAAGTTGG - Intronic
927702862 2:25278923-25278945 CAGAATCTGCATTTTAAAGAGGG - Intronic
928525271 2:32133714-32133736 CAAACTTTACATTTTGAAGACGG - Intronic
928996918 2:37302881-37302903 CAGGCTTTTCATCTTGAAGGTGG - Intronic
929550493 2:42887703-42887725 CTGAATTAGCATCTTGTATATGG + Intergenic
930353383 2:50286455-50286477 CAGAATTTCCATCTTTATTATGG + Intronic
931648720 2:64449709-64449731 CAGTATCTGCATCATGAAGAGGG - Intergenic
932578315 2:72975111-72975133 AAGACTTTGCTTCTTGATGATGG + Intronic
933132643 2:78691530-78691552 CTGAATTTGAATTTTAAAGAGGG + Intergenic
935607094 2:104982184-104982206 CAGAATTTGATTCTTGCTGAAGG - Intergenic
936716846 2:115196960-115196982 CTTAAATTGCATCTTGAAAATGG + Intronic
937079575 2:119130767-119130789 CTGAATTTTCTTCTTGAAAATGG - Intergenic
938106910 2:128537927-128537949 AAGAATTTACATTTTCAAGAAGG - Intergenic
938681458 2:133695727-133695749 AAGAATAGCCATCTTGAAGAAGG + Intergenic
939147300 2:138431413-138431435 CAGTGTTTGCATCTTTAAAAGGG - Intergenic
941066253 2:160906261-160906283 CAGAATCTGCATTTTGAAACAGG - Intergenic
942204163 2:173602899-173602921 CAGTATTTGCATTTTGAACTGGG + Intergenic
945119239 2:206441867-206441889 CACAATATGCATCCTGAAAAAGG - Intergenic
945657734 2:212645508-212645530 CATAATTTGCATCACAAAGAAGG + Intergenic
946948528 2:224847587-224847609 CAGAAAATGCATCTTCCAGATGG + Intronic
947178834 2:227394431-227394453 CAGAATCTTCATCTTCAAGAAGG - Intergenic
948554165 2:238795669-238795691 CAGAATTTACATCTTGACCGTGG + Intergenic
1169145965 20:3252524-3252546 CAGAATGTCCACCTTGGAGATGG - Exonic
1169454275 20:5738400-5738422 AAGTATTTGCATTTTGAAGGGGG + Intergenic
1170368404 20:15621600-15621622 AATAATTTGCATCTGGAGGAAGG + Intronic
1170993533 20:21328674-21328696 AAGAATATGCATCTTGAAGTTGG + Intronic
1172027109 20:31956053-31956075 CAGAAGTTGCATTTTAAACATGG - Intergenic
1173302413 20:41815949-41815971 CAGAATTTGTCTATTGAAGTAGG - Intergenic
1173448589 20:43142351-43142373 CAGGATTTGAAAGTTGAAGATGG + Intronic
1173701066 20:45072069-45072091 AGGATTTTGCATTTTGAAGAAGG - Intronic
1173714493 20:45190512-45190534 CAGAATTAGCATATTGTGGAGGG - Intergenic
1173890259 20:46502667-46502689 GAGAATTGCCCTCTTGAAGAAGG + Exonic
1174144259 20:48440042-48440064 GAGAATTTGCACCTTTAGGATGG - Intergenic
1176957415 21:15121944-15121966 CAGCATTTACATCTTGAAGCAGG + Intergenic
1177254658 21:18645346-18645368 CAGAATTTACATCTGAGAGAGGG + Intergenic
1177879386 21:26673992-26674014 AAGCATTTGTATCTTAAAGATGG - Intergenic
1178537187 21:33420157-33420179 CGGAAGATGCATCTTGGAGAGGG + Intronic
1179511029 21:41873742-41873764 CAGAGTTTCCATTTTTAAGATGG - Intronic
1181582834 22:23837458-23837480 CATAATTTGCATCGTCAGGACGG - Intronic
1182917064 22:34043771-34043793 CAGAATTTGAATCTGGACTATGG - Intergenic
1184629248 22:45763092-45763114 CAGCATTTTCATCTGGAAGGAGG + Intronic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
950714308 3:14836911-14836933 AAGAATTTGCGACCTGAAGAAGG + Intronic
951822766 3:26831441-26831463 CTGAATTTGCATTTTGAGCATGG - Intergenic
952991053 3:38831161-38831183 CAGAAGCTGTATCTTAAAGATGG - Intergenic
953707131 3:45239808-45239830 GAGAATTTGCATCTCGAACAAGG + Intergenic
955723919 3:61912339-61912361 AGGAATTTGCATAATGAAGAGGG + Intronic
955733512 3:62012195-62012217 CAGTCTTTCCATCTTTAAGATGG - Intronic
956058962 3:65330695-65330717 TGGAATTTACATCTTGAAGATGG - Intergenic
956482454 3:69686921-69686943 AAGAAAATGCATCTTGAAGCTGG + Intergenic
956983186 3:74664492-74664514 CAGAATTTGAATCATTAAGAAGG + Intergenic
956989394 3:74745702-74745724 CAGGTTTTACATCTAGAAGAAGG + Intergenic
957168433 3:76706207-76706229 TAGAATTTTCAACTTGAATATGG + Intronic
957539141 3:81546400-81546422 CAGCAACTCCATCTTGAAGAGGG + Intronic
957936727 3:86953866-86953888 CAAAATTTGCATATTAAATATGG - Intronic
958004751 3:87796549-87796571 CAAAATATGGATATTGAAGAGGG + Intergenic
959905804 3:111709993-111710015 CAGATTTTGCATCTGTCAGAAGG + Intronic
961267161 3:125652902-125652924 GAGAATAAGCATCTTGAAAAAGG + Intergenic
961955277 3:130795226-130795248 CACAATTTGAATACTGAAGAAGG - Intergenic
962681103 3:137801316-137801338 GAAAATTTGGATATTGAAGACGG + Intergenic
964331378 3:155607124-155607146 CTAAATTTGCATTTTTAAGAGGG - Intronic
964447372 3:156774096-156774118 TAGAATTTCCAAATTGAAGAAGG - Intergenic
969984160 4:11189812-11189834 CAAAATTTGCAGCTGGAAGGAGG + Intergenic
970992983 4:22234734-22234756 CAGGATTTGCATCTGCAAGAGGG - Intergenic
971060918 4:22968484-22968506 CAGGATCTTCATCTTTAAGATGG - Intergenic
971923628 4:32976961-32976983 CATAAGTTGCATGTTGAAGGAGG - Intergenic
972703524 4:41517127-41517149 CGGAAGTTGTATGTTGAAGATGG - Intronic
974015802 4:56647754-56647776 CAGAACCTGCATTTTTAAGAAGG - Intergenic
974274460 4:59699859-59699881 CAGGATCTGCATCTTGAAAGAGG - Intergenic
974797747 4:66775609-66775631 TAGAATTTGCTTCTCGAAAAGGG - Intergenic
975536041 4:75452042-75452064 AAGAATTTATATCTTGAATATGG - Intergenic
977504142 4:97880116-97880138 CAGAATTTCCTTCTTTTAGAAGG - Intronic
977958657 4:103059304-103059326 AAGAATTTCCATCTTGAAGTAGG - Intronic
978704845 4:111695024-111695046 AAGATTTTGCATATTGAAGAAGG + Intergenic
978784853 4:112597994-112598016 GAGACTTTGCATGTTGAAAATGG - Intronic
978950464 4:114552983-114553005 CTGAATTTGTATATTGAAGGAGG + Intergenic
979408601 4:120345398-120345420 AAAAGTTTGCATCTAGAAGAGGG + Intergenic
979534458 4:121803833-121803855 CAGAATTTGATTCTTGATTAGGG + Intronic
979746366 4:124218454-124218476 CAAAATTTAAAACTTGAAGAAGG - Intergenic
980573525 4:134655910-134655932 CACCATTTTCATCTTGATGAAGG - Intergenic
981095680 4:140777489-140777511 AAGAATATGTTTCTTGAAGAAGG - Intergenic
981297263 4:143146640-143146662 CAGGCTTTTCAGCTTGAAGATGG - Intergenic
982737979 4:159025874-159025896 CAGTTTTTGCTTCTTGAAGCAGG + Intronic
983587724 4:169374202-169374224 GAGAATTAACATCTTGGAGAGGG - Intergenic
983944969 4:173575916-173575938 CGGACTTTGAATCTTGAGGAAGG + Intergenic
986468335 5:8049658-8049680 CAGAATTTGCAGTTTGAGGCTGG + Intergenic
986591912 5:9379770-9379792 CAGAATGTGCATTTAGATGACGG + Intronic
986950456 5:13077150-13077172 CAGAATTTGTATCTTCAGAATGG - Intergenic
987155513 5:15085406-15085428 CAGAATATTCATCTGAAAGATGG + Intergenic
988349885 5:30088391-30088413 CAGTATTGTCATCTTGAAAAAGG - Intergenic
988450819 5:31341434-31341456 CAGCTTTTGCATGTTGGAGATGG - Intergenic
991303379 5:65150405-65150427 CAGGATGTGAAACTTGAAGATGG + Exonic
991500477 5:67271461-67271483 AAGCATTTTCATCTTGCAGATGG - Intergenic
992376964 5:76197801-76197823 CAGCATTTCCAGCTTGCAGAAGG - Intronic
993519001 5:88875676-88875698 CAGAATTTTCAAGTTAAAGAAGG + Intronic
993866774 5:93205249-93205271 TAGATGTTGCATCTTGTAGAAGG - Intergenic
996989918 5:129616521-129616543 AAGCATTTGGATTTTGAAGATGG - Intronic
998687343 5:144543595-144543617 AAGAATTTGCTTCAGGAAGAGGG + Intergenic
998753719 5:145352694-145352716 GAAAATTTGCAGCCTGAAGATGG - Intergenic
999204679 5:149839643-149839665 CAGATTTTTCATCTGGAAAATGG + Intronic
1000045384 5:157517969-157517991 GAGAATTTGCATCTTACACAAGG + Intronic
1001132472 5:169075944-169075966 CAGAATCTACATCTTGGGGAGGG + Intronic
1001640619 5:173241839-173241861 CAGAATTTGTATTTTAAATATGG + Intergenic
1003785956 6:9487283-9487305 CAGAATTTGAAGCTAGCAGATGG + Intergenic
1003871445 6:10406256-10406278 TAAAATTAGTATCTTGAAGATGG - Intronic
1004126239 6:12876816-12876838 CATAATTTGCATCTGTAAGCTGG + Intronic
1004462113 6:15847315-15847337 CAAAATTTGCAAATTGAAGCTGG - Intergenic
1005131549 6:22514185-22514207 CAGAATGTGCAGTTGGAAGAAGG + Intergenic
1005793526 6:29332253-29332275 CACAATTTGCATCTTCAAAATGG + Intergenic
1008078200 6:47168003-47168025 CAGAATTTGCATCTAAATGAAGG + Intergenic
1008235334 6:49039823-49039845 CAGAATTTACATCTTTTATAAGG + Intergenic
1008300743 6:49836212-49836234 CTGAATTTGAATCTTGACAATGG + Intronic
1009248241 6:61266690-61266712 CAAAATTTGCATTTGAAAGAGGG - Intergenic
1010359708 6:74978436-74978458 CTTAATTTGCAACATGAAGATGG - Intergenic
1012215863 6:96582859-96582881 TGTAATTTGCATTTTGAAGAAGG - Intronic
1012843514 6:104361069-104361091 CGTAATTTGCATCTTCAAGGTGG - Intergenic
1013932276 6:115548017-115548039 CAGAAAATGCACCTTTAAGAGGG + Intergenic
1013963980 6:115933660-115933682 CTGAATTTGCATATTGAAATGGG + Exonic
1014462972 6:121720546-121720568 CAGAGTTTCCATCTACAAGATGG - Intergenic
1015834124 6:137401118-137401140 TAGAATGTGCATCTTGAATAAGG - Intergenic
1015959037 6:138628383-138628405 CAAAATATGCATATTAAAGATGG - Intronic
1016761461 6:147742011-147742033 CAGTCTTTGCATGTTGAATATGG - Intergenic
1017081430 6:150672925-150672947 CAGAATATGCAATTTGAAGGGGG - Intronic
1017854769 6:158340620-158340642 GAGAAGGTGCATCTTGAGGAGGG - Intronic
1019667800 7:2260904-2260926 CCGCATTTCCACCTTGAAGAGGG - Intronic
1020650034 7:10863445-10863467 TAAAATATGCATCTTTAAGATGG - Intergenic
1020718109 7:11704261-11704283 CAGCATTTTCATATTGAATAGGG + Intronic
1020883454 7:13793103-13793125 CAGAGTCTCCAGCTTGAAGATGG + Intergenic
1021227487 7:18045357-18045379 CAGAAGATGCAACTTGCAGAAGG + Intergenic
1021603224 7:22385459-22385481 CAAAATTTGCATCAAGAAGAAGG - Intergenic
1021663238 7:22943379-22943401 CAGAATTTGCATTCTTAACAAGG - Exonic
1021773635 7:24030035-24030057 TAAAATTTTCATCTGGAAGATGG + Intergenic
1022951776 7:35346124-35346146 CAGCATTTGTTTCTAGAAGATGG + Intergenic
1022982901 7:35621172-35621194 TAGATTTTGCATATAGAAGACGG - Intergenic
1024159538 7:46660104-46660126 CTGAATTTCCAGCTTGCAGATGG - Intergenic
1025813082 7:64887926-64887948 CAGAACTTGCATCCTGATGGGGG + Intronic
1026450652 7:70526366-70526388 CAGAAGCAGGATCTTGAAGATGG - Intronic
1027957705 7:84902593-84902615 CAGAATCTCCAGCTTGCAGATGG + Intergenic
1028714848 7:93953604-93953626 TAGAATATGCATTTTGGAGAAGG + Intergenic
1029433099 7:100544911-100544933 CAGAATTTAGATCAGGAAGAGGG + Intronic
1029478022 7:100796715-100796737 CAGAATCTGCATTTTCAACAAGG + Intronic
1030171198 7:106604559-106604581 CAGTATTGGAATCTTGTAGAAGG + Intergenic
1031623338 7:123962766-123962788 CAGAAGTTGCCACTTGTAGAAGG - Intronic
1031719253 7:125149856-125149878 CAAATTTTCCATTTTGAAGATGG + Intergenic
1038512995 8:28158072-28158094 CAAAAATTACATGTTGAAGATGG - Intronic
1039186325 8:34921058-34921080 CAGAATTTTCTTCTTGAATCCGG - Intergenic
1039987843 8:42463004-42463026 CAGAATTTTCATCTTAAAAAAGG - Exonic
1043470976 8:80562290-80562312 CAGAAGTTCCAGCTTGAAGTGGG - Intergenic
1043886172 8:85603198-85603220 AAGTATTTGCATTTGGAAGAGGG + Intergenic
1045720874 8:105109248-105109270 CAGAGTTTCCAGCTTGCAGATGG + Intronic
1045733088 8:105264112-105264134 GAAAATATGCATATTGAAGAAGG - Intronic
1046727591 8:117691883-117691905 CAGCATTTTCATTTTGAAAAGGG + Intergenic
1047296649 8:123576356-123576378 CAGAATTTGGATCTTGGGGCTGG + Intergenic
1047685391 8:127300178-127300200 AAGAATTTGCATTTTGAAAAAGG - Intergenic
1051234822 9:14988453-14988475 CAGAATTTCCTTTTTTAAGACGG - Intergenic
1051460030 9:17301815-17301837 CAGTATTTGCCTCTGGGAGATGG - Intronic
1051495499 9:17718419-17718441 CAGAATCTGCATTTTTAACACGG - Intronic
1051877158 9:21804962-21804984 TAGAATGTCCATCTTGAAGAGGG + Intronic
1052114639 9:24635443-24635465 CAGAATTTGCATCAGAAAGTGGG - Intergenic
1052216388 9:25971817-25971839 CAGGCTTTTCATCTTGAAGGTGG - Intergenic
1053073194 9:35112980-35113002 CAGAGTTTTCCTCTTGAAAAGGG - Intronic
1055096074 9:72415451-72415473 CAGTTTTTTCATCTAGAAGATGG + Intergenic
1056541219 9:87572983-87573005 CAGAATCAGCATCTGGAAGGTGG - Intronic
1057559604 9:96116862-96116884 CAGAGTTTGCATCTTGGAGCTGG - Intergenic
1058382512 9:104392856-104392878 CAGAATTTTCAGTCTGAAGAAGG + Intergenic
1058843166 9:108930724-108930746 CAGAATTTGCATGACAAAGAGGG + Intronic
1059521005 9:114942117-114942139 CAAAGTATGCATCTTGGAGAAGG - Intergenic
1059777504 9:117490083-117490105 CACAAAATGCATCTTTAAGAGGG - Intergenic
1059797763 9:117717825-117717847 TAGAATTTCCATCTGGGAGAGGG - Intergenic
1060950499 9:127599128-127599150 TAGAATTTGCAGGTTGAGGAGGG - Intergenic
1202798843 9_KI270719v1_random:154162-154184 CAGAATTGGCATCTTTTATATGG + Intergenic
1187414591 X:19082164-19082186 CAGAATTTCTATCTAGAAGAGGG + Intronic
1188709912 X:33383221-33383243 CAGAAATTCCATCTTTTAGATGG + Intergenic
1189055702 X:37697506-37697528 CAGAATTTGAATGCTGAATAGGG - Intronic
1189077814 X:37936610-37936632 AAGAATTTGCCTCTAGAAGTCGG - Intronic
1192784021 X:74320699-74320721 CAGAAATTGCATATTGAAACTGG - Intergenic
1192804588 X:74497572-74497594 CAGAAATTGCATATTGAAACTGG + Intronic
1193367109 X:80648117-80648139 GAGAATTTGTATCTTAAGGAAGG + Intergenic
1196251402 X:113464542-113464564 CAGAATTTAAAACTTGAATATGG + Intergenic
1196542177 X:116922769-116922791 AACAATTTGCATCATGAACAAGG - Intergenic
1197288615 X:124626985-124627007 CAGAATATCCATCTTAACGATGG - Intronic
1198997396 X:142589490-142589512 CAGTATTTGCATGTTGAGGCTGG + Intergenic
1199358463 X:146887954-146887976 TACAATTGGCATATTGAAGAAGG + Intergenic
1199563493 X:149188921-149188943 CTTAATTTTTATCTTGAAGATGG + Intergenic
1199911933 X:152296185-152296207 TACACTTTTCATCTTGAAGAGGG + Intronic