ID: 1143778079

View in Genome Browser
Species Human (GRCh38)
Location 17:9212592-9212614
Sequence CCAGGGTGAAAGAGTTTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143778079_1143778086 -7 Left 1143778079 17:9212592-9212614 CCCCTTAAACTCTTTCACCCTGG 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1143778086 17:9212608-9212630 ACCCTGGGCCAGGGAGAACCAGG 0: 1
1: 0
2: 6
3: 21
4: 307
1143778079_1143778094 20 Left 1143778079 17:9212592-9212614 CCCCTTAAACTCTTTCACCCTGG 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1143778094 17:9212635-9212657 CCTCCCCTACGCCCAGCCCTTGG 0: 1
1: 0
2: 7
3: 80
4: 627
1143778079_1143778088 -6 Left 1143778079 17:9212592-9212614 CCCCTTAAACTCTTTCACCCTGG 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1143778088 17:9212609-9212631 CCCTGGGCCAGGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 41
4: 394
1143778079_1143778090 -5 Left 1143778079 17:9212592-9212614 CCCCTTAAACTCTTTCACCCTGG 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1143778090 17:9212610-9212632 CCTGGGCCAGGGAGAACCAGGGG 0: 1
1: 0
2: 2
3: 53
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143778079 Original CRISPR CCAGGGTGAAAGAGTTTAAG GGG (reversed) Intronic
905623397 1:39468900-39468922 CCAGGGAGAAAAAGCTGAAGAGG + Intronic
906165296 1:43681572-43681594 CCAAGGTGACAGGCTTTAAGAGG - Intronic
907048148 1:51312588-51312610 CCAGGGTGACAGAGTAGAGGAGG - Intronic
913294827 1:117309152-117309174 CAAGGGGGAATGAGCTTAAGAGG + Intergenic
916966076 1:169944598-169944620 CCAGGAAGAATGAGGTTAAGTGG + Intronic
921330867 1:214034027-214034049 CCAGTGTGAAAGTCTTTAGGAGG + Intronic
923302087 1:232650726-232650748 ACAGGCTGGAAGAGTTTGAGGGG - Intergenic
923350360 1:233099060-233099082 CCAGGCTCAGAGAGATTAAGTGG + Intronic
923467135 1:234259176-234259198 CCAGGGAGAAGGAGTTTTAGAGG - Intronic
923950122 1:238940919-238940941 CCAGGCTGTAACAGTTTGAGGGG - Intergenic
924547428 1:245042911-245042933 CCCGGGTCAAACATTTTAAGTGG + Intronic
924855746 1:247873545-247873567 TCAGAGTCAAAGAGTTTATGTGG - Intronic
1063947322 10:11190902-11190924 ACAGGGAGTAAGAGTGTAAGGGG + Intronic
1066130449 10:32388078-32388100 CAATGGTTAAAGAGTTGAAGTGG - Intergenic
1069837281 10:71317478-71317500 CCAGGCTCAAAGAGGTCAAGTGG - Intergenic
1070950224 10:80425277-80425299 CCAGGTGGAAAGATTTGAAGGGG - Intronic
1074856752 10:117479637-117479659 ACAGGCTCAAAGAGTTCAAGAGG + Intergenic
1079116991 11:17646237-17646259 CCAGGGTCACAGAGGTTCAGAGG - Intronic
1079675959 11:23226959-23226981 CAAGGCTTAAAGAGTTTGAGGGG - Intergenic
1084019566 11:66409534-66409556 TCAGGGAGAAAAAGTTTAAGGGG - Intergenic
1089167125 11:116485891-116485913 CCAGGGTGCTGGAGTTGAAGAGG - Intergenic
1089799917 11:121018800-121018822 CCAGGCAGAAACAGTCTAAGAGG + Intergenic
1093072042 12:14715760-14715782 CCCGCCTGAAAGAGTTTAAAAGG - Intergenic
1093926954 12:24918143-24918165 CCAAGAGGAAAGAGTTGAAGGGG + Intronic
1095849898 12:46791093-46791115 CGAGGTTGACAGAGTTAAAGGGG - Intronic
1097436982 12:59561915-59561937 AGAGAGAGAAAGAGTTTAAGGGG - Intergenic
1097516211 12:60610076-60610098 TGAGGCTTAAAGAGTTTAAGTGG + Intergenic
1103750516 12:123155911-123155933 CCAGGGTGAAGGAGTGGAAAGGG + Exonic
1104153201 12:126105089-126105111 CACTGCTGAAAGAGTTTAAGTGG + Intergenic
1107166988 13:37294039-37294061 CTAACGTCAAAGAGTTTAAGAGG - Intergenic
1110057908 13:71000152-71000174 CTAGGCTGAAAGAGTTTTTGTGG - Intergenic
1111093839 13:83483368-83483390 CCAGGCTGAGATAGTGTAAGAGG + Intergenic
1111244050 13:85511752-85511774 CAATGGTAAAAGAGTTTGAGAGG + Intergenic
1113174449 13:107546142-107546164 CCAGGGTGCAAGAGGCCAAGTGG - Intronic
1115814364 14:37147089-37147111 CAAGGGTGAAGGAGTTCTAGAGG - Intronic
1116460775 14:45170498-45170520 CCTGGGTGACAGAGTTTGAATGG + Intronic
1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG + Intergenic
1116711925 14:48379178-48379200 CAAGGATGACAGAGGTTAAGTGG - Intergenic
1117967237 14:61218578-61218600 CAAGGGAAAAAGAGCTTAAGTGG + Intronic
1118864526 14:69692519-69692541 CTAGGGTGGAAGAATTTAATAGG + Intronic
1119464638 14:74846203-74846225 CTAGGCTGAAAGAGTTAATGCGG + Intronic
1120269889 14:82297959-82297981 CCAGAGTGAAAGAGTTGCAAAGG + Intergenic
1120982623 14:90303992-90304014 CCAAGGTGGAGGAGTTTAACAGG - Exonic
1121563487 14:94891955-94891977 CCAGGGTCACAGAGAGTAAGTGG + Intergenic
1126422112 15:48485687-48485709 CGAGGGTGAAAGAGAGCAAGAGG - Intronic
1128527492 15:68422400-68422422 CCAGGGGGATAGAATTTAACAGG - Intronic
1128561553 15:68671918-68671940 CCAGGGTTAAAGTGCTTAACAGG + Intronic
1129234256 15:74214279-74214301 CCAGCGTGAAAGACCTTAATGGG - Intergenic
1130145149 15:81268409-81268431 CCAGGCTGAGAGAAGTTAAGTGG + Intronic
1130393463 15:83480194-83480216 GAAGGGTGATAGAGTTAAAGAGG - Intronic
1132548242 16:543498-543520 CCAGGGTGAAAGAGAAAGAGCGG - Intronic
1133987386 16:10678812-10678834 CCAGGGAGAATGTGATTAAGCGG - Intronic
1134746077 16:16589613-16589635 CCAGGAGGAAAAAGTTCAAGAGG + Intergenic
1134999403 16:18764131-18764153 CCAGGAGGAAAAAGTTCAAGAGG - Intergenic
1137232761 16:46582838-46582860 TCAGGTTGAAAGAGTTTAAAGGG - Intronic
1137809242 16:51337129-51337151 CCAGGGTGAGTGATTTTAAGGGG - Intergenic
1137925749 16:52540080-52540102 CCAGCCTGAAAAATTTTAAGTGG - Intronic
1137952339 16:52795682-52795704 CCAGGGTACAAGAGTGAAAGGGG + Intergenic
1137961578 16:52886850-52886872 CCACTGTGAAAGATTTTAACTGG - Intergenic
1138146750 16:54619457-54619479 GCAGGTTGAAAGAGTTTCATGGG + Intergenic
1139013496 16:62662128-62662150 CCTGGGTGAAAGGGTTAAAAAGG - Intergenic
1140327291 16:74017185-74017207 CCAGGGTGGCAGAGGCTAAGTGG - Intergenic
1141070220 16:80947732-80947754 CCAGGGTGATAGAGTTGACATGG + Intergenic
1143349596 17:6277638-6277660 CCAGGGTGACAGAGGTAATGGGG - Intergenic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1144143590 17:12375351-12375373 CCAGGTTGTAAGAGATTAGGAGG + Intergenic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1150045379 17:61907712-61907734 CCAATTTGAAAGTGTTTAAGTGG - Intronic
1151016502 17:70560306-70560328 CCATGGTGATAGAGTACAAGAGG - Intergenic
1151317035 17:73329361-73329383 CCTGGGTAAAAGAGGGTAAGGGG + Intergenic
1151555370 17:74843823-74843845 CCAGGGTGGCAGGGTTGAAGAGG - Intronic
1151971908 17:77461958-77461980 CCAGGTTGAAGGCGGTTAAGCGG + Intronic
1154254253 18:12768785-12768807 CCAGGGTTGCAGAGATTAAGGGG + Intergenic
1154957209 18:21270516-21270538 CCAGGGTGTAAGAGTTCATAGGG + Intronic
1161486199 19:4537133-4537155 CCAGGGTGAAGGAGGAAAAGAGG - Exonic
1161728572 19:5945055-5945077 CCACAGAGAAAGAGTATAAGGGG - Intronic
1162098003 19:8322156-8322178 CCAGGGTGAGAGGGTTTGGGAGG + Intronic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
925611469 2:5706059-5706081 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
925611517 2:5706214-5706236 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
926496676 2:13597657-13597679 CAAAGGTGAAACAGTTTATGTGG - Intergenic
927630630 2:24771045-24771067 CTAGGGTGTAAGAGTTACAGAGG + Intergenic
930708395 2:54526618-54526640 ACAGGGTGGATGATTTTAAGGGG - Intronic
930879814 2:56258342-56258364 CCAGGGTGTAAGAAGTTATGGGG + Intronic
931174590 2:59840552-59840574 CCTGTGTGAAAGATTTTAAATGG + Intergenic
931865311 2:66404053-66404075 CCAGGGAGAGAGGGTTTAATAGG + Intergenic
932247081 2:70204953-70204975 CAAGGCAGAAAGAGTTTAAATGG - Intronic
932513911 2:72325431-72325453 CCAGAATGAATGAGTTAAAGAGG - Intronic
937528061 2:122795434-122795456 GCAGGGTGAAAGAGTTCCTGGGG - Intergenic
939273056 2:139964703-139964725 CCAGGGTGAAAAAGTTAAGCTGG + Intergenic
940250027 2:151664945-151664967 CCATGGTAAAAGAGGTTAAATGG + Intronic
946092912 2:217246614-217246636 GCAGGGGGAATGAGTTTCAGGGG - Intergenic
946485393 2:220096236-220096258 CCAGGGGCAAAGACTTGAAGTGG + Intergenic
946950344 2:224867489-224867511 CCTGGGGGCAAGAGGTTAAGAGG - Intronic
947348499 2:229218928-229218950 TGAGGATGAAAGACTTTAAGAGG - Intronic
948523400 2:238556441-238556463 CCAGGGAGAGAGAGTAGAAGGGG + Intergenic
1170190405 20:13639353-13639375 CCAGGGGGAAGGAGTGTAGGCGG + Intergenic
1170207246 20:13811594-13811616 GCAGGGTGAAGGTGTTTAATAGG + Intronic
1171009149 20:21498511-21498533 TCAGGGTGATAAAGTTTAAAAGG + Intergenic
1171174006 20:23037676-23037698 CCAAAGGGAAAGAGCTTAAGAGG + Intergenic
1172298389 20:33830324-33830346 CCAGGCTGAAAGATTTTGAATGG + Intronic
1172434541 20:34919763-34919785 CCAGGGTGAGACAGTTCAGGTGG + Intronic
1172960667 20:38796966-38796988 CCAGATTGAAAGAGATTAAAAGG - Intergenic
1173820302 20:46015128-46015150 CCAAGGTCAAAGAAATTAAGAGG + Intronic
1174376492 20:50129752-50129774 CCAGGGTGAATGTGTTTAGGGGG - Intronic
1174542439 20:51300306-51300328 ACAGGCTGTAAGAGTTAAAGAGG + Intergenic
1176916883 21:14636338-14636360 CAAGAGTGAGAGAGATTAAGAGG - Intronic
1177531716 21:22368139-22368161 CCAGGCTGAAGTAGTTTAAACGG - Intergenic
1178377076 21:32075588-32075610 ACAGTGAGAAAGAGTTGAAGGGG + Intergenic
1180171355 21:46060307-46060329 CCAGGGTGAAACAGTCACAGAGG + Intergenic
1181358495 22:22317080-22317102 CTAGGCAGAAAGAGTTCAAGAGG - Intergenic
1181795854 22:25309907-25309929 CCTGAGGGAAAGAGTTAAAGAGG + Intergenic
1181836384 22:25613436-25613458 CCTGAGGGAAAGAGTTAAAGAGG + Intronic
950577093 3:13838485-13838507 CCAGGCTCAGAGAGGTTAAGTGG - Intronic
951663988 3:25101828-25101850 CCAGGGTGGAAGAGGATATGGGG - Intergenic
952841667 3:37651854-37651876 CCAGGGTGACAGAGGTGAGGAGG + Intronic
953411708 3:42693900-42693922 CCAGGGTGACAGTGTTGAGGAGG - Intronic
954028930 3:47803987-47804009 CCAGGTTGAAAGCCTGTAAGTGG - Intronic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
954426058 3:50443725-50443747 CGAGGGTGAAGGGGTTGAAGAGG - Intronic
956536533 3:70282902-70282924 CCAGGATGAAATAGTAAAAGGGG + Intergenic
956671168 3:71692405-71692427 CCAGGGAAAAATAGTCTAAGTGG - Intronic
958012705 3:87900594-87900616 CCTGGGTGCAAGAGATTAATGGG + Intergenic
959682352 3:109109806-109109828 CCAGGGCAAAAGAGTTTCAGAGG + Intronic
960130089 3:114046448-114046470 CCAGAGTAAAATAGTTTCAGGGG + Intronic
960754524 3:120996551-120996573 ACAGGATGAATGAGTTTTAGAGG - Intronic
964487805 3:157203835-157203857 CTAGGATGAAAGAGATTACGTGG + Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966970958 3:185045014-185045036 CCAGTGTGAAACAGCTTAGGTGG + Intronic
967391672 3:188962159-188962181 CCAGGGGGAAAAAGTTAGAGAGG + Intronic
967539454 3:190648518-190648540 CGAAGGTGAAAGAGCTGAAGAGG + Intronic
969500050 4:7547175-7547197 CCAGGATGAATGAGATTTAGAGG - Intronic
970374544 4:15443555-15443577 CCAAGGTGTATGTGTTTAAGGGG + Exonic
970593364 4:17577923-17577945 CCAAGGTGAAAGGGTTTCTGAGG + Intronic
973752761 4:54040023-54040045 CCAGGGTTTAAGAGTTGACGAGG + Intronic
975026105 4:69550494-69550516 CCTAGGTGAAAGAGTTCATGAGG + Intergenic
975509010 4:75171843-75171865 CAAGGGTAAAGGAGTTTAGGAGG - Intergenic
976667180 4:87608236-87608258 TCAGGGTGACAGAGTTTAAGTGG + Intergenic
977769958 4:100846518-100846540 CCAGGGTGACAGAGTGCAAGTGG - Intronic
978722636 4:111930095-111930117 CCAGGGGAAAGGATTTTAAGAGG - Intergenic
978821572 4:112972561-112972583 CCTGGGTGAGAAGGTTTAAGAGG + Intronic
980462859 4:133139411-133139433 CCAGAATGCAAGAGTTTAAGTGG - Intergenic
981258962 4:142696588-142696610 CCAGGATGACCCAGTTTAAGTGG - Intronic
982637999 4:157921462-157921484 TCAGGGTGAGAGAGGTGAAGAGG + Intergenic
982851249 4:160318723-160318745 CCAGGGTGCCAGAGGTTAAGCGG - Intergenic
984880292 4:184404828-184404850 CCAGGGTGACAGAGTGCAGGAGG + Intronic
987359071 5:17090422-17090444 CCAGAGTGAAATAGCTTCAGTGG - Intronic
990770911 5:59243835-59243857 ACTGGGTCAAAGAGTTTAAATGG - Intronic
991121031 5:63014077-63014099 CCAGCATGAAAGAGTACAAGCGG - Intergenic
992743549 5:79797240-79797262 CAAGGGTGAAGGAGTTCTAGAGG - Intronic
995058177 5:107785844-107785866 CCAGGGTGCAAAATTTAAAGAGG + Intergenic
997006263 5:129819996-129820018 CCAACTTGAAAGAGTATAAGAGG - Intergenic
1001522519 5:172404797-172404819 CCAGGGTGACAGAGTTGGTGAGG + Intronic
1001524349 5:172418169-172418191 CCAGGCTCAGAGAGGTTAAGTGG - Intronic
1001569567 5:172721285-172721307 TCAGGGAGACAGAGTTTAAGAGG + Intergenic
1002275755 5:178103526-178103548 CGGGGGTGAAAGAGTCTAGGTGG + Intergenic
1004094722 6:12541648-12541670 CCAGGTTGGAAGAGTTTAAAAGG - Intergenic
1004147908 6:13086884-13086906 ACAAGGTGATAGAGTTTCAGTGG + Intronic
1007227583 6:40325770-40325792 ACAGGGTGAAAGAGGTGGAGAGG - Intergenic
1012110960 6:95233167-95233189 CCATGATGAAAGAGTCCAAGGGG + Intergenic
1013153241 6:107466897-107466919 CTAGGTTGAAAGATTTTAAGAGG + Intergenic
1013509729 6:110833675-110833697 CAAAGGCCAAAGAGTTTAAGAGG - Intronic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1016321547 6:142851864-142851886 TCACGGTGGAAGAGTTTCAGTGG + Intronic
1021239879 7:18187301-18187323 TGAGGGTCAGAGAGTTTAAGAGG + Intronic
1023124500 7:36942030-36942052 CCAGGGAGCAAGAGTTTTAGAGG + Intronic
1025621553 7:63176389-63176411 CCAAGGTGACAGAATTTACGAGG + Intergenic
1026471863 7:70700583-70700605 CTGGGGAGAAAGAGATTAAGGGG + Intronic
1027263053 7:76478712-76478734 CAAGGCTGAAAGAGGTCAAGGGG - Intronic
1027314436 7:76976817-76976839 CAAGGCTGAAAGAGGTCAAGGGG - Intergenic
1028863063 7:95676671-95676693 TCAGAGTGAAAGAGTCTATGAGG - Intergenic
1029627045 7:101726425-101726447 CCAGGGAGAAGGATTTTAATAGG - Intergenic
1031380574 7:121080739-121080761 CCAGAGAGAAAGAGATTGAGAGG + Intronic
1031991557 7:128202266-128202288 CCAGGCTGAAAGGGGTGAAGGGG - Intergenic
1034220499 7:149441270-149441292 CCAGTGGGGAAGAGTTTAAAAGG + Intronic
1034374663 7:150631451-150631473 CCAGGGACAAAGAGATTGAGAGG - Intronic
1034829063 7:154293504-154293526 CCAGGATGAAGGAGTTGATGGGG - Intronic
1036209798 8:6833006-6833028 CCAGCCAGAAAGATTTTAAGAGG - Intronic
1037125431 8:15342330-15342352 CTAGGTTATAAGAGTTTAAGTGG - Intergenic
1037965346 8:23129690-23129712 CCAGAGTCACAGAGTTGAAGAGG - Intergenic
1039181546 8:34872532-34872554 CTAGGATGAAAGAGTTCCAGAGG - Intergenic
1039566868 8:38558150-38558172 CCTGGTTGTCAGAGTTTAAGAGG + Intergenic
1042321416 8:67479320-67479342 GCAAGGTGAAAGATTTTTAGGGG - Intronic
1042960733 8:74301218-74301240 TCATGGAGAAAGAATTTAAGTGG - Intronic
1044275294 8:90292306-90292328 CTAGTGGGAAAGAGTTTAAAAGG - Intergenic
1045651185 8:104342826-104342848 CCGGGGTGCCCGAGTTTAAGGGG + Intronic
1048434985 8:134407846-134407868 CTAGGGAGAAAGAATTTCAGTGG + Intergenic
1057236900 9:93368292-93368314 CCAGGGTGACAGAGGCCAAGTGG - Intergenic
1185676411 X:1852778-1852800 CCTCGGTGTAAGAGTTAAAGAGG - Intergenic
1187025304 X:15429359-15429381 ACAGTGTGAAAAAGTCTAAGAGG + Intronic
1188331016 X:28871895-28871917 GGAGGCTGAAAGAATTTAAGAGG - Intronic
1189376232 X:40468272-40468294 CCAGGCTTAGAGAGGTTAAGTGG + Intergenic
1192690755 X:73360944-73360966 CTTGGGTGAAAGAGTGTGAGGGG - Intergenic
1193418596 X:81255238-81255260 TCAGGGTAAAAGAGTGTAAATGG - Intronic
1193928857 X:87527349-87527371 TCAGGGACAAAGAGTATAAGTGG - Intronic
1194407598 X:93516474-93516496 AAAGGGTCAGAGAGTTTAAGTGG - Intergenic
1197182648 X:123552829-123552851 CCAGGGTAAGAGAGTCTAAAAGG - Intergenic
1198234445 X:134723870-134723892 GCATGATGAAAGCGTTTAAGGGG + Intronic
1198256410 X:134927583-134927605 CTAGGGTGCAACAGTTGAAGTGG - Intergenic