ID: 1143783769

View in Genome Browser
Species Human (GRCh38)
Location 17:9242438-9242460
Sequence TGCCACAGCCCTTCTGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 258}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143783769_1143783779 6 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783779 17:9242467-9242489 CGATATCCCACCCTGGGTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1143783769_1143783778 5 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783778 17:9242466-9242488 ACGATATCCCACCCTGGGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
1143783769_1143783774 0 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783774 17:9242461-9242483 GCCCCACGATATCCCACCCTGGG 0: 1
1: 0
2: 1
3: 11
4: 182
1143783769_1143783787 28 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783787 17:9242489-9242511 GTCTCACGGGTGTCCTGTGAGGG 0: 1
1: 0
2: 1
3: 7
4: 99
1143783769_1143783773 -1 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783773 17:9242460-9242482 AGCCCCACGATATCCCACCCTGG 0: 1
1: 0
2: 0
3: 4
4: 95
1143783769_1143783782 14 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783782 17:9242475-9242497 CACCCTGGGTCTGGGTCTCACGG 0: 1
1: 0
2: 3
3: 36
4: 247
1143783769_1143783788 29 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783788 17:9242490-9242512 TCTCACGGGTGTCCTGTGAGGGG 0: 1
1: 0
2: 1
3: 9
4: 113
1143783769_1143783783 15 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783783 17:9242476-9242498 ACCCTGGGTCTGGGTCTCACGGG 0: 1
1: 0
2: 3
3: 27
4: 235
1143783769_1143783786 27 Left 1143783769 17:9242438-9242460 CCCTGCCCAGAAGGGCTGTGGCA 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1143783786 17:9242488-9242510 GGTCTCACGGGTGTCCTGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143783769 Original CRISPR TGCCACAGCCCTTCTGGGCA GGG (reversed) Exonic
900228302 1:1543167-1543189 TGCCCCGGCCCCTCTGTGCAAGG + Intronic
900655089 1:3752894-3752916 TTCCACAGGCCTTCTGGTGATGG + Intronic
900895707 1:5481507-5481529 GGCCACAGCTCTCCTGGGGATGG + Intergenic
901331229 1:8410311-8410333 TGCAACAGCCGTTCTGGGTGAGG - Intronic
901947881 1:12718410-12718432 TGCCACAGCCATTTTGGCCTTGG - Intronic
903279812 1:22244037-22244059 TGCCCCAGTCCTTTTGGCCAAGG + Intergenic
903539547 1:24089409-24089431 TGCCTGGGCCCTTCTGGCCAGGG + Intronic
903737787 1:25541343-25541365 TGCCACAGCCCTTTTGCAGAAGG + Intergenic
905172342 1:36116526-36116548 GCCCCCAGCCCTTCAGGGCAAGG - Intronic
905284474 1:36870286-36870308 TGCCTCAGCCCTTCTTGGGGAGG - Intronic
905360136 1:37413377-37413399 TGCCAGAGGACTCCTGGGCAGGG + Intergenic
905975010 1:42168372-42168394 TCCCACAGCCCCCCTGGCCAAGG + Intergenic
906286340 1:44590272-44590294 AGCCCAAGCCCTGCTGGGCAAGG + Intronic
906943054 1:50272712-50272734 TGTCACCTCTCTTCTGGGCAAGG - Intergenic
907689008 1:56644787-56644809 TGCCACTGCCCCTTTGGCCAGGG + Intronic
910749653 1:90615162-90615184 TGGCACAGTCCCTCTGGGCTGGG - Intergenic
913983261 1:143542730-143542752 TCCCACAGGGCATCTGGGCAAGG + Intergenic
916742159 1:167655542-167655564 TCCCAAACCCCCTCTGGGCAAGG + Intronic
919554044 1:199029375-199029397 GGCCACAGACCTTTTGGGGAAGG + Intergenic
919809258 1:201398836-201398858 TCCCACAGCCCCTCTTGGGAGGG - Intronic
919905002 1:202072326-202072348 TGCTGCAGCTCTTCTGGCCAAGG - Intergenic
920153875 1:203932718-203932740 TACCACAGCCCTGCTAGGCTGGG + Intergenic
920165246 1:204031232-204031254 TGCAACATCCTTGCTGGGCAAGG + Intergenic
921216805 1:212944759-212944781 TGCCACAAACTGTCTGGGCACGG + Intergenic
921492752 1:215798976-215798998 TGCCACAGCACTTCTGGCCATGG + Exonic
1063209029 10:3862030-3862052 GGCCACATTCCATCTGGGCATGG + Intergenic
1063449423 10:6141497-6141519 CGCCACAGCCGTGCTGGTCAGGG - Intergenic
1069684649 10:70309830-70309852 TGCCACAGGCTTGCTGGGCATGG + Intronic
1070525731 10:77294376-77294398 TGGCAGAGCCCTGCTGAGCATGG + Intronic
1070592987 10:77813395-77813417 TGCCCCAGCCCTCTTGGGAAGGG + Intronic
1070772335 10:79089719-79089741 TGGGACAGCCTTCCTGGGCAGGG + Intronic
1070950641 10:80428305-80428327 TGACACTGCCCTCCAGGGCAGGG - Intronic
1072633819 10:97164757-97164779 TGCCACGGCAGTCCTGGGCAGGG - Intronic
1073469665 10:103714797-103714819 TGCCACCACCCATCTGGCCAGGG - Intronic
1074801679 10:117006020-117006042 TGCCACTTCTCTCCTGGGCATGG - Intronic
1075052873 10:119195821-119195843 TGCCACAGGCATTCAGGGAAAGG - Intergenic
1075090451 10:119441379-119441401 TCCCACAGCCCACCTGGGCAGGG - Intronic
1076509074 10:130999429-130999451 TGTCTCTGCCCCTCTGGGCATGG - Intergenic
1076827339 10:132975637-132975659 TGCCTCAGCCCTTCCAGGCCTGG - Intergenic
1077105171 11:839095-839117 TTCCAAAACCCTTCTGGCCATGG + Intronic
1077504545 11:2924026-2924048 AGCCAGAGACCCTCTGGGCACGG + Intronic
1079115763 11:17639603-17639625 TGCCACTGGCTTTCTGGGTATGG + Intronic
1080132143 11:28808879-28808901 TGCCTCAGCCCTCTTGGGAAAGG - Intergenic
1081623171 11:44631048-44631070 TCCCCCAGCCCTTCTAGGCTGGG - Intergenic
1081642759 11:44767554-44767576 TGCCTCAGGCCCTATGGGCAGGG - Intronic
1081644329 11:44779121-44779143 CCCCACAGCCCTTTTTGGCAAGG + Intronic
1081744584 11:45463973-45463995 TGCCACAGCCCTGCAAGGGAAGG + Intergenic
1083315448 11:61812193-61812215 TGCCACAGCCCACCTGTGCCAGG - Intronic
1084757212 11:71247540-71247562 TGCCATGGCCCTGCTGGGCTGGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085459306 11:76683695-76683717 TGACTCAGCCCTTCTCAGCAAGG + Intergenic
1085459767 11:76686513-76686535 TGCCAAAGCCCATCAGGACACGG - Intergenic
1086967937 11:93049467-93049489 TGCCACGGTCATTCTGGGCATGG - Intergenic
1087073025 11:94100421-94100443 TGCCACAGGCCCTCTGAGCCAGG + Intronic
1089890436 11:121875260-121875282 TGACACAGCCCTTCTGGTTATGG + Intergenic
1090967871 11:131614302-131614324 CTGCACGGCCCTTCTGGGCATGG - Intronic
1091277529 11:134362611-134362633 TGCCGCAGCTGTTCTGGGCCAGG + Intronic
1091286101 11:134409402-134409424 TGCCCCAGCCCTCCTGGTCCTGG - Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1096096178 12:48937247-48937269 TGGGACAGCCCTACTGGGAAGGG + Exonic
1103906473 12:124330184-124330206 TGCCTCAGCCCCACTGGGCCAGG + Intronic
1104675385 12:130709021-130709043 TGACACAGCCCTTCTGCGGCAGG - Intronic
1105227276 13:18447837-18447859 TTCCACAGCTCTTTAGGGCAGGG - Intergenic
1106343150 13:28850429-28850451 AGCGACAGCCCTGCTGGGCTAGG + Intronic
1107058568 13:36131479-36131501 CGCCCCCGCCCTTCTTGGCAGGG + Intergenic
1108314526 13:49224398-49224420 TGCCACAGTCCTTCTGCTCATGG + Intergenic
1110904652 13:80871393-80871415 TGCCACTGCACTTCTGGCCTGGG + Intergenic
1113364318 13:109661952-109661974 TGGCACAGCATTACTGGGCAGGG + Intergenic
1113855910 13:113445417-113445439 TGCCACAGCCTGTCCTGGCATGG - Intronic
1114011725 14:18376291-18376313 TTCCACAGCTCTTTAGGGCAGGG - Intergenic
1114127365 14:19744769-19744791 TGCCAAAGCCCTGCAGGGCTTGG - Intronic
1114190482 14:20436400-20436422 TGGCCCAGCCCTTCTGGCCTTGG - Intergenic
1114826719 14:26089840-26089862 TGAAACAGCCCTTCAGGCCACGG + Intergenic
1115859875 14:37672495-37672517 TGCCACAGCACTCCAGGGCTAGG - Intronic
1115969501 14:38929605-38929627 TGCCACAGCTCATCTGAGAAAGG - Intergenic
1119213033 14:72847064-72847086 TCCCACAGCCCTTGTCTGCATGG - Intronic
1119401285 14:74364333-74364355 TGCCAGATCCCTTGTGAGCAGGG - Intergenic
1122497502 14:102169288-102169310 TGGCAGTGCCTTTCTGGGCAGGG - Intronic
1122868033 14:104618255-104618277 TGCCACAGCCCTTGCAGGAAAGG + Intergenic
1122906275 14:104803001-104803023 TGCCCCAGGCCTTCCTGGCAGGG - Exonic
1123040346 14:105487762-105487784 TGCGACAGCCCTTCTCGGCGGGG - Intronic
1124433817 15:29631637-29631659 TGCGCCAGACCTTCTAGGCAGGG + Intergenic
1124661770 15:31555601-31555623 TCCCACAGCCCATCTGGGTGAGG - Intronic
1125584880 15:40813156-40813178 TGCCCCAGCCCTGCAGGGCTGGG - Intronic
1125606773 15:40943934-40943956 AGCCACAGCCCTGCCAGGCATGG + Intergenic
1125802293 15:42460536-42460558 TGCGTATGCCCTTCTGGGCAGGG - Intronic
1126178973 15:45766225-45766247 TCCCACAGACCTTGTGGTCATGG - Intergenic
1127389280 15:58492150-58492172 GGCCACAGGCCATCTGGGGAGGG - Intronic
1128684772 15:69675680-69675702 TGCCCCACTCCTTGTGGGCATGG + Intergenic
1129329293 15:74818768-74818790 GGCCACACCCCTTCAGAGCACGG + Exonic
1129677215 15:77638173-77638195 TGCCACGGCCCTTCTGCACTGGG + Intronic
1132357116 15:101179876-101179898 TGCCTCAGTACATCTGGGCAAGG + Intronic
1132386476 15:101404306-101404328 TGCCACAGCCCATGTGAGCTGGG - Intronic
1132865918 16:2092680-2092702 TCCCACTGCCCTGCTGGCCACGG + Intronic
1133364065 16:5197099-5197121 TGCCACAGTCCATCTGTGCAAGG - Intergenic
1134691895 16:16196527-16196549 TGCCTCAGCCCCTCTGGGGCAGG + Intronic
1137008813 16:35303198-35303220 TACAATACCCCTTCTGGGCAAGG + Intergenic
1137402544 16:48165145-48165167 TCCCACAGCAGTTCTGGGAATGG + Intergenic
1138392989 16:56683616-56683638 TGACACAGCAGTTCTGGGGAAGG - Intronic
1138551079 16:57748842-57748864 CGCCACATCCTCTCTGGGCAGGG + Intronic
1141065230 16:80908700-80908722 AGCCACTGCACTCCTGGGCAGGG + Intergenic
1141786564 16:86204677-86204699 TGCCACAGACCTTCTGGATACGG - Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142185880 16:88694534-88694556 TCTGACAGCCCTCCTGGGCACGG + Intergenic
1142277921 16:89132668-89132690 TGCCCCAGCCCCTGTGGGCAAGG + Intronic
1142283448 16:89161057-89161079 CGCCACAGCCCACCTGGGCCTGG - Intergenic
1142379558 16:89723605-89723627 GGCCACATCCGTGCTGGGCAGGG - Exonic
1142995758 17:3759348-3759370 TGCCACAGAGACTCTGGGCATGG + Intronic
1143783769 17:9242438-9242460 TGCCACAGCCCTTCTGGGCAGGG - Exonic
1144203061 17:12958654-12958676 TGCCACACCCTTCCTGGGCAGGG - Intronic
1144834797 17:18151199-18151221 GGCCCCAGCCCCTCTGGCCAAGG + Exonic
1145322111 17:21772792-21772814 TGCCACAACCCATCAGGGAAAGG + Intergenic
1145903938 17:28506264-28506286 TGGCGCAGCCCCTCCGGGCAAGG + Intronic
1146016554 17:29238471-29238493 TCCCACTGCCCTTCAGGGGAAGG + Intergenic
1147743639 17:42682488-42682510 TGCCTCAGCCCTGCTGCGAAAGG - Intronic
1148679521 17:49465752-49465774 AGCCAGAGCCCTTCTATGCATGG + Intronic
1149585541 17:57783590-57783612 TGCCGCAGCCCCTCTGGGTTGGG + Intergenic
1150177385 17:63073993-63074015 CGCCAAAGCCGCTCTGGGCAAGG + Exonic
1150520764 17:65865335-65865357 TGCAACAGTCCTTCTTGGCTGGG - Intronic
1151473672 17:74333059-74333081 TCCCGCAGCACTTCTGGGCTCGG - Intronic
1151696823 17:75722105-75722127 TGCCACAGTCCATCTGGGGCTGG + Intronic
1152318143 17:79592888-79592910 TGCCAGGTTCCTTCTGGGCAGGG - Intergenic
1152894423 17:82902594-82902616 TGCCACAGCCCCTCTGGTGTCGG - Intronic
1154133355 18:11755166-11755188 GGCCACAGCCCTTGCAGGCAGGG - Intronic
1154526101 18:15291638-15291660 TTCCACAGCTCTTTAGGGCAGGG + Intergenic
1157595687 18:48862414-48862436 TGCCACAGCCCTGCTCCCCAAGG + Intronic
1158039278 18:53072661-53072683 TCCCACAGCCATTTTGTGCATGG - Intronic
1158733015 18:60046497-60046519 TGCCACATTACTTCTTGGCAAGG + Intergenic
1160007303 18:75076820-75076842 GGCCACAGCCCCTCCTGGCAGGG + Intergenic
1161218700 19:3107845-3107867 TGCCACCGCCCTTCTCTTCAGGG + Intronic
1163692153 19:18743850-18743872 TGTCACAGCCCTTCCTGGCCAGG + Intronic
1163839621 19:19598844-19598866 TGTCTCAGCCCTTATGTGCATGG - Intronic
1163841528 19:19613877-19613899 TGGCACAGCTCTTCTGTGCTAGG + Intronic
1164255472 19:23524475-23524497 TACAACAGCCCATGTGGGCAGGG + Intergenic
1164286369 19:23821224-23821246 TGCCACAGCCCTACTGGCATGGG - Intronic
1164684591 19:30158441-30158463 TGCCCCTGCCCTTCTCTGCAAGG - Intergenic
1165060768 19:33204268-33204290 GGCCACTGCCCTTTTGGGGAGGG + Intronic
1165103056 19:33450319-33450341 TCTCACTGCCTTTCTGGGCAGGG - Intronic
1165875460 19:39003430-39003452 TGCCACTGCACTCCTGGGCCTGG + Intronic
1166916500 19:46199092-46199114 TGGCCCAGCCCCTCTGGGAAGGG - Intergenic
925493835 2:4424236-4424258 CGGAACAGCCCTTCTGGGGAAGG + Intergenic
926222967 2:10948392-10948414 GGCCCCAGGCCTTCAGGGCATGG - Intergenic
926738293 2:16090844-16090866 TCCCACTGTCCTTCTGGGCCTGG + Intergenic
929187482 2:39110521-39110543 TGGCACAGCCCTGCTCTGCAAGG + Intronic
929443685 2:41986316-41986338 TGCCAGAGCCCCTGAGGGCAAGG + Intergenic
929992855 2:46804124-46804146 TGCCACAGCCCCACGAGGCAGGG - Intergenic
932307562 2:70714793-70714815 AGCCTCAGACCTTCTGGGGAAGG - Intronic
935747033 2:106197407-106197429 TGCAACAGCCCTGTGGGGCAGGG + Intergenic
935762777 2:106336839-106336861 TGCAACAGCCCTTTAGGGAAAGG - Intergenic
936060720 2:109294014-109294036 TGTCACATCCCTTCTTGGAATGG + Intronic
936965989 2:118128063-118128085 TGCCCCAGCCCTTCAGGACCTGG + Intergenic
938525205 2:132123003-132123025 TTCCACAGCTCTTTAGGGCAGGG + Intergenic
938949354 2:136242773-136242795 TCCCACAGCCCATCTGTGCCAGG - Intergenic
944513753 2:200490369-200490391 AGCCACGGCCCTGGTGGGCACGG - Exonic
945319696 2:208407025-208407047 TCCTACAGCCGTTCCGGGCATGG + Exonic
947530059 2:230903307-230903329 TGAAACTGCCCTTCTGGGGAAGG + Intergenic
948125363 2:235561060-235561082 TGCCACAAGCCTTCTGTGCATGG - Intronic
948556856 2:238817992-238818014 TGCCACAGCCCCACTGGGCCTGG - Intergenic
948669563 2:239559345-239559367 TCCCACTGCCCTCCTAGGCAGGG + Intergenic
948772642 2:240259339-240259361 TGCCAGGGCCCTTCTGGGAAAGG + Intergenic
1168967387 20:1907130-1907152 TGCCACATCCCTGCAGGGAAGGG - Intronic
1170119227 20:12893983-12894005 TGAAACAGCCCTTCAGGGAAAGG + Intergenic
1171226060 20:23442958-23442980 TGGAAAAGCCCTTGTGGGCAGGG - Intronic
1172409588 20:34711313-34711335 GGCCACAGGGCTTCTAGGCAGGG + Exonic
1172948538 20:38706782-38706804 TGCCAGGGTCCCTCTGGGCAGGG - Intergenic
1174179976 20:48668627-48668649 TGCCCCAGGCCTTCTGCCCAGGG - Intronic
1175970862 20:62686091-62686113 GGCCACTTCCCATCTGGGCAGGG + Intergenic
1176271621 20:64238271-64238293 GGGCAGAGCCCCTCTGGGCAGGG + Intronic
1178774708 21:35538646-35538668 TGAAACAGCTCTTCTGAGCATGG - Intronic
1179536955 21:42059082-42059104 TGGCTCAGCCCCTCTGGGGATGG + Intergenic
1179960138 21:44763566-44763588 AGGCACATCCCTGCTGGGCAGGG - Intergenic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1180436218 22:15307099-15307121 TTCCACAGCTCTTTAGGGCAGGG - Intergenic
1180518461 22:16171294-16171316 TTCCACAGCTCTTTAGGGCAGGG - Intergenic
1181057391 22:20266644-20266666 TGCCTCAGCCCTGGTGGGTAGGG + Intronic
1181278023 22:21699021-21699043 TGCCGCTGCCCTGGTGGGCATGG - Exonic
1182053594 22:27331955-27331977 TGCCACAGCCCTGCTGTCCTTGG + Intergenic
1182289307 22:29266239-29266261 TGGCACAGCCCCTCTGGCCCTGG + Intronic
949555032 3:5145427-5145449 TGCCACAGCCCTGCTGGTAGAGG - Intronic
950765342 3:15269224-15269246 TACGACAGGCCTTCTGGGCTGGG - Intronic
952263570 3:31764326-31764348 TGCCAAACTCTTTCTGGGCAGGG + Intronic
952549441 3:34460232-34460254 AGCACCAGCCATTCTGGGCAAGG - Intergenic
952901405 3:38114275-38114297 GACCACATCCCCTCTGGGCAAGG - Intronic
953556724 3:43951978-43952000 TGCCCCAGCAATTCTGGGAATGG + Intergenic
954364681 3:50139607-50139629 AGCCGCAGCCCATCGGGGCAGGG + Intergenic
965104044 3:164337037-164337059 TGCCTCAGCCCATCTGGAGAAGG + Intergenic
972829977 4:42803280-42803302 TTCCACAGCTCTTTAGGGCAGGG + Intergenic
973107370 4:46356944-46356966 GGACACAACTCTTCTGGGCAAGG - Intronic
974308728 4:60175807-60175829 TGCCTGAGCCCTTTAGGGCATGG + Intergenic
974824076 4:67104348-67104370 TGCCACAGGCTTGCTGTGCAGGG + Intergenic
974877916 4:67720479-67720501 TGCCACAGGCCTCCATGGCAAGG - Intergenic
976113294 4:81699968-81699990 TCTCTCTGCCCTTCTGGGCATGG - Intronic
982253997 4:153434853-153434875 TGCCACAGCACGGCCGGGCACGG + Intergenic
982478449 4:155879938-155879960 TTCCACAGACCTCCAGGGCAGGG + Intronic
983286338 4:165743906-165743928 TTCCAAAGCTGTTCTGGGCATGG - Intergenic
983911296 4:173242565-173242587 AGCTGCAGCCCTGCTGGGCATGG - Intronic
983938271 4:173518020-173518042 TCCCACAGCCCTTCGGGGTGAGG - Intergenic
985756257 5:1720384-1720406 TGCCAAGGCCATTCTGAGCATGG + Intergenic
985819124 5:2147969-2147991 TTCCACTGCACTTCTGTGCAGGG + Intergenic
985969779 5:3365878-3365900 GGCCATGGCCCTTCTGGGCATGG - Intergenic
986042485 5:4006907-4006929 TCCCACATCTCTTCTGGCCATGG + Intergenic
987173760 5:15285933-15285955 TGCCTCAGCCCTTCTTGACCTGG - Intergenic
991669698 5:69035797-69035819 TTCCACATGGCTTCTGGGCATGG - Intergenic
995485246 5:112633627-112633649 TGCCACCATCCTCCTGGGCAGGG + Intergenic
997064550 5:130546108-130546130 TGCCACAGCCCTGCTGGTAGAGG - Intergenic
997374319 5:133386116-133386138 TGTGACAGCCCTTCAGGGTAAGG - Intronic
998736312 5:145145342-145145364 GGCCCCAGCTCTTCTGGGCCTGG - Intergenic
998878201 5:146621072-146621094 TACGACAGCCCATCTTGGCATGG + Intronic
999264928 5:150260537-150260559 TACCAAAGGGCTTCTGGGCAGGG - Intronic
1001937272 5:175714429-175714451 TGCCAGAGCCCTGCAGAGCAGGG + Intergenic
1001982381 5:176046079-176046101 TGCCACAGCCCTTTTTGGGTAGG + Intergenic
1002205352 5:177559392-177559414 GCACACAGCCCTTCTGGGCGTGG - Intergenic
1002235080 5:177797978-177798000 TGCCACAGCCCTTTTTGGGTAGG - Intergenic
1003536759 6:6982149-6982171 TGGCACAACCCTTCCTGGCATGG - Intergenic
1003985387 6:11429847-11429869 TGACACAGCTCTTCCTGGCATGG - Intergenic
1005302924 6:24488818-24488840 TGCCACCGACCTTAGGGGCAAGG - Intronic
1005975443 6:30794664-30794686 TGGCACTGCCCAGCTGGGCATGG - Intergenic
1006017232 6:31091518-31091540 TATCACACCCCTTCTGGTCAAGG - Intergenic
1006438815 6:34040845-34040867 TGGCACGGCCCATCTGTGCATGG + Intronic
1006513880 6:34535494-34535516 TGCCCCAGCTCTCCTGGTCAGGG - Intergenic
1007410006 6:41656027-41656049 TGCCACAGCCCTGCGGAGCAGGG - Intergenic
1007830472 6:44634527-44634549 AGCTGCAGCCCTGCTGGGCATGG - Intergenic
1009833530 6:68969441-68969463 GGCTACAGCCCTTATGAGCAGGG + Intronic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1016352072 6:143178633-143178655 TGACAAAGCCCCTCTGGGGATGG - Intronic
1016386111 6:143532374-143532396 TGACAAAGTCCATCTGGGCAAGG + Intergenic
1017456223 6:154603879-154603901 TGCCACAGCCCAACTTGGCCAGG + Intergenic
1018294417 6:162330320-162330342 TTCCACAGCCCATTTGGGCCTGG - Intronic
1019481006 7:1266875-1266897 TGCCGCAGCCATTCTGGACCTGG + Intergenic
1019723160 7:2585916-2585938 TTCCACAGCCCTTCTAGTGATGG + Intronic
1019921096 7:4163690-4163712 AGCCGCAGCCTTCCTGGGCATGG + Intronic
1022012995 7:26325353-26325375 TGCCACTGCACTTCTGGCCTGGG - Intronic
1022470147 7:30677031-30677053 TGCCACCTCCCTCCTGGCCATGG - Intronic
1023882245 7:44326937-44326959 AGCCAGGGCCCTTCTGGGCCAGG + Intronic
1026412466 7:70139045-70139067 AGCCTCAGCCTTTCTGGGCTCGG + Intronic
1029111159 7:98213634-98213656 TGGTGCAGCCCTTCTGGGCATGG + Intergenic
1029632706 7:101763018-101763040 TGCCACAGAATCTCTGGGCATGG + Intergenic
1031935725 7:127733786-127733808 TGCCACTGCCCTTCTTTTCATGG + Intronic
1033570529 7:142624187-142624209 TGCCACAGCCCTTTGGTGCCAGG + Intergenic
1034072035 7:148195182-148195204 TTGCACATTCCTTCTGGGCAAGG + Intronic
1034821800 7:154222884-154222906 TGCCACAGCCTTTCAGGTCATGG + Intronic
1034906874 7:154956886-154956908 AGCCCCAGGCCTCCTGGGCACGG - Intronic
1036152983 8:6315695-6315717 TGCCACAGACCCCCTGGGGATGG - Intergenic
1037536693 8:19831201-19831223 TGACACAGCACATCTGGCCAAGG - Intronic
1038803022 8:30766288-30766310 TGCCAGAGGCCGTCTGGGAAAGG - Exonic
1039136874 8:34334860-34334882 TGAGACAGCCCTTCTGCACAGGG - Intergenic
1039444399 8:37619458-37619480 TGTCACAGCCCTTCACAGCATGG + Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1047506461 8:125484492-125484514 AGCCACAGCCCGCCTGAGCAGGG - Intergenic
1049387894 8:142353554-142353576 TGCCTCAGCCCTGCTGGGATAGG - Intronic
1049541378 8:143210692-143210714 TGCCTAAGACCTTCAGGGCAGGG - Intergenic
1049542008 8:143212944-143212966 TGCCTCAGCCCTGCAGTGCAGGG - Intergenic
1050324955 9:4490140-4490162 AGCCACTGCCCTCCTGGGCGCGG - Intergenic
1051076535 9:13244615-13244637 TAGCACATCCCTTCAGGGCATGG + Intronic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1053571875 9:39318334-39318356 TTCCACAGCTCTCCAGGGCAGGG - Intergenic
1053703916 9:40730455-40730477 TTCCACAGCTCTTTAGGGCAGGG + Intergenic
1053915138 9:42940055-42940077 TGCCACAGCTCTCATGGGCTGGG + Intergenic
1054093429 9:60877045-60877067 TTCCACAGCTCTCCAGGGCAGGG - Intergenic
1054114912 9:61152965-61152987 TTCCACAGCTCTCCAGGGCAGGG - Intergenic
1054125270 9:61300677-61300699 TTCCACAGCTCTCCAGGGCAGGG + Intergenic
1054413999 9:64854064-64854086 TTCCACAGCTCTTTAGGGCAGGG + Intergenic
1054592844 9:67029569-67029591 TTCCACAGCTCTCCAGGGCAGGG + Intergenic
1057205077 9:93166941-93166963 TCCCACAGCCGGGCTGGGCAAGG + Intergenic
1058309525 9:103483937-103483959 TGCCACCTCCCTGCCGGGCAGGG + Intergenic
1059482333 9:114601018-114601040 TGTCCCAGCCCCTCTGGCCATGG - Intergenic
1060550582 9:124483044-124483066 TGGCCCAGCCCTGATGGGCATGG - Intronic
1061909576 9:133715621-133715643 GGCCACAGCCCTTCTGTGTCGGG + Intronic
1062308671 9:135923748-135923770 CGCCCCAGCCCTTCTGGGTCAGG + Intergenic
1062549858 9:137080957-137080979 TGCGACAGCCATGCTGGGGAGGG + Intronic
1185731177 X:2463200-2463222 TGCCACAGCCTCTCTGAGTAGGG - Intronic
1187504563 X:19868303-19868325 TGCCACAGTCCTTTTGCGGAGGG - Intronic
1187908262 X:24087259-24087281 TGGCACAGCCTGGCTGGGCATGG - Intergenic
1192892665 X:75407422-75407444 TCCCACCTCCCTCCTGGGCAGGG - Intronic
1192938550 X:75887743-75887765 TGCCACAGTCGTTTTGGCCATGG - Intergenic
1194920346 X:99758060-99758082 TGCCATAGCCCTTGGTGGCAAGG - Intergenic
1197415149 X:126165471-126165493 TGCCGCAGCCCTGGTGGGCCTGG + Exonic
1197776651 X:130122497-130122519 TGTCACTGCACTTCAGGGCACGG + Intergenic