ID: 1143788735

View in Genome Browser
Species Human (GRCh38)
Location 17:9276416-9276438
Sequence AAGCACATACATCTGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143788735_1143788738 5 Left 1143788735 17:9276416-9276438 CCAGGCTACAGATGTATGTGCTT 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1143788738 17:9276444-9276466 GAGGGACAGATTTTGACTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143788735 Original CRISPR AAGCACATACATCTGTAGCC TGG (reversed) Intronic
904405406 1:30285179-30285201 AAGCACTGACATCTGAATCCTGG - Intergenic
904612380 1:31732658-31732680 AAGCACAGCCATCTGTGGTCGGG - Intronic
906904336 1:49873119-49873141 AAGTCCATACATCAGTAGGCAGG - Intronic
908783620 1:67714055-67714077 AACCAAACACATCTGCAGCCTGG - Intronic
910492981 1:87793693-87793715 AAGCATATACAGCTGTGGACAGG - Intergenic
911158801 1:94662076-94662098 AAGTCCATACATCAGTAGGCAGG + Intergenic
911220261 1:95237833-95237855 AGGCCCATACACCTGGAGCCTGG - Intronic
913705433 1:121417387-121417409 AAGAAGATGCATTTGTAGCCGGG + Intergenic
915141092 1:153769080-153769102 AAGCGCACACCACTGTAGCCAGG - Intronic
919169533 1:193936627-193936649 AAGCCCATACATCAGCAGACAGG - Intergenic
919768312 1:201141369-201141391 AACCACAGACATCTGTGACCTGG + Intronic
920235210 1:204498467-204498489 AAGCAGAGGCATCTGTAGACTGG + Intergenic
920665504 1:207959878-207959900 AGTCTCATACTTCTGTAGCCAGG - Intergenic
920854328 1:209651116-209651138 CAGCAGATACATTTGTAGCTTGG + Exonic
921052935 1:211523994-211524016 AATCACATACATTAGAAGCCTGG - Intergenic
923279041 1:232424349-232424371 AAGGACATACATCTTTCACCTGG + Intronic
1062830352 10:601450-601472 CACCACATCCATCTGGAGCCAGG - Intronic
1068584004 10:58776334-58776356 AAGCACTGTAATCTGTAGCCAGG - Intronic
1070251178 10:74774378-74774400 AAGCCCATACATCAGTAGGCAGG + Intergenic
1077534677 11:3117887-3117909 AAGTCCATACATCAGTAGGCAGG - Intronic
1078051553 11:7969343-7969365 AAGTCCATACATCAGTAGGCAGG + Intergenic
1078659214 11:13272884-13272906 ATGCACACACATCTGTATGCAGG + Intergenic
1078795217 11:14585622-14585644 AAGCACATAAAAGTCTAGCCTGG + Intronic
1081718760 11:45270787-45270809 AAGCACATCAATCTCTAACCTGG + Intronic
1083239497 11:61376661-61376683 AAGTCCATACATCGGTAGGCAGG - Intergenic
1089074596 11:115728157-115728179 GAGCACAGACAACTGTTGCCAGG - Intergenic
1090100329 11:123788593-123788615 AAGTCCATACATCAGTAGGCAGG + Intergenic
1093708472 12:22302388-22302410 AAGTCCATACATCAGTAGGCAGG - Intronic
1098408916 12:70158149-70158171 AAGCCCATACATCAGTAGGCAGG - Intergenic
1099028457 12:77495089-77495111 AAGCATTTACAACTGTAGCGGGG + Intergenic
1099508858 12:83509177-83509199 AAGCCCAGACATCTCTGGCCAGG + Intergenic
1102534947 12:113574658-113574680 AAGCACACAGATCTGAAGTCAGG - Intergenic
1104030336 12:125060539-125060561 AAGTCCATACATCAGTAGGCAGG + Intergenic
1104430755 12:128714067-128714089 AAGCCCATTCATCTGCAGCCTGG + Intergenic
1106461510 13:29974318-29974340 AAACACATACCTGTGTATCCAGG + Intergenic
1107277086 13:38689395-38689417 AATCACAAACCGCTGTAGCCCGG - Exonic
1107626577 13:42292160-42292182 AAACACATACTACTGGAGCCTGG - Intronic
1108171083 13:47742741-47742763 GAACATATACATCTGAAGCCAGG + Intergenic
1113285921 13:108848964-108848986 GAGCACACAGATCTGCAGCCAGG + Intronic
1113646917 13:112004648-112004670 CACCACATACATCCGTAGTCAGG + Intergenic
1116141884 14:41006503-41006525 AAGCAGGTACATCTGTAGCTTGG - Intergenic
1117187459 14:53255063-53255085 AAGTCCATACATCAGTAGGCAGG + Intergenic
1117733166 14:58744302-58744324 ATACACATACATCAGAAGCCGGG + Intergenic
1125969820 15:43902802-43902824 AACAAAATACATCTGTAGGCTGG + Intronic
1126707208 15:51416719-51416741 AAGTCCATACATCAGTAGTCAGG + Intergenic
1128178858 15:65582264-65582286 AAACCCATACATCTATTGCCAGG + Intronic
1128289251 15:66464358-66464380 AAGTCCATACATCAGTAGGCAGG + Intronic
1128809983 15:70563710-70563732 CAGCACTTACCTCTGTGGCCAGG + Intergenic
1128939755 15:71778492-71778514 AAGCACACAGCTCTGCAGCCTGG + Exonic
1130418933 15:83722024-83722046 AAAAACATAAATCTGTGGCCAGG - Intronic
1131578744 15:93619150-93619172 TAGCACAAACATTTGTACCCGGG - Intergenic
1131594588 15:93784252-93784274 AAACACAGACATCTCTAGCAAGG + Intergenic
1133102744 16:3489075-3489097 AGCCACAGACAGCTGTAGCCAGG - Intergenic
1134512472 16:14859513-14859535 AGACAAATACATCTGTGGCCAGG + Intronic
1134700112 16:16258014-16258036 AGACAAATACATCTGTGGCCAGG + Intronic
1134865459 16:17603098-17603120 AAGCAAATACATTTGAACCCAGG - Intergenic
1134971714 16:18536648-18536670 AGACAAATACATCTGTGGCCAGG - Intronic
1138336082 16:56253697-56253719 ATGCACAGACATGTGTAGCCAGG + Intronic
1143788735 17:9276416-9276438 AAGCACATACATCTGTAGCCTGG - Intronic
1144814604 17:18025253-18025275 CAGCAGCTGCATCTGTAGCCAGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147515658 17:41115323-41115345 AAGTCCATACATCAGTAGGCAGG - Intergenic
1149258906 17:54858027-54858049 AAACACAAGCATCTGTACCCAGG - Intergenic
1150861430 17:68804937-68804959 AAAGGCACACATCTGTAGCCTGG + Intergenic
1151166576 17:72209095-72209117 AAGCACACATATCTAGAGCCTGG + Intergenic
1153932781 18:9893586-9893608 AATCACATACATGTTTGGCCAGG - Intergenic
1157912897 18:51636036-51636058 AAGTCCATACATCAGTAGGCAGG - Intergenic
1162311282 19:9908870-9908892 AAGAAAATACATTTTTAGCCAGG - Intronic
1163398686 19:17078758-17078780 AAGCAGATACCTTTGAAGCCCGG + Intronic
1166357764 19:42237133-42237155 AAGAAAACACATCTGTGGCCTGG - Intronic
1167844652 19:52151943-52151965 AAGTTCATACATCAGTAGCCAGG - Intergenic
1168013267 19:53551321-53551343 AAGCACATACATGTTTAGAGGGG - Intronic
926065145 2:9832765-9832787 CACCACATACATCTTTAGGCTGG + Intergenic
926634594 2:15166087-15166109 AAGCACATACCTCTGTGGTGGGG + Intergenic
926756320 2:16239000-16239022 CATAACATACAACTGTAGCCAGG - Intergenic
928584456 2:32744753-32744775 AAGCACATACATCCATGGCCGGG + Intronic
928626250 2:33142672-33142694 AAGAACATATGTCTGTAGCCAGG + Intronic
928898201 2:36289043-36289065 TAACACATACATTTGTAGCTTGG - Intergenic
929354262 2:41000727-41000749 GAGCATATACCTCTGTATCCAGG - Intergenic
930093077 2:47545464-47545486 AAAGACATCCATCTGTATCCAGG - Intronic
930414665 2:51076319-51076341 AAGTCCATACATCAGTAGGCAGG + Intergenic
931947539 2:67326959-67326981 AAGCACATGGATCTGTGGTCAGG + Intergenic
935379539 2:102437277-102437299 AATCACATACATATGTGCCCTGG - Exonic
939811881 2:146842753-146842775 AACCACATACCTCTGTAGGAAGG - Intergenic
940302478 2:152189740-152189762 AAGCCCATAGATCCTTAGCCAGG + Intergenic
940987909 2:160066729-160066751 AAGTCCATACATCAGTAGGCAGG + Intergenic
942377289 2:175350636-175350658 CAGCACACACATCTGTAGGTGGG + Intergenic
943598129 2:189881540-189881562 AAGTCCATAGATCTGTAGGCAGG + Intronic
946701178 2:222415920-222415942 AAGTCCATACATCAGTAGGCAGG - Intergenic
947270574 2:228329465-228329487 AAGCACTTCCATCTGTCACCAGG - Intergenic
948287689 2:236799220-236799242 AAGCAATTACCTCTGCAGCCAGG + Intergenic
1174446070 20:50592294-50592316 ATGCCCACACATCTGTGGCCAGG + Intronic
1177589194 21:23139799-23139821 AAGTCCATACATCTGTAGGGAGG + Intergenic
1182920873 22:34077618-34077640 AAGGAAATAAATCTGTAGACCGG - Intergenic
1183519019 22:38285562-38285584 AAGCACCTACATCTTCATCCAGG + Intergenic
1185175809 22:49325893-49325915 AAGCACACACATGTGAAGACAGG + Intergenic
1185406138 22:50652415-50652437 AAGTCCATACATCAGTAGGCAGG - Intergenic
952823283 3:37503428-37503450 AATGACTTACATCTTTAGCCAGG + Intronic
954617878 3:51979181-51979203 TAGCACATCCATCTGTAGCTTGG + Intronic
955534725 3:59910731-59910753 AAGTCCATACATCAGTAGGCAGG + Intronic
957671821 3:83315023-83315045 AAACACATACATCTGTATTACGG - Intergenic
958459458 3:94376031-94376053 AGGAAAATGCATCTGTAGCCAGG - Intergenic
958953633 3:100443023-100443045 AAGTCCATACATCAGTAGGCAGG + Intronic
959970252 3:112401008-112401030 AAGTTCATACATCAGTAGGCAGG + Intergenic
962180118 3:133197771-133197793 TAGCAGATACCTCTGTACCCTGG - Intronic
963914269 3:150843021-150843043 AAGTCCATACATCAGTAGGCAGG - Intergenic
964022877 3:152035298-152035320 AAGTCCATACATCAGTAGGCAGG + Intergenic
965342460 3:167507035-167507057 TGGCACATACAACTGTGGCCAGG - Intronic
965948376 3:174271043-174271065 AACCACAGTCATCTGTATCCAGG + Intronic
968227520 3:196983645-196983667 ATGCACATGTATGTGTAGCCAGG - Intergenic
968301014 3:197614710-197614732 AAGTCCATACATCAGTAGGCAGG + Intergenic
970002133 4:11374783-11374805 ATGCAAAAACATCTGAAGCCTGG - Intergenic
971141866 4:23933346-23933368 AAGCAAATATATCTGATGCCTGG + Intergenic
971161772 4:24140781-24140803 AAGCACATTCATCAGGAGCTGGG - Intergenic
971693203 4:29864685-29864707 AAGTCCATACATCAGTAGGCAGG - Intergenic
973063364 4:45757784-45757806 AAGCAGAAACATTTGTTGCCTGG - Intergenic
974157412 4:58092243-58092265 AAGAACATACATGTGAAGCTGGG - Intergenic
974456093 4:62130817-62130839 CAGCACATATGCCTGTAGCCAGG + Intergenic
975171615 4:71238392-71238414 TAGCACACAAATCTGTAGCCAGG + Intronic
975412043 4:74064664-74064686 AAACCCATACATCAGTAGACAGG - Intergenic
979603821 4:122615593-122615615 ATACACACACACCTGTAGCCAGG - Intronic
983474758 4:168199713-168199735 ATGCACATACACCTGCAGTCTGG + Intergenic
985270099 4:188185960-188185982 AAACATATACATCTGTAGATAGG - Intergenic
987068610 5:14314409-14314431 TAGCAACTACAACTGTAGCCTGG + Intronic
989487962 5:42013717-42013739 AAGCAAACACAGCTGTACCCTGG + Intergenic
989722809 5:44550099-44550121 AGGCAAAAACATCTGTGGCCAGG - Intergenic
989973334 5:50551477-50551499 AAGAAGATACATTTGTAACCAGG - Intergenic
991037218 5:62139550-62139572 AAGTACATACATGTATGGCCTGG - Intergenic
993570545 5:89533459-89533481 AAGCACACACATCTCCAGCTTGG - Intergenic
994679807 5:102872230-102872252 AAGCACATATATCTATTGCCAGG + Intronic
995838921 5:116424785-116424807 AAGCACATAACTGGGTAGCCAGG - Intergenic
997832556 5:137163536-137163558 CTGCACATACATTTGTATCCAGG - Intronic
1001096584 5:168780037-168780059 AAACACAGACATCTGGAGTCAGG + Intronic
1002077698 5:176718711-176718733 AGGCACTTACATTTCTAGCCAGG - Intergenic
1002547851 5:179963090-179963112 CATCACACACATCTGGAGCCTGG - Intronic
1002703738 5:181146694-181146716 AAGTCCATACATCAGTAGGCAGG - Intergenic
1003957039 6:11173682-11173704 AAGCAAATTCCTCTGCAGCCTGG - Intergenic
1005322647 6:24669804-24669826 AAGTCCATACATCAGTAGGCAGG + Intronic
1005371214 6:25135809-25135831 AAGTCCATACATCAGTAGGCAGG - Intergenic
1005517559 6:26569374-26569396 AACCCTATACATCTGAAGCCGGG + Intergenic
1007438131 6:41832375-41832397 CAGTACATACATATGTAGCTAGG - Intronic
1007539227 6:42625743-42625765 AAACACATACATCTCTAGGCTGG - Intronic
1009197175 6:60701131-60701153 AAGCACTTACAATTGTTGCCTGG + Intergenic
1009332893 6:62445830-62445852 AAGCACATCCTTGTGTACCCTGG - Intergenic
1011285891 6:85722317-85722339 AAGCTCATACATCAATAGGCAGG + Intergenic
1011830684 6:91367837-91367859 AAGAACAGACAACTGTAGCATGG + Intergenic
1016457887 6:144250094-144250116 AAGCACAAAAATCTGTTGCAAGG + Intergenic
1018179875 6:161213663-161213685 AAGCCCATACATCAGTAGGCAGG - Intronic
1019560686 7:1655106-1655128 ACGCACACACATATGTAGCCTGG - Intergenic
1019627317 7:2024074-2024096 AAATTCATAAATCTGTAGCCAGG + Intronic
1021147869 7:17111328-17111350 AAGTCCATACATCAGTAGGCAGG - Intergenic
1028425358 7:90681197-90681219 AAGCAAAAACATCTGGTGCCAGG - Intronic
1029597091 7:101543687-101543709 AAGCAACTTCATCTGCAGCCTGG + Intronic
1030855596 7:114552118-114552140 AACTACATACATTTCTAGCCTGG - Intronic
1031227250 7:119055199-119055221 AAGTCCATACATCAGTAGGCAGG + Intergenic
1032060925 7:128724485-128724507 AAGAAGATAGATCTGTAGCATGG - Intronic
1032870833 7:135982897-135982919 AAGTCCATACATCAGTAGGCAGG + Intergenic
1034082901 7:148297039-148297061 AGGAACATATATCTGTAGACTGG + Intronic
1038080257 8:24126758-24126780 AAGAACATACATCTCTAGTGGGG + Intergenic
1043413335 8:80022666-80022688 AAGCACATTCAAGTGGAGCCTGG - Intronic
1045302253 8:100921987-100922009 AAGCAAATATATCTCTGGCCTGG + Intronic
1046017222 8:108619533-108619555 AAGCACAAAGAGCTGTGGCCAGG - Intronic
1047532792 8:125692577-125692599 AAGCACTTACAACAGTACCCAGG - Intergenic
1048364371 8:133725479-133725501 TAGCACATGATTCTGTAGCCTGG - Intergenic
1049448413 8:142642736-142642758 AAGCCCATACATTAGTAGGCAGG + Intergenic
1053058939 9:35013547-35013569 AAGTTCATACATCAGTAGGCTGG + Intergenic
1057909619 9:99007662-99007684 AAGTCCATACATCAGTAGGCAGG + Intronic
1058384263 9:104415264-104415286 AAGTCCATACATCAGTAGGCAGG - Intergenic
1187570868 X:20499992-20500014 AATGCCATACATCTGTAGCAGGG - Intergenic
1188482026 X:30646195-30646217 AAGAACATACATCTTCAGGCCGG + Intergenic
1190951741 X:55152290-55152312 AAGTCCATACATCTGTAGGCAGG - Intronic
1190955936 X:55193412-55193434 AAGTCCATACATCAGTAGGCAGG + Intronic
1191612680 X:63133909-63133931 AAGTTCATACATCAGTAGGCAGG + Intergenic
1191623617 X:63245017-63245039 AAGTTCATACATCAGTAGGCAGG - Intergenic
1193319479 X:80104947-80104969 AAGTCCATACATCAGTAGGCAGG - Intergenic
1193911700 X:87314547-87314569 AAGCCCATACATTAGTAGGCAGG - Intergenic
1195225587 X:102789145-102789167 AAGTCCATACATCAGTAGGCAGG + Intergenic
1196058563 X:111383258-111383280 AAGGACATAAATCTATAGCTGGG - Intronic
1199185883 X:144914143-144914165 AAGTCCATACATCAGTAGGCAGG + Intergenic
1199321179 X:146441080-146441102 AAGTCCATACATCAGTAGGCAGG + Intergenic
1199887205 X:152031971-152031993 AAGTCCATACATCAGTAGGCAGG + Intergenic
1200285085 X:154813312-154813334 AAGTCCATACATCAGTAGGCAGG + Intronic
1202263005 Y:22989290-22989312 CAACACATATATCTGGAGCCAGG + Intronic
1202415995 Y:24623031-24623053 CAACACATATATCTGGAGCCAGG + Intronic
1202454792 Y:25047055-25047077 CAACACATATATCTGGAGCCAGG - Intronic