ID: 1143793597

View in Genome Browser
Species Human (GRCh38)
Location 17:9318005-9318027
Sequence CGAGTTCATATGTAAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143793597_1143793600 29 Left 1143793597 17:9318005-9318027 CCCAATTCTTACATATGAACTCG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1143793600 17:9318057-9318079 AGTCTATGGCATGCTATAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 71
1143793597_1143793599 15 Left 1143793597 17:9318005-9318027 CCCAATTCTTACATATGAACTCG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1143793599 17:9318043-9318065 ACACACTTGAGCAAAGTCTATGG 0: 1
1: 0
2: 1
3: 19
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143793597 Original CRISPR CGAGTTCATATGTAAGAATT GGG (reversed) Intronic
907557818 1:55360049-55360071 CCACTTCATATATAAGAATTTGG - Intergenic
908603909 1:65772648-65772670 TAAGTTTATATCTAAGAATTTGG - Intergenic
909889971 1:80993000-80993022 CGAGTTCATATATTAAAACTCGG + Intergenic
910172337 1:84391061-84391083 AAAATTCATATGTAAGTATTGGG - Intergenic
920240279 1:204542154-204542176 CGAGGGCATATGTATGTATTTGG + Intronic
921899755 1:220437457-220437479 CAAGATGATATGTAAGTATTAGG + Intergenic
923284681 1:232481995-232482017 AGAGGAGATATGTAAGAATTAGG - Intronic
923409962 1:233698140-233698162 TGAGTCCATGTGTAAGATTTAGG - Intergenic
924172307 1:241356155-241356177 CAAGTTCAGATGCAAGTATTGGG - Intronic
924402617 1:243703143-243703165 GTAGTTCATATGTGAAAATTTGG - Intronic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1068603852 10:58983698-58983720 AAAGCTCATATGTAAGAACTAGG + Intergenic
1072437423 10:95426926-95426948 TGAGTACATGTGTGAGAATTAGG - Intronic
1073121675 10:101125781-101125803 CCATATCTTATGTAAGAATTGGG + Intronic
1074542842 10:114379701-114379723 AGTGTTCACATGTAAGAATGTGG - Intronic
1088187261 11:107184889-107184911 CGAGATCTTATGAAATAATTTGG - Intergenic
1097355131 12:58592709-58592731 CAAATTCAAATGTAAGCATTTGG + Intronic
1099260394 12:80373485-80373507 TCAGTTCATATCTAAGAATCTGG - Intronic
1100046515 12:90387889-90387911 CTAGTTCTTATTTAAGAGTTTGG - Intergenic
1101447799 12:104750027-104750049 CGACTTCATATGGCAGAACTAGG - Intronic
1105565315 13:21539921-21539943 CAATTTCATATGTATGAAATAGG - Intronic
1109655556 13:65386623-65386645 AGAGTACATATCTGAGAATTAGG - Intergenic
1116311756 14:43335843-43335865 TGAGTTCATTTCTAAGAAGTGGG + Intergenic
1130397443 15:83515216-83515238 CGAGTTCATAAGTGAGAGTGAGG + Intronic
1132357305 15:101181379-101181401 CGTGTTCATTGTTAAGAATTTGG - Intronic
1133877685 16:9750393-9750415 TGAGGTCATAGGGAAGAATTTGG + Intergenic
1138199214 16:55076664-55076686 CAAGCTCAAATGTAAGAGTTGGG + Intergenic
1142589489 17:996051-996073 CGAGGTCATCAGTCAGAATTGGG - Intergenic
1143793597 17:9318005-9318027 CGAGTTCATATGTAAGAATTGGG - Intronic
1149275703 17:55032937-55032959 TGAGTTCATATTTAAGAATCGGG - Intronic
1149419763 17:56498316-56498338 CTAGTTCACATATAAGAACTAGG + Intronic
1153307176 18:3642379-3642401 CGATTTCAGATGTTTGAATTTGG + Intronic
1155248096 18:23929869-23929891 CGAGAGCAGATGGAAGAATTAGG + Intronic
1156714911 18:39996541-39996563 CTATTACATATGTAAGAATTAGG + Intergenic
1157294262 18:46431226-46431248 TGAGTTCATTTTTAAAAATTTGG + Intronic
1157995697 18:52552556-52552578 TGAGTTCATTTTTAAAAATTTGG + Intronic
1164127614 19:22332848-22332870 TGGGTTCATGTGTAAGATTTAGG + Intergenic
926358431 2:12062722-12062744 AGAATTCATAGCTAAGAATTTGG - Intergenic
928052038 2:28009064-28009086 CGAGTTTATATGAAATTATTTGG + Intronic
928799948 2:35076890-35076912 TTACTTCATCTGTAAGAATTGGG - Intergenic
935362866 2:102262490-102262512 AGAGCTCTTTTGTAAGAATTTGG + Intergenic
938925282 2:136034647-136034669 AGAGGTCATATGTAAGAAGAGGG + Intergenic
1175057987 20:56215638-56215660 CGAGTTCCTAGATAGGAATTTGG - Intergenic
1179001247 21:37461006-37461028 CTATTTCAGCTGTAAGAATTTGG + Intronic
1180248499 21:46564082-46564104 CCAGTTCCTATGTAGGATTTTGG + Intronic
965440440 3:168706497-168706519 CCTATTCATATGTAAGATTTTGG - Intergenic
965864406 3:173187799-173187821 CCAGTTCATATTTAATACTTTGG - Intergenic
970135469 4:12918125-12918147 CTAGTTCTTATGTATGGATTTGG - Intergenic
974481971 4:62456709-62456731 TGAGTTCATTTTTGAGAATTGGG - Intergenic
975174793 4:71275786-71275808 TGAGTTATTATGTAAGAACTAGG - Intronic
979612526 4:122704269-122704291 CTAGTTTACATGTAAGAATGGGG - Intergenic
980272831 4:130608939-130608961 CCAGTTTGTATGTAAGAATCAGG - Intergenic
980565085 4:134529287-134529309 GGAGTTCTTATGCAAGAATATGG - Intergenic
981954214 4:150449637-150449659 CAAATTCTTCTGTAAGAATTTGG - Intronic
982636078 4:157898444-157898466 CCAGATCATATGCAAGAATATGG - Intergenic
982724873 4:158895831-158895853 CGAGTCCATGTGAAAGAATTAGG + Exonic
983645285 4:169983475-169983497 CAATTCCATATGTAAGAACTTGG + Intergenic
986818453 5:11438432-11438454 GTAGTTCATATATTAGAATTTGG - Intronic
987999748 5:25332270-25332292 TTAGTTCATGTATAAGAATTTGG + Intergenic
990584555 5:57197867-57197889 TTAGTTCATATTTAAGAATGAGG + Intronic
991418236 5:66413786-66413808 CTAGTCCATAGTTAAGAATTAGG + Intergenic
993816044 5:92546798-92546820 TGTTTTCATATGTGAGAATTAGG - Intergenic
995708620 5:115012019-115012041 CGAGTTCATATTCAAGAGGTGGG - Intergenic
1007013892 6:38443455-38443477 CGAGTTGATATGCCAGAATAAGG - Intronic
1008985208 6:57534170-57534192 CGAGTTCATATATAGGTATGCGG + Intronic
1012647897 6:101711441-101711463 AGAGATCATATGTAAGTATATGG - Intronic
1012832257 6:104219057-104219079 AAAATTCATATGTAAGCATTTGG - Intergenic
1013285064 6:108674072-108674094 TGATTTCATCTGTAAGAAATAGG + Intronic
1020821438 7:12972972-12972994 GAAGTTCATATGTAACACTTTGG + Intergenic
1027713123 7:81632693-81632715 CTAATTCATATGCAAGAATGTGG - Intergenic
1030175919 7:106653298-106653320 CTAGTTCTTCTGTAAGATTTGGG + Intergenic
1030545786 7:110893697-110893719 AGTGTTCATATTCAAGAATTTGG - Intronic
1032024824 7:128432752-128432774 CCAATTCATATGTAAGTGTTGGG + Intergenic
1037887806 8:22604296-22604318 AGATTTCATATTTGAGAATTAGG + Intergenic
1038154228 8:24972611-24972633 CAAGTTATTTTGTAAGAATTAGG + Intergenic
1042513974 8:69640573-69640595 AGAGTTCATATGAAAAAAATGGG - Intronic
1044617964 8:94161660-94161682 CGATTTAATTTGTAATAATTGGG - Intronic
1051798998 9:20910087-20910109 CAAGTTCCTATGGAAAAATTAGG - Intronic
1055015018 9:71607014-71607036 CAATTTTGTATGTAAGAATTGGG + Intergenic
1058904407 9:109469997-109470019 TGAGTTCATAGGGAAGAATTGGG - Intronic
1059685335 9:116629622-116629644 CGATTTCTTATATAGGAATTGGG - Intronic
1185953208 X:4459239-4459261 CGACTACATTTGAAAGAATTTGG + Intergenic
1190116972 X:47631723-47631745 CAAATTCAAATGTAATAATTTGG + Intergenic
1195843468 X:109200570-109200592 AGAGTTCATAAGAAAGAAATTGG - Intergenic
1196961501 X:121007973-121007995 GGAGTTCATATGTTATTATTAGG + Intergenic