ID: 1143794615

View in Genome Browser
Species Human (GRCh38)
Location 17:9326694-9326716
Sequence ATTCCAACACAGAAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 8, 3: 44, 4: 369}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143794610_1143794615 14 Left 1143794610 17:9326657-9326679 CCACATGTCCCTGGTGATAAGAC 0: 1
1: 0
2: 0
3: 5
4: 123
Right 1143794615 17:9326694-9326716 ATTCCAACACAGAAGGGACATGG 0: 1
1: 0
2: 8
3: 44
4: 369
1143794611_1143794615 6 Left 1143794611 17:9326665-9326687 CCCTGGTGATAAGACACTAGTGC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1143794615 17:9326694-9326716 ATTCCAACACAGAAGGGACATGG 0: 1
1: 0
2: 8
3: 44
4: 369
1143794612_1143794615 5 Left 1143794612 17:9326666-9326688 CCTGGTGATAAGACACTAGTGCT 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1143794615 17:9326694-9326716 ATTCCAACACAGAAGGGACATGG 0: 1
1: 0
2: 8
3: 44
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143794615 Original CRISPR ATTCCAACACAGAAGGGACA TGG Intronic
902050939 1:13563215-13563237 GGTCCAGCACAGATGGGACATGG - Intergenic
903082214 1:20820027-20820049 ATCCCAACTCAGAAGGGGCAGGG - Intronic
903644233 1:24883397-24883419 CTTCCAAAACAGAAGGCACCAGG - Intergenic
904379474 1:30101371-30101393 ATACCAACCAGGAAGGGACATGG + Intergenic
907733452 1:57089463-57089485 ATTGCAAAACAAAAGGGAGATGG + Intronic
908574817 1:65448647-65448669 CTTCCAAAACAGAAAGCACAAGG - Intronic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909679404 1:78275158-78275180 ATTTAAACATAGAAGGGACAGGG - Intergenic
910710955 1:90179877-90179899 AATCCAACACAGAAGGGGATGGG - Intergenic
911422850 1:97666452-97666474 ATTAAAACACAGAAGGGGCCAGG - Intronic
911569283 1:99503445-99503467 GTTCCAACAAAGAAGTCACATGG - Intergenic
912376102 1:109211179-109211201 ATTTCAAAACATGAGGGACAAGG + Intergenic
913245149 1:116864437-116864459 GGTCCTACACAGATGGGACATGG - Intergenic
913675570 1:121137415-121137437 AACCCAATAGAGAAGGGACAGGG - Intergenic
914027466 1:143925356-143925378 AACCCAATAGAGAAGGGACAGGG - Intergenic
915283735 1:154839809-154839831 AGACAAACACAGACGGGACAAGG + Intronic
916505807 1:165427372-165427394 ATTCCAACATTGATGGGGCAAGG - Intronic
916869121 1:168893370-168893392 AGTCCAGCAGAGAAGGGACTAGG - Intergenic
918041426 1:180916334-180916356 ATTCCAGCACAGAGGGGCCCTGG - Exonic
920342696 1:205285288-205285310 ATTCCATTCCAGGAGGGACAGGG + Intergenic
920462934 1:206156251-206156273 AACCCAATAGAGAAGGGACAGGG - Intergenic
920983129 1:210857073-210857095 ATTCTAACACAGTAGGCATAGGG - Intronic
921902166 1:220462898-220462920 ATCCCAACTCAGAAGGGGCGGGG - Intergenic
922226561 1:223650603-223650625 ATACCAACAGAGAAGAGAGATGG + Intronic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923054049 1:230412114-230412136 ATTCCAACAAAAAAGGGAAAAGG + Intronic
923695159 1:236241603-236241625 ATTACAACTCAGAAGAGTCATGG + Intronic
924648395 1:245901717-245901739 AATTCAGCACAAAAGGGACAGGG + Intronic
1062832783 10:617170-617192 ATACCAACACAGTAGGGGCGGGG - Intronic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1066043088 10:31571134-31571156 ATTCCAAAACAGAAAGCACCAGG + Intergenic
1067162568 10:43839800-43839822 ATCCCAAGGCAGAAGGGAGACGG + Intergenic
1067708077 10:48626026-48626048 AGTCTACCAAAGAAGGGACATGG - Intronic
1067993899 10:51247035-51247057 ATTCGAAAAGAGAAGGGAAAAGG + Intronic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068454265 10:57234888-57234910 AATTCAACCCATAAGGGACAGGG + Intergenic
1071188718 10:83076251-83076273 ATTACATAACAGATGGGACATGG + Intergenic
1071843217 10:89494699-89494721 AATCCAACATGGAAGGGAGACGG + Intronic
1073051495 10:100670174-100670196 ACTCCAAGACAGAAGGGAGGAGG - Intergenic
1074682022 10:115916877-115916899 ATACCCAGACAGAAGGAACAGGG - Intronic
1076584067 10:131533408-131533430 ATCCGAAGCCAGAAGGGACAGGG + Intergenic
1077453818 11:2666122-2666144 ATGCCAAAACAGAAGAGACAGGG - Intronic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1078591612 11:12645790-12645812 TTTCCAAAACAGAAAGGACCAGG + Intergenic
1079882423 11:25944175-25944197 TTGCCAACACAGAAGAGGCAGGG + Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1080186524 11:29493853-29493875 ATTCCAACAAAGAAGACAGAAGG - Intergenic
1080584152 11:33666249-33666271 GCTCCAACTCAGAAGGGGCAGGG + Intronic
1084359231 11:68658882-68658904 ATTCATACACAGAAGGGACTGGG - Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1084935642 11:72585185-72585207 GCTCCAATACAGCAGGGACAGGG - Intronic
1084991013 11:72925806-72925828 GTCCCAACTCAGAAGGGGCAGGG - Intronic
1086125285 11:83343461-83343483 GATCCCACACAGATGGGACATGG + Intergenic
1087968967 11:104455280-104455302 TATCCAACACGGAAGGGTCAAGG + Intergenic
1088513091 11:110598776-110598798 ACCCCAACTCAGAAGGGGCAGGG - Intronic
1088686862 11:112290995-112291017 ATTCAAAGAAAGAAGGTACAAGG - Intergenic
1088746214 11:112807122-112807144 ATTTCCACCCAGCAGGGACAAGG + Intergenic
1089172841 11:116527447-116527469 GTTCCAACTCAGAAGGGGCAGGG - Intergenic
1089493970 11:118899330-118899352 ATCCCAACGCACAGGGGACAGGG - Exonic
1089505888 11:118961594-118961616 CTGCCAACTCAGAAGGGGCAGGG + Intergenic
1089505950 11:118961856-118961878 TTCCCAACTCAGAAGGGGCAGGG + Intergenic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090159383 11:124476297-124476319 AATCAAACACAGAAGAGGCATGG - Intergenic
1090441507 11:126728777-126728799 GAGCCAACACAGAAGGGACCTGG - Intronic
1091506277 12:1072666-1072688 ATTAAAACACAGAAAGGACTTGG - Intronic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1093684832 12:22044474-22044496 ATTCCAGCACTGAAGGGCAAGGG - Intergenic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095042173 12:37455431-37455453 ATTCCAACTCAGAAGGGGCAGGG - Intergenic
1095595199 12:43950902-43950924 AGACCAACACAGAAGGCAGATGG + Intronic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1096070565 12:48773369-48773391 ATTCCAAGGCACAAGGGGCATGG + Intronic
1097078300 12:56410988-56411010 ATCCCAACTCAGAAGGGACAGGG + Intergenic
1097595120 12:61620195-61620217 AATTCAACAGAGAAGTGACAGGG + Intergenic
1098164262 12:67677387-67677409 ATACCATCACAGTGGGGACAGGG + Intergenic
1098173618 12:67770025-67770047 GGTCCTACACAGATGGGACACGG + Intergenic
1098289531 12:68944732-68944754 ATTACAATAAAGAAGTGACAAGG + Intronic
1098318989 12:69221904-69221926 AACCCAAATCAGAAGGGACAAGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099907384 12:88788481-88788503 ATTCCAAAACAGAAAGGATCAGG + Intergenic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1102060255 12:109926227-109926249 ATCCCAACCCAGAAGGGGTAAGG - Intronic
1102809983 12:115815808-115815830 TTTCCAAGACAGAATGGAGAGGG - Intergenic
1104565921 12:129883025-129883047 AGTGCAATACACAAGGGACAGGG + Intronic
1106838198 13:33658926-33658948 ATTACAACGCACAGGGGACAGGG + Intergenic
1108088157 13:46817976-46817998 GTTCCAACTCAGAAGGGGCAGGG - Intergenic
1108088189 13:46818114-46818136 CTCCCAACTCAGAAGGGACAGGG - Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1110461965 13:75755062-75755084 ATTCCAACACTGAAGGGTCAGGG + Intronic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111800622 13:92975375-92975397 GCTCCAACTCAGAAGGGGCAGGG + Intergenic
1113667275 13:112149529-112149551 ATACCATCACAGAGGGGTCAGGG - Intergenic
1114349740 14:21836404-21836426 GCTCCAACTCAGAAGGGGCAGGG + Intergenic
1114573309 14:23690850-23690872 ATTTCAAGATAGAAGGGACCTGG - Intergenic
1114654289 14:24306767-24306789 ATTCCAAACCAGAAGTGACTTGG - Exonic
1115361827 14:32511880-32511902 CTTCCAAAACAGAGGGGAGAAGG - Intronic
1116257108 14:42570920-42570942 ACTCCAACTCAGAAGGGGCAGGG - Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1117241678 14:53839898-53839920 ATTCCATGACAGAAGGCAGAAGG + Intergenic
1118105944 14:62659754-62659776 TTCCCAAAGCAGAAGGGACACGG - Intergenic
1118487364 14:66226509-66226531 AATACAACACAGAAGAGAAAAGG - Intergenic
1118847592 14:69559414-69559436 ATTACAACACAGAAGCCAAATGG - Intergenic
1119031541 14:71196720-71196742 ATTCCCAAACAGATGAGACATGG - Intergenic
1119137199 14:72231954-72231976 TTTTGAACACAGAAGTGACAAGG + Intronic
1119304339 14:73595313-73595335 ATTCCAATAGAGAAGGCCCAGGG + Exonic
1121062140 14:90922380-90922402 AATGCAATACAGAAGGGTCACGG - Intronic
1121140993 14:91541398-91541420 ACCCCAACACAGTAGAGACATGG + Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1123124889 14:105939313-105939335 ATTCCAAAAGAGTAGGGAAATGG + Intergenic
1123817622 15:23995860-23995882 TTTCAAACACAGAAGACACAAGG + Intergenic
1124268321 15:28257198-28257220 TGTCCACCACAAAAGGGACACGG + Exonic
1124618715 15:31261769-31261791 ATTCTAAGTCAGGAGGGACAAGG + Intergenic
1124823579 15:33071312-33071334 TATCTAACACAGAAGAGACACGG + Intronic
1125435893 15:39645338-39645360 TTTCCAACTCAGAAGAGGCAGGG - Intronic
1126292772 15:47100091-47100113 ATTCCAACTCGGAAGGGGCAGGG + Intergenic
1126817740 15:52470685-52470707 ATTCCCTCACATCAGGGACAAGG + Intronic
1127789697 15:62389355-62389377 ATCCCAATACAGAATGGACCAGG - Intergenic
1127867966 15:63047328-63047350 ATTCCCACACATAAGGGAGCTGG + Intronic
1128137080 15:65271783-65271805 ATTCTCACACAGAAAGGAAAAGG - Intronic
1130869550 15:87959731-87959753 ACACCAACACAAAAGGGCCACGG + Intronic
1131526165 15:93154413-93154435 CTTCCAAAACAGAGGGCACAAGG - Intergenic
1131531588 15:93197722-93197744 ATTCCAAAACAGAAGGGTGTGGG - Intergenic
1131913896 15:97240102-97240124 TTATCAAAACAGAAGGGACAGGG - Intergenic
1132978895 16:2724871-2724893 CTGCCAACTCAGAAGGGGCAGGG - Intergenic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1135207014 16:20492530-20492552 CCACCAACTCAGAAGGGACAGGG - Intergenic
1135211871 16:20531102-20531124 CCACCAACTCAGAAGGGACAGGG + Intergenic
1135935150 16:26773690-26773712 ATGCCAAGACAGAAGAGGCAAGG + Intergenic
1136529975 16:30861492-30861514 GATCCCACACAGATGGGACACGG - Intronic
1137018888 16:35402905-35402927 CCTCCATGACAGAAGGGACAAGG - Intergenic
1138163669 16:54779411-54779433 ATTTTAACACAGCAGGGCCAGGG + Intergenic
1138333401 16:56233491-56233513 ATTCATACACAGAGAGGACACGG - Intronic
1138592220 16:58007340-58007362 CTTCCAAAACAGAAGGCACCAGG - Intronic
1139124903 16:64066252-64066274 CTTCCAACATTGAAGGGTCATGG - Intergenic
1139717084 16:68822350-68822372 CCTCAAAGACAGAAGGGACAAGG - Intronic
1140358570 16:74325961-74325983 ACTCCAGCATAGAGGGGACAGGG - Intergenic
1141915452 16:87093545-87093567 CAGCCAACACAGAAGGGACATGG + Intronic
1142737418 17:1909959-1909981 ATTCCCACCCAGAAGGGAACTGG - Intergenic
1143611554 17:8020703-8020725 AGTCCAAGACTGAAGGAACAGGG + Intergenic
1143794615 17:9326694-9326716 ATTCCAACACAGAAGGGACATGG + Intronic
1143924431 17:10357309-10357331 CTTCCAACTCAGTAGGGACTGGG - Intronic
1144728552 17:17513874-17513896 ATCACAACACAGAAGAGACATGG + Intronic
1147891459 17:43720518-43720540 ATGCGATCACAGGAGGGACACGG + Intergenic
1148025415 17:44584264-44584286 TTTCCCACACAGAAGGGAACAGG - Intergenic
1152096203 17:78273126-78273148 AGTTCAAAACAGAGGGGACATGG + Intergenic
1152134700 17:78497052-78497074 AACCCAACTCAGCAGGGACAAGG - Intronic
1152846117 17:82600798-82600820 ATTTCCACACAGAAGGGAGCGGG - Intronic
1153320774 18:3771923-3771945 ATGCGAACTCAGAAGGGACCGGG - Intronic
1153452971 18:5250043-5250065 ATTCAAAAAGAGAAGAGACATGG + Intergenic
1155135328 18:22985998-22986020 ATTCCAGCAGGGAAGGGACTGGG - Intronic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1158262666 18:55626111-55626133 ATTCCAACTCATTAGGGAGAAGG + Intronic
1158773685 18:60552630-60552652 GTCCCAACTCAGAAGGGGCAGGG - Intergenic
1161005187 19:1932116-1932138 TTTGAAACACAGAAGGGGCAAGG + Intergenic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1165510299 19:36262857-36262879 GTTCCTGCACAGATGGGACATGG + Intergenic
1166477453 19:43140585-43140607 ATAGCAACACAAAAGGGACAAGG + Intronic
1166488881 19:43240066-43240088 ATAGCAACACAAAAGGGACAAGG + Intronic
1167234924 19:48308657-48308679 ATCCCAACTCAGAAGGGTCAGGG - Intronic
1167612181 19:50512874-50512896 AGACCAAGACAGAAGGGGCAGGG + Intronic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168509162 19:56960872-56960894 ATTCCCACATGGAAGGGACTTGG + Intergenic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
926011019 2:9407921-9407943 CTTCCAACACAGGAGAGAAAAGG + Intronic
926436009 2:12838631-12838653 ATGCCAAGACAGAAGGCAAAAGG - Intergenic
926859417 2:17292371-17292393 ACCCCAACTCAGAAGGGGCAGGG + Intergenic
927072772 2:19547976-19547998 ATCCCAACTCAGAAGGGGCGAGG - Intergenic
928111050 2:28509136-28509158 ATTCCCTCAAGGAAGGGACAGGG + Intronic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
935411511 2:102769185-102769207 CTAGCAACACAGAAGGGAAATGG + Intronic
936039519 2:109139480-109139502 ATTCAGCCACAGAAGGCACAAGG - Intronic
936784792 2:116081603-116081625 ATTCCATGATAGAAGGAACATGG + Intergenic
937140440 2:119595661-119595683 GCTCCAACACAGCAGGGACCAGG - Intronic
937279977 2:120711143-120711165 AGTCGAAGGCAGAAGGGACAGGG + Intergenic
937350317 2:121156307-121156329 ATCCCAAAACAGTAGTGACATGG - Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
940387344 2:153089301-153089323 ATTACAAGCCAGAAGGGACTGGG - Intergenic
940577120 2:155522931-155522953 TTTCCAAAATAAAAGGGACATGG - Intergenic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
941155720 2:161975737-161975759 ATTTGAACAAAGAAGGGGCAAGG + Intronic
942345278 2:174996496-174996518 ATTCCTGCACAGATGGGATAAGG + Intronic
942435598 2:175971283-175971305 ATTGCATCTGAGAAGGGACATGG + Intronic
943201838 2:184837082-184837104 ATTGCAGCACAGGAGGGTCAAGG - Intronic
943232270 2:185269638-185269660 ATTCCAACAGATAAGAGAAACGG - Intergenic
943835423 2:192509817-192509839 GGTCCTACACAGATGGGACATGG - Intergenic
944353271 2:198755207-198755229 TTTCCATCACAGAAGTGAAAAGG - Intergenic
944829505 2:203519014-203519036 ATTCCAAAATAGAAAGCACAAGG + Intronic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
946913764 2:224493596-224493618 ATTCCAAGTCAGATGGGAAAAGG + Intronic
947740881 2:232484334-232484356 AGCCCCACAAAGAAGGGACAGGG + Intronic
948151201 2:235746467-235746489 ATCCTAACACAGAAGGGAGGAGG + Intronic
948720774 2:239898772-239898794 AGTCCTACACAGATGGGGCAAGG + Intronic
1170184763 20:13576192-13576214 ATTCCGAGACAGAAGGGGGAGGG + Intronic
1171060868 20:21957735-21957757 AATTCAACAGAGAAGTGACAGGG - Intergenic
1171536605 20:25898503-25898525 ATTCCAACTCAGAAGGGGCAGGG - Intergenic
1171804500 20:29662654-29662676 ATTCCAACTCAGAAGGGGCAGGG + Intergenic
1171839547 20:30193768-30193790 ATTCCAACTCAGAAAGGGCAGGG - Intergenic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173295334 20:41750326-41750348 ATAACCACACAGAAGAGACAAGG + Intergenic
1173316386 20:41948536-41948558 ATTCAAACACACAATGCACATGG - Intergenic
1173916458 20:46711692-46711714 ATTCTTACACAGCAGGGACCAGG + Intronic
1174250358 20:49214887-49214909 AGTCCATAACAGAAGGAACATGG + Intergenic
1174455625 20:50646631-50646653 ATGCCCACACAAAAGGAACAGGG + Intronic
1175425308 20:58861280-58861302 TTTTCAAGAGAGAAGGGACAGGG + Intronic
1176699477 21:10026092-10026114 ATTCCAAAAGAGAAGAGAGAGGG - Intergenic
1177100646 21:16894513-16894535 GATCCCACACAGATGGGACATGG - Intergenic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1178634751 21:34292401-34292423 ATTCCCAAATAGAAAGGACATGG + Intergenic
1178867128 21:36338111-36338133 ATTCCAACAGAGAAGAGAAAGGG - Intronic
1179577143 21:42315061-42315083 ATTTCAACACAGACTGGGCAGGG + Intronic
1179716509 21:43291351-43291373 ATCCCCCCACAGGAGGGACATGG + Intergenic
1180016859 21:45092735-45092757 ATTCCAAAACAGAGCAGACAAGG + Intronic
1183079481 22:35447328-35447350 ACTCAAACCCAGAAGGAACAAGG - Intergenic
1184173750 22:42774507-42774529 CTTGCAACTCAGAAGGGGCAGGG - Intergenic
1184613492 22:45622015-45622037 GTCCCAACTCAGAAGGGGCAGGG - Intergenic
949545029 3:5065407-5065429 AATCCAACACTGAGGGGAGAAGG - Intergenic
949714265 3:6910401-6910423 ATTCCAAGATGGAAGAGACATGG - Intronic
950024601 3:9811488-9811510 GTTACAACACAGACGGGAGAAGG - Intronic
950887721 3:16375578-16375600 ATTCCATCAAAGGAGGGAAAAGG + Intronic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
952225633 3:31372795-31372817 AGTCCCACAGAGAAGGGTCATGG - Intergenic
952256050 3:31696677-31696699 ATTCCAACATGGAGGGGTCAGGG - Intronic
953016893 3:39086085-39086107 ATTCCAACTCAGAAGTGACAGGG + Intronic
953301475 3:41780913-41780935 ATTCCCACACAGAAAGGGGAAGG + Intronic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
955541610 3:59982793-59982815 GTTCCAAGACAGTAGGGACTGGG - Intronic
956599598 3:71005990-71006012 AATCAAACACAGGAGGAACACGG + Intronic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
957412528 3:79859913-79859935 ATTCCAACAATAAATGGACAAGG + Intergenic
957734847 3:84191175-84191197 GGTCCCACACAGAAGGGACAAGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
960251265 3:115457145-115457167 ATTCCTAAACAGAAAGGACTAGG - Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961357391 3:126347747-126347769 ATGTCACCAGAGAAGGGACAGGG + Intronic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
962105406 3:132383681-132383703 ACCCCAACTCAGAAGGGGCAGGG + Intergenic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963372281 3:144415947-144415969 AATCCAATAGAGAAGGTACAAGG + Intergenic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963977504 3:151497889-151497911 AATCCAACTTAAAAGGGACATGG - Intergenic
964067916 3:152599779-152599801 AGTCCTGCACAGATGGGACATGG - Intergenic
964300233 3:155278556-155278578 GGTCCTACACAGATGGGACATGG + Intergenic
965005561 3:163018829-163018851 TCTCCAACTCAGAAGGGGCAGGG - Intergenic
966105067 3:176324997-176325019 AGTCCTACACAGATGGGACACGG + Intergenic
966719744 3:183050257-183050279 CTTCCAAAACAGAAAGCACAAGG + Intronic
967113113 3:186312769-186312791 ATGTCAAAACAGAAGGGCCAGGG + Intronic
967152147 3:186660351-186660373 AGTCCTACACAGATGGGATACGG - Intronic
967158198 3:186712632-186712654 ATTGCCACACAGAGGGGCCATGG - Intergenic
967412156 3:189177892-189177914 ATTCGAACCCAGAAGGGAGATGG + Intronic
968538546 4:1150437-1150459 AGTCCAACTCAGAAGGGGCAGGG + Intergenic
970203925 4:13637044-13637066 ATTTCAACAGAGAAGGGAGAAGG + Intergenic
970210242 4:13702432-13702454 ATTCCAACAGAGAAAAGAAAGGG - Intergenic
970493100 4:16596021-16596043 ACTGCAACCCAGAAGGGTCATGG - Intronic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
972103435 4:35450956-35450978 ATTCCAAAACAGAAGGTACCAGG + Intergenic
975971024 4:80037036-80037058 AAACCACCACACAAGGGACAAGG + Intronic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
977075185 4:92442339-92442361 GGTCCTACACAGATGGGACACGG + Intronic
977250366 4:94682310-94682332 ACTCCAAAACAGGAGAGACAGGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
978964690 4:114726044-114726066 GCCCCAACTCAGAAGGGACAGGG + Intergenic
980508117 4:133749395-133749417 ATTCCCAGACATGAGGGACAAGG - Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982091763 4:151885662-151885684 ACCCCAACACTGAAGGGAAAGGG + Intergenic
982407035 4:155032171-155032193 AATCCAACACAGCAGGGACCTGG + Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
982799431 4:159685620-159685642 ATTCCCACACAGCAGGGAAGTGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
983805770 4:171989408-171989430 GTTCCTACACAGATGGGATACGG + Intronic
984321372 4:178201059-178201081 ATTCCAAAACAGAAAGCACAAGG + Intergenic
984486944 4:180382615-180382637 ATTAAAACACAGCAGGGACTTGG + Intergenic
985347110 4:189017680-189017702 ATTCCAACACAGAAAAGTCGTGG - Intergenic
988146477 5:27315245-27315267 ATTCCAGGACACAAGGGTCAGGG + Intergenic
988237174 5:28561132-28561154 AATTCAACAAAGAAGTGACAGGG + Intergenic
989659945 5:43788447-43788469 GATCCCACACAGATGGGACATGG - Intergenic
990180077 5:53151125-53151147 ATTCCCACAGAGGAGGGACCTGG + Intergenic
991530263 5:67606916-67606938 TTTCCAGCACAGAATGGAGATGG + Intergenic
991650553 5:68848142-68848164 ATCCCAAAACAGAATGGGCAAGG + Intergenic
993721857 5:91329257-91329279 ATTCCAACACTGAAGAGGAAAGG - Intergenic
994362961 5:98876472-98876494 ATTCCATCTCAGAAGGGAAAAGG - Exonic
994503830 5:100614618-100614640 ATTCCAACACTGAAAGGTGATGG + Intergenic
994725803 5:103434198-103434220 GTTCCATCTCAGAAGGGGCAGGG - Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
995347296 5:111135358-111135380 ATCCCAACACACATGAGACAGGG + Intergenic
996787618 5:127257199-127257221 ATTCCCACAGAGAAGGGACTGGG - Intergenic
996917701 5:128731879-128731901 GATCCCACACAGATGGGACATGG - Intronic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
998957836 5:147454770-147454792 ATTCCATCGCCGAAGGGCCATGG - Intronic
998996380 5:147872350-147872372 GGTCCTACACAGATGGGACACGG + Intronic
999590716 5:153142875-153142897 AGTGCAGCACAGAAGTGACAGGG + Intergenic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001280564 5:170383517-170383539 ACTCCAACACAGAAGAGCTAGGG + Intronic
1001665568 5:173431082-173431104 ATTCCAACCCAGAAGAGGAAGGG + Intergenic
1002382404 5:178840146-178840168 AGTCCAACCCAGAAGAAACAAGG + Intergenic
1002648172 5:180672529-180672551 AGTCCAACCCAGAAGAAACAAGG - Intergenic
1002693828 5:181070760-181070782 GTCCCAACTCAGAAGGGACAGGG + Intergenic
1004283501 6:14300329-14300351 GTTCCCACACAGATGGGACGCGG + Intergenic
1007494679 6:42251717-42251739 CTTCCAAGGCAGAAGAGACAAGG + Intronic
1008469837 6:51872314-51872336 ATTGCAAAACACCAGGGACAAGG + Intronic
1009776369 6:68210511-68210533 ATACAAAAACTGAAGGGACAAGG - Intergenic
1009856524 6:69272525-69272547 ATTCCAACACAAAATGTATAGGG + Intronic
1009931687 6:70183580-70183602 ATTCAGACACACAAGGAACAAGG - Intronic
1015127727 6:129772938-129772960 TTTCCAAGACAGAAGGGGCCAGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1015430636 6:133126994-133127016 ATTTCAACACTGAAAGGACAAGG + Intergenic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1021561561 7:21972689-21972711 CTCCCAACTCAGAAGGGGCAGGG + Intergenic
1022573390 7:31474880-31474902 ATCCCAACGAAAAAGGGACAGGG - Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1022851033 7:34262486-34262508 AACCCACGACAGAAGGGACATGG - Intergenic
1023788979 7:43737208-43737230 GTCCCAACTCAGAAGGGGCAGGG - Intergenic
1024281238 7:47721557-47721579 ATCCCAACTCAGTAGGGCCAGGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1025288077 7:57685211-57685233 ATTCCAACTCGGAAGGGGCAGGG - Intergenic
1026259168 7:68739256-68739278 ATTCCACCTCAGAAGGGAGCAGG + Intergenic
1026359709 7:69591849-69591871 CTGCCAACTCAGAAGGGGCAGGG + Intergenic
1026359772 7:69592096-69592118 GTCCCAACTCAAAAGGGACAGGG + Intergenic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1028233177 7:88330008-88330030 ATCCCAATTCAGAAGGGGCAGGG - Intergenic
1028269586 7:88772397-88772419 ATTCCACCCCTGAAGTGACAGGG + Intronic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1030234936 7:107248274-107248296 ATGCCATCACAAAAGGAACAAGG + Intronic
1030522352 7:110613649-110613671 ATTTCAACAAAGAAGGTATATGG + Intergenic
1031727911 7:125262280-125262302 GGTCCCACACAGAAGGGACATGG + Intergenic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1031849815 7:126850325-126850347 ACTCCAACACATAAAGGACAGGG - Intronic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1034232057 7:149538105-149538127 CTTACATCACAGAAGGCACAAGG - Intergenic
1034255315 7:149721539-149721561 AGTCTGACACAGCAGGGACAGGG + Intronic
1036414000 8:8529953-8529975 TTTCCAACACAGCAAGGACTTGG + Intergenic
1036615866 8:10387020-10387042 ATTCCAACTCAGCAGGTCCAGGG + Intronic
1037367437 8:18137948-18137970 ATTCCAACAGAGAATGGGAAGGG - Intergenic
1037572692 8:20172153-20172175 ATTCTAACCCAGAAGTGACAAGG + Intronic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1039370141 8:36975954-36975976 AGTCCATCCCAGCAGGGACATGG - Intergenic
1039894156 8:41704549-41704571 ATTCAAAGAGAGAACGGACAGGG + Intronic
1040477185 8:47789510-47789532 ATTCCAAAACACAAGGGAGGAGG + Intronic
1040539848 8:48342673-48342695 ATTCCCACACAGACAGCACATGG + Intergenic
1041456898 8:58070632-58070654 ATTCCAAAACAGAAGCGAGTCGG - Intronic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043598866 8:81915779-81915801 GATCCCACACAGATGGGACATGG - Intergenic
1044361447 8:91289480-91289502 ATTCCACAAAAGAAGGGAGATGG + Intronic
1044497655 8:92907087-92907109 ATTCCAAAAAATAAGGGAAAAGG + Intronic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1045086638 8:98693733-98693755 ATACCTACACAGCAGGGACTGGG + Intronic
1046005585 8:108478930-108478952 AATCAAAAACATAAGGGACATGG - Intronic
1047163896 8:122414690-122414712 ATTTCACAACAGAAGGGAAAAGG - Intergenic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1048009041 8:130442243-130442265 AATCTAACACAGAAGGGGCATGG + Intronic
1048098747 8:131323844-131323866 AATCCAACTTAGAAGGGACATGG + Intergenic
1048502326 8:134989447-134989469 GTTCCCACACAGAAAGAACAGGG - Intergenic
1049114137 8:140671470-140671492 ATTCCAACACTGAGAGGCCAAGG - Intronic
1050405817 9:5307685-5307707 ATTCCAACACAGAAGGACGAGGG - Intergenic
1050456110 9:5836112-5836134 ATGGCAAGACAGAAGGGACATGG - Intergenic
1050616675 9:7408405-7408427 ATTCCAAAATACAAGGTACAAGG - Intergenic
1050857782 9:10383070-10383092 AGTCATACAAAGAAGGGACATGG + Intronic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1052889488 9:33685059-33685081 ATACTAAAACAGAAGTGACAAGG + Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1053076451 9:35138662-35138684 ATCCCAACTCAGAAGGGGCAGGG - Intergenic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056900703 9:90596905-90596927 ATGTCAACAATGAAGGGACAAGG + Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1058026188 9:100144071-100144093 GGTCCTACACAGATGGGACACGG + Intronic
1058362164 9:104161179-104161201 ATTCCAAAAAAGGATGGACAAGG + Intergenic
1058751723 9:108045653-108045675 ATTACAACGCAGAGGGGACCAGG + Intergenic
1059096569 9:111422522-111422544 ATGCCAACAGACAAGGGACAAGG + Intronic
1059565390 9:115379479-115379501 ATCCCAATTCAGAAGGGGCAGGG - Intronic
1059635478 9:116166213-116166235 CTTCCAAAACAGAAGGGGAAGGG + Intronic
1060765754 9:126294095-126294117 ATTCCAATACAGAAGTGCCAAGG + Intergenic
1061934434 9:133849525-133849547 ACACAAACACAGCAGGGACATGG - Intronic
1186187520 X:7036177-7036199 ATAGCAACACAAAAGGGACAAGG + Intergenic
1186667900 X:11737107-11737129 ATTCTAAGACAAAAGGGAAAAGG - Intergenic
1189360029 X:40343356-40343378 GTCCCAACTCAGAAGGGGCAGGG - Intergenic
1190068776 X:47261978-47262000 ATTCCATCACAGGATGGGCAAGG + Intergenic
1190898806 X:54648778-54648800 AGTCCAACACAGAAGGAGCTTGG - Intergenic
1191053689 X:56221307-56221329 ATTCCAACACAGAGTGGCCAAGG + Intergenic
1191615044 X:63162005-63162027 AATTCAACATAGAAGTGACAGGG + Intergenic
1191621254 X:63216918-63216940 AATTCAACATAGAAGTGACAGGG - Intergenic
1191825572 X:65362051-65362073 GTTCCCACACTGATGGGACATGG - Intergenic
1192159066 X:68769324-68769346 ACTCCACCCCAGAAGGGCCAGGG - Intergenic
1192554753 X:72080654-72080676 TTTCTACCACCGAAGGGACAAGG - Intergenic
1193537114 X:82729194-82729216 AGTCCCACACAGAAGGGACATGG - Intergenic
1194205222 X:91003296-91003318 TTCCCAACTCAGAAGGGGCAGGG + Intergenic
1194276780 X:91894740-91894762 ATTTCATATCAGAAGGGACATGG - Intronic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198965942 X:142228884-142228906 GTTCCTGCACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199360167 X:146907794-146907816 TCCCCAACTCAGAAGGGACAGGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1199861234 X:151801730-151801752 ACTCCAACTCAGAAGGGACAGGG + Intergenic
1200551041 Y:4578433-4578455 TTCCCAACTCAGAAGGGGCAGGG + Intergenic
1200560422 Y:4694871-4694893 ATTCCTACAAACAAGGTACAAGG - Intergenic
1200594133 Y:5116851-5116873 ATTTCATATCAGAAGGGACATGG - Intronic
1201581407 Y:15514709-15514731 AGTCCTGCACAGATGGGACATGG - Intergenic