ID: 1143796319

View in Genome Browser
Species Human (GRCh38)
Location 17:9339676-9339698
Sequence CAGAGTACACAGCAGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143796319_1143796322 1 Left 1143796319 17:9339676-9339698 CCTCATTCCTGCTGTGTACTCTG 0: 1
1: 0
2: 2
3: 41
4: 364
Right 1143796322 17:9339700-9339722 CTATTGGCCTATGCTCAGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 119
1143796319_1143796325 22 Left 1143796319 17:9339676-9339698 CCTCATTCCTGCTGTGTACTCTG 0: 1
1: 0
2: 2
3: 41
4: 364
Right 1143796325 17:9339721-9339743 GGGCTTTTTCTTTATGAGACAGG 0: 1
1: 0
2: 5
3: 118
4: 948
1143796319_1143796323 2 Left 1143796319 17:9339676-9339698 CCTCATTCCTGCTGTGTACTCTG 0: 1
1: 0
2: 2
3: 41
4: 364
Right 1143796323 17:9339701-9339723 TATTGGCCTATGCTCAGAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143796319 Original CRISPR CAGAGTACACAGCAGGAATG AGG (reversed) Intronic
900118188 1:1037436-1037458 CAGAGCTCACAGCAGGGCTGGGG + Intronic
900371462 1:2334039-2334061 CAGAGCAGACAGAAGGCATGGGG + Intronic
900970406 1:5989525-5989547 CCAAGAACACAGGAGGAATGAGG - Intronic
900992292 1:6103621-6103643 CAGAGCACACAACACGCATGTGG + Exonic
901449402 1:9326782-9326804 CAGACTAAACTGCAGGAATGAGG - Intronic
904200438 1:28815929-28815951 CCGAGTACACAGCAAGTAAGTGG - Intronic
905416944 1:37810145-37810167 CTGAGAACACAGCAGGAAAAGGG + Exonic
905462517 1:38130942-38130964 CAGTGTAACCAGCAGGCATGTGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906546280 1:46621385-46621407 CAGAGTTGCCAGCAGGGATGGGG + Intergenic
906711856 1:47936408-47936430 CAGAGAACCCAGCAGGTATGAGG + Intronic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907749888 1:57252871-57252893 AAGATTACAAAGCAGGAAAGTGG + Intronic
908032417 1:60015594-60015616 CAGAGAACACAGCAAGAAAGTGG - Intronic
909253931 1:73393867-73393889 ATGAGAACACAGCAAGAATGTGG - Intergenic
909555080 1:76944561-76944583 CAGAGTACATACCAGCACTGGGG - Intronic
910724527 1:90324538-90324560 CAGAGAACTCTGCAGGAAGGGGG + Intergenic
910866846 1:91796626-91796648 CAGAGGACACAGGAGGAAATGGG + Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
912554130 1:110503985-110504007 GAGAGTGCAAAGCAGGAATCAGG + Intergenic
913526456 1:119698048-119698070 CAGGCTACAGGGCAGGAATGAGG - Intronic
914322520 1:146578870-146578892 AAGAGTGCACAGGTGGAATGTGG - Intergenic
915016155 1:152736103-152736125 AAGATTAAACAGCAGGAAAGAGG - Intergenic
915930979 1:160060928-160060950 CAGAGTTCGTAGCAGGAGTGGGG + Intronic
916722302 1:167493612-167493634 AAGATCACACAGCTGGAATGTGG + Intronic
916789512 1:168112937-168112959 CAGAAGACAGAGGAGGAATGTGG + Intronic
917141157 1:171837569-171837591 GTGAGGACACAGCAGGAAGGTGG - Intergenic
917712815 1:177704465-177704487 CAGAGCACACAGCAGGTCTATGG - Intergenic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919221402 1:194634009-194634031 CAGTCTACACATAAGGAATGAGG + Intergenic
919396675 1:197058459-197058481 CAAAGTCTCCAGCAGGAATGTGG - Intronic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922809953 1:228409742-228409764 CAGCCCACTCAGCAGGAATGGGG + Intronic
923790306 1:237106015-237106037 CAGAGTGTGCAGCAGGACTGGGG + Intronic
1063035610 10:2284105-2284127 CAGAGGGCAAGGCAGGAATGCGG + Intergenic
1063528968 10:6811759-6811781 CAGAGTACATCGAAGGAATGAGG - Intergenic
1063613215 10:7580670-7580692 CATAGAAGACAGCAGGAATGTGG + Intronic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1065713927 10:28545555-28545577 GAGAGTACACAGAAGGGAAGAGG + Intronic
1068784859 10:60960884-60960906 CAGAGCTGACAGCAGGATTGTGG + Intronic
1070452611 10:76577279-76577301 GAGAATCCACAGGAGGAATGAGG + Intergenic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1072788141 10:98298427-98298449 CAGGTCACCCAGCAGGAATGTGG - Intergenic
1072846804 10:98840532-98840554 CAGAGAAGACAGCAGGGAAGCGG + Intronic
1072945641 10:99807752-99807774 CAGGATGCACAGCAAGAATGTGG + Intronic
1073281030 10:102354289-102354311 CAGGGAACAGGGCAGGAATGGGG - Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1074810511 10:117100301-117100323 CAGAAAACACATCATGAATGAGG - Intronic
1075948616 10:126458606-126458628 CTGAGCTCACAGCAGGAAAGGGG + Intronic
1076039720 10:127235468-127235490 AATAGTACTCAGCAAGAATGAGG - Intronic
1076225085 10:128768138-128768160 TAGAGTACAAAGCAGAAAGGTGG + Intergenic
1076516920 10:131050986-131051008 TAGGGTACACAGCTGGACTGGGG + Intergenic
1078540804 11:12211567-12211589 CAAAGTACACAGCATGCCTGGGG + Intronic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1079185838 11:18235717-18235739 CAGAGGTCAGAGCAGGAGTGTGG - Intronic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1081685789 11:45042118-45042140 CAGGGCACACAGCTAGAATGTGG + Intergenic
1082001598 11:47396088-47396110 CAGAGTTCAGAGCAGAGATGGGG + Intergenic
1083843569 11:65318001-65318023 TAGGGTACACAGCAGGGATGGGG - Intronic
1083997964 11:66281521-66281543 AAGAGTACACAGCAGCAGAGTGG - Intronic
1085248928 11:75128735-75128757 GAGAGCACACAGCAGGAAGCTGG - Intronic
1085703571 11:78766431-78766453 CAAAGCACACAGTATGAATGGGG + Intronic
1085801382 11:79593251-79593273 CAGAGCACACAGCAGCATTGTGG + Intergenic
1086158624 11:83695841-83695863 CAGAGAGCACAGGAGGAATTGGG + Intronic
1087194807 11:95294608-95294630 GAAACTACCCAGCAGGAATGTGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1089116759 11:116101510-116101532 CAGAGAATTTAGCAGGAATGAGG - Intergenic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1091173708 11:133541428-133541450 CAAAGTGAAGAGCAGGAATGCGG + Intergenic
1091912121 12:4240989-4241011 AGGAGTCCACAGCAGGAATGTGG + Intergenic
1093780142 12:23126058-23126080 CAGAGTCAACAGGAGGAATGTGG - Intergenic
1094399221 12:30043461-30043483 CTGAGGACACAGCAAGAAAGCGG + Intergenic
1095370316 12:41459014-41459036 CAGAGTTCAAAGGAGGAATTAGG + Intronic
1095971023 12:47902070-47902092 CAGAGGTCACAGCAGTGATGAGG - Intronic
1096424235 12:51487611-51487633 CAGAGTACACTGCAGGGGTGGGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1101814716 12:108136982-108137004 CAGACTACTCAACAGGACTGGGG + Intronic
1102639237 12:114351974-114351996 CAGATTACACAGCTGGTGTGTGG - Intergenic
1103052174 12:117789824-117789846 CTGTGTACTCAGCAGGGATGGGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1106005267 13:25763842-25763864 CACAGTAGACAGAAGGGATGTGG + Intronic
1106636430 13:31533578-31533600 CAGAGGGCACAGCAAGAAGGTGG - Intergenic
1107902134 13:45027553-45027575 CAGAGTACAAACCAAGAACGGGG - Intronic
1109173986 13:59132621-59132643 CAGATTGCAAAGCAGGAAGGTGG - Intergenic
1110719253 13:78743078-78743100 CACTGTTCACAGCAGGAATCAGG - Intergenic
1111474267 13:88725220-88725242 CAGAGTAGGCACCAGGAGTGGGG - Intergenic
1111607426 13:90559444-90559466 AAGATTACACAGCTGGAAAGAGG + Intergenic
1111795339 13:92911949-92911971 AAGAGTAAACAGCATGAATTTGG + Intergenic
1111872624 13:93852355-93852377 CAGAGAACAGAATAGGAATGTGG - Intronic
1111983238 13:95038961-95038983 AAGGAGACACAGCAGGAATGAGG + Intronic
1112229029 13:97569155-97569177 CAGAGTTCACTGCAGGGATCTGG - Intergenic
1113265866 13:108617369-108617391 CAGAATGCATAGAAGGAATGAGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1115145751 14:30224162-30224184 CCTAGTACAGGGCAGGAATGAGG + Intergenic
1115220484 14:31053454-31053476 CAGAGGCCAGAGAAGGAATGGGG + Intronic
1115530210 14:34320100-34320122 CAGAGGACTCAGGAGGAATCTGG + Intronic
1116412912 14:44646812-44646834 GAGAGGACACAGCAAGAAGGTGG - Intergenic
1116753135 14:48911630-48911652 GAGAGGACACAGTAAGAATGTGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117513046 14:56471945-56471967 CAGAGTTCACTGTGGGAATGTGG + Intergenic
1118634960 14:67739962-67739984 CACATTCCACTGCAGGAATGGGG + Intronic
1118675378 14:68179067-68179089 TAGAGTACTCTGCAGGAAGGTGG - Intronic
1118708964 14:68504153-68504175 CAGAGTACAGAGCTGGATCGGGG + Intronic
1119909643 14:78337961-78337983 CAGAGTACCCAGTGGGAAGGTGG + Intronic
1120260462 14:82178166-82178188 CAGAGGACAAAGAAGAAATGAGG - Intergenic
1120415002 14:84208084-84208106 GTGAGTACACAGCAAGAAGGTGG - Intergenic
1121007718 14:90500935-90500957 CAGAGGAGACAGCAGGACTGGGG + Intergenic
1121227331 14:92330705-92330727 CTGAGCACACAGCAAGAAGGTGG - Intronic
1121930523 14:97967727-97967749 AAGAGTACACAGCAGAGCTGGGG - Intronic
1122831205 14:104396963-104396985 GAGAGGACACAGCAAGAAGGAGG - Intergenic
1122877933 14:104677413-104677435 CAGAGTCCAGGGCAGCAATGGGG - Intergenic
1124154085 15:27209871-27209893 GTGAGGACACAGCAGGAAGGTGG - Intronic
1124877108 15:33605359-33605381 CAGAGGAGACAGGAGGGATGAGG - Intronic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1128557979 15:68644706-68644728 CAGGGCCCACAGCAGGAGTGGGG - Intronic
1129069096 15:72936360-72936382 CAGAGTACACATCAGGCACTGGG + Intergenic
1129070267 15:72945210-72945232 GGGAGTCCACAGTAGGAATGTGG - Intergenic
1129363949 15:75043065-75043087 CAGAGGCCACAGCAGGCAGGAGG - Intronic
1130559900 15:84949855-84949877 TCTAGGACACAGCAGGAATGGGG + Intergenic
1131379253 15:91950170-91950192 CAGAGGAAGCAGCTGGAATGAGG + Intronic
1131488938 15:92845155-92845177 CAAAGTACAAAGCAGGAGTAAGG - Intergenic
1131871998 15:96773031-96773053 CAGAGTGCAGAGCAGTGATGAGG - Intergenic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1132389356 15:101427296-101427318 CACAGAACAGAGCAGGCATGAGG + Intronic
1132574430 16:658012-658034 CAGAGTACACATCAGCCATGTGG + Intronic
1133120492 16:3603755-3603777 CCAAGTACACAGCAGCTATGGGG + Intronic
1133489598 16:6254833-6254855 CAGAGAACAGGGCAGGAAAGAGG - Intronic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1134612232 16:15618568-15618590 AAGAGAGCACATCAGGAATGGGG - Intronic
1135890906 16:26356351-26356373 GAGAAGACACAGCAGGAAGGTGG - Intergenic
1138416693 16:56875731-56875753 CAGTGCACACAGCAGGGAAGAGG + Intronic
1140011103 16:71132305-71132327 AAGAGTGCACAGGTGGAATGTGG + Intronic
1140269493 16:73452239-73452261 TAGAGTTCACAGCATGAAGGAGG - Intergenic
1140779714 16:78283380-78283402 CAGAGTGGAAAGCAGGTATGAGG - Intronic
1141057848 16:80835138-80835160 CAGAGGACACAGTTGAAATGAGG + Intergenic
1141149267 16:81552866-81552888 CAGAGTGCACAAGAGGAATGAGG + Intronic
1142334812 16:89481049-89481071 CAGAAAAGAAAGCAGGAATGGGG - Intronic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1144357244 17:14458047-14458069 CAGAGTACAGGGCAGAGATGAGG - Intergenic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1147406764 17:40217999-40218021 CAGGGAACACAGCAGGCATAGGG - Intergenic
1147844823 17:43397751-43397773 CAGAGCACACAGTATGAATGAGG + Intergenic
1148172764 17:45537123-45537145 GAGAAGACAAAGCAGGAATGGGG - Intergenic
1148276506 17:46308326-46308348 GAGAGGACAAAGCAGGAATGGGG + Intronic
1148298622 17:46525919-46525941 GAGAGGACAAAGCAGGAATGGGG + Intronic
1148363156 17:47030411-47030433 GAGAGGACAAAGCAGGAATGGGG + Intronic
1150403969 17:64884038-64884060 GAGAGGACAAAGCAGGAATGGGG - Intronic
1151018317 17:70583198-70583220 GAGAGAAGACAGGAGGAATGAGG - Intergenic
1151772032 17:76170008-76170030 CTGAGTGCACAGCAGGACTTGGG + Intronic
1151887652 17:76932615-76932637 CCGAGCACGCAGAAGGAATGGGG - Intronic
1151941671 17:77296118-77296140 CGGAGGACACAGCAGGGAGGTGG + Intronic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152999236 18:438522-438544 CACAGCACCCAGCTGGAATGAGG - Intronic
1154047861 18:10924112-10924134 CAGAGTGGAGAGCAGGAATTGGG - Intronic
1154334328 18:13453807-13453829 CAGATTACACAGCAGTACTGGGG - Intronic
1154417490 18:14189182-14189204 CATAGTGCACAGCAAGCATGAGG - Intergenic
1156277226 18:35594894-35594916 CAGAGGACAAATCAGGATTGAGG + Intronic
1157299207 18:46467609-46467631 CACAGTAGACAGCAGGGATGAGG + Intergenic
1157391603 18:47307895-47307917 CAGGGTTCACAGCAGACATGAGG - Intergenic
1157802069 18:50628733-50628755 CAGAGCCCACAGGAGGAATGTGG - Intronic
1158395135 18:57073368-57073390 CAGGGGACCCAGCAGAAATGAGG + Intergenic
1158744495 18:60183643-60183665 CAGAGGAAACAGCAGGGATAGGG + Intergenic
1159354331 18:67318017-67318039 CAAAGGACACAGCAGAAATCAGG - Intergenic
1160405141 18:78640163-78640185 CAGTGTAGACAGCTGGGATGGGG + Intergenic
1161686128 19:5703517-5703539 AAGAGCACACGGCAGGATTGGGG + Intronic
1163233422 19:16018382-16018404 CAGAGACCCCAGCAGGCATGGGG + Intergenic
1163328452 19:16620315-16620337 CAGCGGACACAGCTGGAAGGAGG - Intronic
1163781486 19:19251625-19251647 CAGAGTCCAGAGCAGGATTTGGG - Exonic
1163831309 19:19548360-19548382 CAGAGTTATCAGCAGGGATGGGG - Intergenic
1163860579 19:19740714-19740736 CAGAGACCCCAGCAGGCATGGGG + Intergenic
1164079689 19:21851713-21851735 CAGGGTACCGCGCAGGAATGGGG + Intronic
1164399043 19:27890333-27890355 CTGTGTCCCCAGCAGGAATGAGG + Intergenic
1164564894 19:29318723-29318745 CAGAGTTCCCAGCAGAAATCTGG + Intergenic
1164737367 19:30551756-30551778 AAGAGGACACAGAAGAAATGGGG - Intronic
1165165190 19:33849170-33849192 AGGAGTCCACAGCAGGAATGTGG - Intergenic
1165269320 19:34691424-34691446 CAGACTGCAAAGCAGGAAGGGGG - Intergenic
1166293649 19:41878645-41878667 CAGAGTACAAAGTGGGTATGCGG + Intronic
1166424299 19:42662167-42662189 CAGTGGACACAGCAGGAGTTTGG + Intronic
1166431584 19:42732497-42732519 CAGTGAACACAGCAGGGATTTGG - Intronic
1166491128 19:43261574-43261596 CAGTGAACACAGCAGGGATTTGG - Intronic
1166635933 19:44452067-44452089 TGGAGTCCTCAGCAGGAATGTGG + Intergenic
1168511286 19:56975513-56975535 CAGAGGCCTCATCAGGAATGTGG - Intergenic
925018516 2:550603-550625 CAGTGTACAGAGCAGGATTCTGG + Intergenic
925024881 2:599815-599837 CAGAGTCCACAGCAGGACCTGGG - Intergenic
925217854 2:2112561-2112583 CAGATAACACAGCTGTAATGGGG - Intronic
927209431 2:20629735-20629757 AGGAATACACAGCAGGAAAGCGG - Intronic
927703676 2:25283964-25283986 CAGAGCACACAGCAGGCACCCGG - Intronic
928214319 2:29348732-29348754 CAGATCACATAGAAGGAATGAGG + Intronic
930281704 2:49377302-49377324 AAGAGTACCCAGCAGGGAAGAGG + Intergenic
930892079 2:56401635-56401657 GAGAGGACACAGTAGGAGTGGGG - Intergenic
931707026 2:64955097-64955119 CAGATCACACAGCTGGAAAGTGG - Intergenic
933096472 2:78189469-78189491 CAGTGTACACAGCCTGTATGAGG - Intergenic
934476867 2:94599420-94599442 CAGAGTACAGAGCAGCTTTGGGG - Intronic
934528010 2:95063837-95063859 CTGTGCACACAGCAGGAAAGGGG - Intergenic
934938662 2:98483741-98483763 CAGAGTAGCCAACAGGAAGGTGG - Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935091087 2:99895672-99895694 CAGAGCACACAGCAGGGACTCGG + Intronic
935117619 2:100150457-100150479 CAAGTTACACAGCAGGGATGAGG - Intergenic
936370251 2:111897847-111897869 CAAAGTGCAGAGCAGGAGTGGGG - Intergenic
937760106 2:125590645-125590667 CAGAATACTCAGCAGCTATGAGG - Intergenic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938227119 2:129625776-129625798 GAGAGGACAGAGCAGGAGTGTGG + Intergenic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
941522386 2:166562295-166562317 CATAGTGCACAGCAGGATTTAGG - Intergenic
941583854 2:167332182-167332204 AGGAGTCCACAGCAGGAATGTGG + Intergenic
942369884 2:175272220-175272242 CAAACTACACACCAGGTATGGGG - Intergenic
942644532 2:178095934-178095956 CAGAGCACAGAGCAGCAGTGGGG + Intronic
944510028 2:200455614-200455636 CAGCTTCCACAGTAGGAATGTGG + Intronic
944740025 2:202602993-202603015 AAGAATACACAGTAGAAATGGGG + Intergenic
945395211 2:209307709-209307731 CAGAGTGGGCACCAGGAATGGGG + Intergenic
945629960 2:212262089-212262111 CAGAGTACACAGCCAAAAAGTGG - Intronic
945803480 2:214462274-214462296 AAGAGTCCACAGTGGGAATGTGG + Intronic
947713562 2:232329151-232329173 CAGAGGACAGGGCAGGAGTGGGG - Intronic
948301399 2:236909788-236909810 CAGCGTGCACACCAGGGATGAGG - Intergenic
948644413 2:239394854-239394876 CAGGGTACAGAGCAGGCATGAGG + Intronic
948860952 2:240752377-240752399 CGGAGCACCCAGCAGGACTGTGG - Intronic
1168755888 20:317409-317431 CAAAGGAGACAGCATGAATGAGG + Intergenic
1170882900 20:20313214-20313236 GTGAGGACACAGCAGGAAGGTGG + Intronic
1171004765 20:21453663-21453685 CAGAGAAGACAGCAGGAAAGAGG + Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1173395892 20:42679020-42679042 CAGCAGACCCAGCAGGAATGAGG + Intronic
1173845815 20:46187771-46187793 CAGAGCACACAGCATGCACGTGG + Intronic
1174165816 20:48582840-48582862 CAGTGTACATTGCATGAATGTGG - Intergenic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1175247260 20:57589687-57589709 CATGGCACACAGCAGGAGTGGGG - Intergenic
1175558601 20:59896114-59896136 CAAAGTACACAGCTGGAAGTGGG + Intronic
1175659664 20:60801829-60801851 CAGAAAAGGCAGCAGGAATGAGG + Intergenic
1175732319 20:61362287-61362309 CAGAGTATTCAGCAGGGAAGGGG + Intronic
1176855825 21:13970082-13970104 CATAGTGCACAGCAAGCATGAGG + Intergenic
1178209881 21:30517503-30517525 CAGAGTGAACAGCATGATTGTGG - Intergenic
1178468528 21:32870946-32870968 CAGAGGACACAGCTGGTAAGTGG - Intergenic
1179267283 21:39814910-39814932 ATGAGTACACAGCAAGAAGGTGG + Intergenic
1179893224 21:44348173-44348195 CAGAGGACACTCCAGGAAGGAGG - Intergenic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1180258523 21:46650689-46650711 AAGAGGACAGAGCAGGAGTGAGG + Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181037630 22:20177575-20177597 CAGGGTGCACAGCAGGGCTGGGG - Intergenic
1183115603 22:35690251-35690273 CAGCTTACAAAGCATGAATGAGG - Intergenic
1184653275 22:45928934-45928956 AAGTGTACACAGCAGAGATGCGG - Intronic
1185029811 22:48436289-48436311 CAGAGGGGACAGCAGGGATGGGG + Intergenic
949169363 3:980406-980428 CAGAGTCCAGAGGAGGATTGTGG + Intergenic
950364886 3:12475883-12475905 CAGAGTACAGAGCAGGGATCTGG - Intergenic
950885579 3:16359563-16359585 GTGAGGACACAGCAGGAAGGTGG + Intronic
951035886 3:17931423-17931445 CACAGTACACAGAATGTATGGGG - Intronic
952104061 3:30049704-30049726 GTGAGTACACAGCAAGAAGGTGG - Intergenic
953098421 3:39801865-39801887 CAGAGTACACAGCAGGTCTGTGG - Intergenic
953226666 3:41027814-41027836 AAGAGTGGACAGCAGGGATGAGG + Intergenic
953505591 3:43482858-43482880 CAGGGTACAGGGCAGGGATGGGG + Intronic
954884006 3:53856112-53856134 CAGAGAACACTGCAGGTGTGAGG + Intronic
956422871 3:69102614-69102636 CAGGTCATACAGCAGGAATGTGG + Intronic
956794923 3:72709189-72709211 AAGAGGACACAGCAAGAAAGTGG + Intergenic
957960053 3:87237387-87237409 CTGAGAACACAGCAAGAAGGTGG + Intronic
959403666 3:105934249-105934271 CAAAGGACACATTAGGAATGTGG + Intergenic
960436525 3:117633574-117633596 CAAGTTACACAGCAGGGATGGGG + Intergenic
965074478 3:163959290-163959312 AGGAGTCCACAGGAGGAATGTGG - Intergenic
965695075 3:171400018-171400040 CACAGGACACAGCAGGAGTAAGG + Intronic
965952373 3:174326056-174326078 CAGAGGTCACAGCAGGGATGAGG - Intergenic
966212146 3:177464442-177464464 CAGAGGACAAAGCAGGAAAAGGG - Intergenic
968705419 4:2075308-2075330 CAGGTGACACAGCAGCAATGAGG + Intronic
968902006 4:3436312-3436334 CTGAGAACACGGCAGGAAGGGGG - Intronic
969370987 4:6731550-6731572 AAGAGTACACAGCCGGAAAAAGG - Intergenic
969372524 4:6742977-6742999 CGGAGTCAACAGCAGGAACGAGG + Intergenic
971035892 4:22692600-22692622 CAGAGTACGGATCAGGAATTGGG + Intergenic
971710098 4:30099603-30099625 CAGAAAACACAGCAAGAATGAGG - Intergenic
972044324 4:34645141-34645163 AGGATTACACAGCAGAAATGTGG + Intergenic
973821218 4:54663266-54663288 CAGAGCACACAGCAGGGAAGAGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
977718062 4:100206384-100206406 CAAAGAACAATGCAGGAATGGGG - Intergenic
977923068 4:102667163-102667185 CAGGGTTCTGAGCAGGAATGTGG + Intronic
978189332 4:105895154-105895176 CAGGGTGCCCAGCAGGAAAGGGG - Intronic
979576448 4:122297122-122297144 CAGAGTAAACAGACAGAATGGGG + Intronic
980789623 4:137603256-137603278 AAGATTACACAGCTGGAAAGTGG - Intergenic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
982840845 4:160184271-160184293 CAGAGTAAAAGGCAGGAATTTGG - Intergenic
983779490 4:171650765-171650787 AAGAGTTCACAGTGGGAATGTGG - Intergenic
984869137 4:184311335-184311357 CACAGCACAGAGCAAGAATGGGG - Intergenic
985286019 4:188336975-188336997 CAGCCTTCAGAGCAGGAATGAGG - Intergenic
985720183 5:1484840-1484862 CTGAGCCCACAGCAGGAAGGGGG - Intronic
985934085 5:3081144-3081166 CAGATGACAAAACAGGAATGCGG - Intergenic
985986389 5:3520197-3520219 CAAAATACACAGCAGAATTGTGG + Intergenic
986363974 5:7011077-7011099 CAGAGGACACAGCATGTATAGGG + Intergenic
986808022 5:11327136-11327158 CAGAGAAGACAGCCGGGATGTGG + Intronic
987591201 5:19929362-19929384 CAGAGGACACAGCAAGCATTAGG + Intronic
987962772 5:24831934-24831956 CAGAGAACACAGCAGGAGCTAGG - Intergenic
988223889 5:28386176-28386198 GAAAGCACACAGCAGGAAAGGGG + Intergenic
990723215 5:58722356-58722378 CAGAGAAGGCAGCAGGCATGGGG + Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991432126 5:66559262-66559284 CAGAAGGCAAAGCAGGAATGAGG + Intergenic
991620472 5:68539802-68539824 CTGAGTACAGAACAGGAATTTGG - Intergenic
992232703 5:74679380-74679402 CACAGTAGCCAGCAGTAATGTGG + Intronic
993345994 5:86783380-86783402 CAGAGGACACACCATGGATGTGG - Intergenic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994588709 5:101746147-101746169 GAGAGTACACAAGAGGAATCTGG + Intergenic
998025837 5:138815479-138815501 CAGGGCACCCAGCAGGAAAGAGG - Intronic
1000014217 5:157263655-157263677 CAGAGAACACAGCAAGTTTGAGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002359749 5:178661255-178661277 CAGAGGACACAAAGGGAATGAGG - Intergenic
1002592539 5:180300650-180300672 CAAAGTACACAAAAAGAATGAGG + Intergenic
1003140429 6:3467043-3467065 CTGAGGACACAGCAACAATGGGG + Intergenic
1003311191 6:4971215-4971237 GTGAGGACACAGCAGGAAGGTGG - Intergenic
1003773363 6:9332620-9332642 AACAGTACACAGCTGGAATTTGG + Intergenic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1004288929 6:14348971-14348993 GTGAGGACACAGCAGGAAGGCGG - Intergenic
1004982252 6:21038396-21038418 CTGAGCACACAGCAGGGCTGGGG + Intronic
1006436999 6:34030921-34030943 CCCTGTACACAGCAGGAGTGGGG + Intronic
1006499580 6:34449303-34449325 CACAGAAGACAGCAGGAGTGAGG - Intergenic
1006535860 6:34698127-34698149 AAGATTACACAGCTGGAAAGTGG + Intergenic
1008025233 6:46628634-46628656 CAGAGTACAAAGTAGGAGAGAGG + Intronic
1008855662 6:56083404-56083426 AAAAATACAGAGCAGGAATGGGG - Intronic
1013752771 6:113426310-113426332 CAGGGTACAAAGCAGGCCTGGGG - Intergenic
1013817572 6:114117084-114117106 CAGAGGATTCAGCCGGAATGGGG - Intronic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1018322342 6:162624837-162624859 AAGAGAACACAGCAGGGATGTGG + Intronic
1019162414 6:170077698-170077720 CAGAGGACACAGCGAGAAGGCGG - Intergenic
1019919772 7:4156169-4156191 CAGAGTGGGCATCAGGAATGTGG - Intronic
1019962509 7:4472769-4472791 CAGAGCACACAGCAGGCACTCGG + Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1022637956 7:32155003-32155025 GAGAGTCCACACCAGGCATGAGG + Intronic
1023059856 7:36316581-36316603 CACAATACACAGCAGGCCTGGGG - Intergenic
1023280248 7:38561829-38561851 AAGAGAACACAGCAAGAAGGTGG + Intronic
1026116793 7:67502599-67502621 ATGAGGACACAGCAGGAAGGTGG - Intergenic
1026445698 7:70482783-70482805 TAGAGAAAGCAGCAGGAATGGGG - Intronic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1029485401 7:100836840-100836862 GGGAGTTTACAGCAGGAATGGGG + Intronic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1032762453 7:134956506-134956528 ATGAGGACACAGCAGGAAGGTGG + Intronic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1033653903 7:143361292-143361314 CTCCGGACACAGCAGGAATGGGG + Intronic
1033965970 7:146975521-146975543 CAGAATGCACAGCAGTGATGTGG - Intronic
1034495256 7:151417038-151417060 CAGACCACAGAGCAGGAACGGGG + Intergenic
1034881698 7:154767694-154767716 AAGAACACACAGCAGGACTGGGG + Intronic
1034934151 7:155187749-155187771 CAGAGGGCACAGCAGGGAAGTGG - Intergenic
1035589503 8:802149-802171 CAGAGGACCCAGGAGGAGTGCGG - Intergenic
1035673656 8:1439373-1439395 CAGGGTACACGGCAGGACCGTGG - Intergenic
1036697524 8:10987595-10987617 CAGAATACACTGTGGGAATGTGG - Intronic
1036774201 8:11598907-11598929 GTGAGGACACAGCAAGAATGTGG + Intergenic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1037443645 8:18942964-18942986 CAGCCCACACAGGAGGAATGTGG + Intronic
1037629025 8:20636230-20636252 CAGAGTACATCGCAGGTATTAGG + Intergenic
1039914687 8:41851302-41851324 CAGAGAACACTCCAGCAATGAGG + Intronic
1040413522 8:47178629-47178651 CAGACTCCACAGGATGAATGAGG - Intergenic
1040740732 8:50571328-50571350 AAGAGAACACAGCAGGAATGTGG + Intronic
1041928656 8:63264570-63264592 CAGACTACAAAGCAGGAAGGAGG - Intergenic
1041970953 8:63742172-63742194 CTGAGGACACAGCACGAAGGTGG + Intergenic
1045646942 8:104308454-104308476 GTGAGGACACAGCAGGAAGGCGG + Intergenic
1045718278 8:105074482-105074504 CAGTGGACAGAGCAGGAAAGGGG + Intronic
1046548072 8:115676463-115676485 CAGAGGACAGAGCAGGGATATGG - Intronic
1047136331 8:122082802-122082824 CTGAGTACACAGTAGGCAGGGGG - Intergenic
1047576517 8:126161676-126161698 CAGAGTACACAGGAGAAACTTGG + Intergenic
1047665968 8:127091432-127091454 AAGTGGACACAGCAGGAAGGTGG + Intergenic
1047757728 8:127931596-127931618 CAGATCACACAGCTGGAAAGTGG + Intergenic
1048380446 8:133860639-133860661 CAGATTACATAGGAAGAATGGGG + Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1050299554 9:4243241-4243263 CAGAGTACAGTACAGGAAGGAGG + Intronic
1050437337 9:5625133-5625155 AAGAGTACACATAAGAAATGGGG - Intergenic
1051104733 9:13566488-13566510 CAGAGTACACAGCTGGCAGGTGG + Intergenic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1052067591 9:24041423-24041445 CAGAGGGCACAGCAGACATGTGG - Intergenic
1052290416 9:26833894-26833916 CAGACAACACAACAGGAGTGAGG + Intergenic
1052675504 9:31617264-31617286 GTGAGTACACAGCAAGAAGGTGG + Intergenic
1052853161 9:33390489-33390511 CAGAGTACAGAGCAGCTTTGGGG + Intronic
1053931188 9:43114989-43115011 CAGAGTACAGAGCAGCTTTGGGG + Intergenic
1055240894 9:74184273-74184295 TAGAGGACACAGCAGCAGTGTGG + Intergenic
1055767958 9:79685230-79685252 CAAATTACCCAGCAGGAATGAGG - Intronic
1056557082 9:87698494-87698516 CACAGTGCACAGCAGGCGTGGGG + Intronic
1056695849 9:88851389-88851411 AAGAGAACACAGCAAGAAGGTGG + Intergenic
1056906142 9:90649547-90649569 ATGAGGACACAGCAGGAAGGTGG + Intergenic
1057496621 9:95566100-95566122 CAGACCATACAGCAGGCATGTGG + Intergenic
1058135737 9:101305811-101305833 CTGAGTCCATAGCAGGAATAGGG + Intronic
1060720121 9:125971072-125971094 AAGAGTACACAGCTGGTAGGAGG - Intergenic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1061011210 9:127955699-127955721 GAGAGGAAACAGCATGAATGAGG + Intronic
1062670387 9:137705522-137705544 TAGAGTACACACCAGGACGGTGG - Intronic
1185823231 X:3224874-3224896 CAGGGTTCACAGAAGGAATGAGG + Intergenic
1187287908 X:17923794-17923816 CAGCCTCCACAGCAGCAATGTGG - Intergenic
1187310182 X:18134291-18134313 AAGACTAAAGAGCAGGAATGAGG + Intergenic
1187459440 X:19473144-19473166 CTGAGGAGACAGCAGGAATCCGG + Intronic
1187677572 X:21732911-21732933 CAAAGGACACAGCAAGAATATGG + Intronic
1189141539 X:38612218-38612240 CTGAGCGCCCAGCAGGAATGTGG + Intronic
1189271900 X:39757928-39757950 CAGAGTCCACTGGATGAATGCGG + Intergenic
1189392284 X:40586280-40586302 CAGACAACACATCAGGAGTGAGG - Intronic
1189528987 X:41858508-41858530 CTGAGCACCCAGCAGGAATTTGG - Intronic
1190922835 X:54872579-54872601 CAGAGAACCCAGCTGCAATGTGG - Intergenic
1191112270 X:56813274-56813296 CAGAGTCCACAAAAAGAATGGGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1194689339 X:96963567-96963589 CAGAGTTCACAGTGGGAATCTGG + Intronic
1195139887 X:101948787-101948809 CAAAAGACACAGTAGGAATGTGG - Intergenic
1195155023 X:102114278-102114300 CAGAGTACACAGCAATTGTGAGG - Intergenic
1196573827 X:117295405-117295427 GTGAGGACACAGCAAGAATGTGG - Intergenic
1196647530 X:118133795-118133817 AAGAACACACAGCTGGAATGTGG - Intergenic
1198504446 X:137287517-137287539 CACAGTACAAAGGAGAAATGAGG + Intergenic
1198518686 X:137431314-137431336 CAGAATCCCAAGCAGGAATGTGG + Intergenic
1199736577 X:150692025-150692047 GTGAGTACACAGCAAGAAGGTGG - Intergenic
1199737345 X:150696226-150696248 CAGACTACAGAGAAGGGATGGGG + Intronic
1200386232 X:155893632-155893654 CTGAGAACACAGCAAGAAGGTGG - Intronic
1200833972 Y:7714625-7714647 ATGAGGAAACAGCAGGAATGTGG + Intergenic
1201665982 Y:16455130-16455152 AAGAGGACACAGCAAGAAGGTGG - Intergenic
1201903635 Y:19067860-19067882 CAGAAAATAAAGCAGGAATGGGG - Intergenic