ID: 1143802160

View in Genome Browser
Species Human (GRCh38)
Location 17:9392286-9392308
Sequence TTGCTAAGAAGCATAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143802155_1143802160 29 Left 1143802155 17:9392234-9392256 CCGGAAAATTTCAAGTTGCATAA 0: 1
1: 0
2: 3
3: 37
4: 322
Right 1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 152
1143802158_1143802160 2 Left 1143802158 17:9392261-9392283 CCTGGGAAAAGACAACAAGATGC 0: 1
1: 0
2: 1
3: 15
4: 244
Right 1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143802160 Original CRISPR TTGCTAAGAAGCATAGTTGT TGG Intronic
901590601 1:10338406-10338428 TTGCTACAAGTCATAGTTGTTGG + Intronic
903581458 1:24373911-24373933 TTGCTAAGAAGGACAGGTTTCGG - Intronic
908625156 1:66032070-66032092 TTGGTAACAAGCCTAGTTGATGG - Intronic
908973891 1:69873291-69873313 TTGTAAAGAGGCATAGTTCTAGG - Intronic
909163337 1:72182860-72182882 TTGCTAAAAAGCAAACCTGTGGG - Intronic
909417914 1:75428386-75428408 TTGCTAACAAGGATAATTGATGG - Intronic
913473959 1:119218562-119218584 TTGCTATGAAAAATAGATGTGGG + Intergenic
916595552 1:166239187-166239209 ATTCTAAGAAGCATGGTTGCTGG + Intergenic
1067838504 10:49656780-49656802 TTGCTGAGAGGCAGAGTTGCTGG + Intronic
1073532062 10:104241359-104241381 TTCCTATGTAGCATAGTTGGTGG - Intronic
1077076298 11:703747-703769 TTGCTAGGCAGCAGAGCTGTTGG - Intronic
1080307655 11:30854089-30854111 TAGTCAAGAAGCAGAGTTGTGGG + Intronic
1082777517 11:57258787-57258809 TGGCTAATAAGCATAGTACTAGG - Intergenic
1083950754 11:65954483-65954505 TTCCTAATAAGCAGATTTGTGGG + Intronic
1084592209 11:70097356-70097378 CTGCTATGAAGCACAGTTGAGGG - Intronic
1085581182 11:77652112-77652134 TTGCCAAGAAGCAAAATTGCTGG + Intergenic
1086260925 11:84939571-84939593 TGGCTAGGAAGGATAGTGGTGGG - Intronic
1087663138 11:101010990-101011012 TTGCTGGGAAGTAAAGTTGTGGG - Intergenic
1087979635 11:104595228-104595250 TTGCTAAGAAGGAAAATTATAGG - Intergenic
1092971089 12:13695771-13695793 TTGTTAAGAAAAATAGTGGTTGG + Intronic
1093706524 12:22280700-22280722 TTGCTCAGAAGAATAGCTGATGG - Intronic
1095687046 12:45048649-45048671 TTTTTAAGCAGCATATTTGTGGG + Intronic
1098476779 12:70913896-70913918 TAGGTAACAAGCATAGTTCTAGG + Intronic
1099051035 12:77781773-77781795 TTGCCAAGAACCATGCTTGTGGG - Intergenic
1100954062 12:99886575-99886597 TTGCTAAGAAACTTTGTTGATGG - Intronic
1104099832 12:125596858-125596880 TTTCATAGAAGCACAGTTGTAGG + Intronic
1107758776 13:43653753-43653775 TTGCTAAGAAGAGTAGGTATGGG - Intronic
1109805936 13:67442880-67442902 TTGCTTAGAAGGATATTTTTGGG - Intergenic
1110657778 13:78020672-78020694 TTGCAGAGAACCATAGTCGTGGG + Intergenic
1113400977 13:109992993-109993015 TTGCTGAGAAGCGAAGTTGAAGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1116148580 14:41107327-41107349 ATGATAAGAAGTATGGTTGTAGG - Intergenic
1116798562 14:49418004-49418026 ATGCTAAGCAGTTTAGTTGTAGG - Intergenic
1117910357 14:60632003-60632025 TTCCTAAGGACCATAGTTTTTGG - Intergenic
1118373856 14:65159951-65159973 TTGTTAAAATGCATATTTGTAGG - Intergenic
1120284929 14:82487933-82487955 TTGCTAACTAGCATATTTGAAGG + Intergenic
1120636179 14:86954044-86954066 TTGCTAAGGAGCAGAGATGGTGG + Intergenic
1121913844 14:97818150-97818172 TTGTTAAACAGCTTAGTTGTAGG + Intergenic
1124936894 15:34181335-34181357 TTTCCAAGAAACATAGTTTTTGG + Intronic
1125117386 15:36111050-36111072 TTTCTAGGAAGCATTTTTGTTGG - Intergenic
1127557688 15:60104171-60104193 TTGTCAAGTAGCATAGTTGTAGG + Intergenic
1128952070 15:71895770-71895792 TTTCCAAGATACATAGTTGTAGG - Intronic
1128998697 15:72315966-72315988 TTTCGAAGAAGAATAGTTGGGGG - Intronic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1133868502 16:9666286-9666308 TTCCTAAGAAAAACAGTTGTTGG - Intergenic
1135498787 16:22975803-22975825 GTGCTGAGAATCATAGATGTAGG + Intergenic
1139197301 16:64934485-64934507 TTGGTAAGAAACACAGTAGTTGG + Intergenic
1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG + Intronic
1145949202 17:28802929-28802951 TTGCTAATAATCAGAGCTGTTGG - Intronic
1147124270 17:38355015-38355037 TTGCAAAGAAGCTTAGTTCAGGG + Intronic
1150731205 17:67696155-67696177 TCTCTAAGTAGCACAGTTGTGGG + Intronic
1150982399 17:70157183-70157205 TTGTCAAGAAGCATAGTAGAGGG + Intergenic
1151024994 17:70668233-70668255 TTGCTAAAACCCATAGTTATTGG - Intergenic
1152332885 17:79683762-79683784 TTGCCAAGAAGGAGAGTTGTCGG - Intergenic
1153589581 18:6659264-6659286 TTGCTAAGAAGCACATCTATGGG - Intergenic
1153768292 18:8395609-8395631 TTTCCAAGAAGCATGGCTGTTGG + Intronic
1154419292 18:14210977-14210999 TTGCTAAGAAGCATTCTGTTTGG - Intergenic
1156442545 18:37205998-37206020 TTGCTTAGAAGAATATTTGTTGG + Intronic
1156654830 18:39272656-39272678 TTGCTGAGAGGGATAGTGGTAGG + Intergenic
1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG + Intronic
1167849902 19:52193524-52193546 TTGCTAAGAAGAAAAATTGCTGG + Intronic
1168054480 19:53854397-53854419 TTGCTGGGAAGCAAAGTTCTGGG - Intergenic
926401172 2:12498633-12498655 TTTCTAAAGAGCATAGTTGCAGG + Intergenic
933314462 2:80699552-80699574 TTGGTCAGAAGCAATGTTGTGGG - Intergenic
934497956 2:94826360-94826382 TTGCTAAGAAGCATTCTGTTTGG + Intergenic
936764733 2:115833043-115833065 AAGTTAAGAAGCATTGTTGTGGG + Intronic
937584721 2:123532476-123532498 TTTCTAAATAGCATAGTTTTAGG + Intergenic
937743608 2:125385556-125385578 ATACCAAGAAGCATAGTTGCTGG - Intergenic
937814534 2:126236844-126236866 TTGCTAAGAAGAAAAGTAGGAGG + Intergenic
942782388 2:179660076-179660098 TTGCTAAGAAACATGCTTCTTGG - Intronic
943636944 2:190317426-190317448 TTGCTGGGAAGCACAGTTCTAGG - Intronic
944860188 2:203808676-203808698 TTTCTTATAAGCATAGTTGTAGG - Intergenic
945570333 2:211459366-211459388 TTTCTGAGAAGGAGAGTTGTGGG - Intronic
1169164323 20:3408774-3408796 TTACTAAGAAGCATAGTTACCGG - Intergenic
1170377354 20:15714494-15714516 CTGCTAAGAAGAAAAGTTGGGGG + Intronic
1173159479 20:40641765-40641787 TGGCTAACAAGCAGGGTTGTTGG - Intergenic
1173850823 20:46216633-46216655 TTGGTAGGAAGCATGGTTGGAGG + Intronic
1176854015 21:13948316-13948338 TTGCTAAGAAGCATTCTGTTTGG + Intergenic
1176972228 21:15280095-15280117 TTGGTGAGGAGGATAGTTGTGGG - Intergenic
1177095240 21:16824111-16824133 TTGCTGAGAAGCTGAGTGGTGGG + Intergenic
1178022419 21:28424682-28424704 TTGATAAAATGCATAGATGTTGG + Intergenic
1178142378 21:29699012-29699034 TTTCTGGGAAGCATAGATGTTGG + Intronic
1179205788 21:39277173-39277195 TTGCTAAGGGGCATTGTTATTGG - Intronic
1179834505 21:44020993-44021015 TTTCTCAGAAGCATAATTTTAGG - Intronic
1182252068 22:29008734-29008756 TGGTTAACAAGGATAGTTGTTGG - Intronic
1183123504 22:35751578-35751600 CTGCTAAGAACCATGGTTCTAGG + Intronic
949357895 3:3201333-3201355 GAGTTTAGAAGCATAGTTGTGGG - Intergenic
949862502 3:8518960-8518982 GTGCCAAGAAGCATAGATGATGG + Intronic
951077973 3:18420355-18420377 TTCCTAAGATTCTTAGTTGTAGG - Intronic
955260757 3:57388053-57388075 TGGCTAGGAAGCAAATTTGTAGG - Intronic
955768044 3:62365320-62365342 TTGATATAAAGAATAGTTGTTGG + Intergenic
962216846 3:133529997-133530019 TTGTTAAGATGCAGAGTTCTGGG - Intergenic
963719573 3:148845624-148845646 TTGGTAAGTAGCAAAGTAGTAGG + Exonic
964200919 3:154118468-154118490 ATGCCAAGAAACATAGTTGAAGG + Intergenic
965383680 3:168020959-168020981 TTGCTAAGAGGGCCAGTTGTGGG - Intronic
970218371 4:13782745-13782767 GTGATAAGAAGCACAGATGTTGG + Intergenic
971490619 4:27208634-27208656 GTTCTAAGAACCATAGTTATTGG - Intergenic
973177523 4:47226070-47226092 TTGCTATTAAACATAGTTCTAGG + Intronic
973565107 4:52177883-52177905 TTGCTTAGCATCACAGTTGTTGG + Intergenic
976443051 4:85098743-85098765 ATGCTCAGAAGTATAATTGTTGG + Intergenic
983114798 4:163801208-163801230 TAGCTAAGATACAAAGTTGTGGG - Intronic
983763898 4:171451890-171451912 TTTCTAAGGTACATAGTTGTAGG - Intergenic
984083033 4:175273503-175273525 TTGCTAAGGATCATAGCTGAAGG - Intergenic
985245417 4:187975661-187975683 TTGCTAAGAATAATAGTGGGGGG - Intergenic
987334883 5:16889876-16889898 TTGATAAGAATCATTTTTGTGGG + Intronic
988812402 5:34798592-34798614 CTCTTAAGAAGCATAGTTCTTGG + Intronic
989109085 5:37889911-37889933 TTCTGAAGAAGGATAGTTGTAGG + Intergenic
991065430 5:62419695-62419717 ATGATAAGAAGTATAGTAGTGGG + Intronic
993794260 5:92248203-92248225 TAGCTAATGAGGATAGTTGTAGG - Intergenic
995874796 5:116779002-116779024 TTTCTGAGAAGCATAATTATTGG - Intergenic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
998772772 5:145565115-145565137 TTTCTAAGAAGAATACTTCTGGG - Intronic
1005690594 6:28301170-28301192 TTTCTGAGAAGCATAATTATTGG - Exonic
1008842092 6:55915210-55915232 CTGCTAGGAGGCAAAGTTGTCGG + Intergenic
1009588301 6:65635214-65635236 TTGACAAGAGGCATAGTTGTGGG - Intronic
1011287363 6:85739197-85739219 TAACTAAGAAGCAGAGTTGGGGG + Intergenic
1014366474 6:120549198-120549220 TTGCTGAGAATGATAGTTGCCGG + Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1015694676 6:135966896-135966918 TTACTACCAAGCATAGTTCTAGG - Intronic
1015942405 6:138465466-138465488 TATGTAAGAAGAATAGTTGTGGG - Intronic
1016725675 6:147363578-147363600 TTGCTTATAAGCACAGTTCTGGG - Exonic
1017553406 6:155536543-155536565 TTTCTAATAAACATAGTCGTAGG - Intergenic
1018453411 6:163930146-163930168 ATTCTAAGAGGCTTAGTTGTAGG + Intergenic
1018487310 6:164254339-164254361 TTGCTAATAATGATAGATGTAGG + Intergenic
1018939752 6:168301322-168301344 TTCCTCAGAAGCAGAGGTGTAGG - Intronic
1019814859 7:3192165-3192187 AGGCTAAGAAGCATTGTTCTAGG + Intergenic
1021093337 7:16508502-16508524 AGGCTGGGAAGCATAGTTGTGGG + Intronic
1022843352 7:34185960-34185982 AAGATAAGGAGCATAGTTGTCGG - Intergenic
1023550712 7:41367364-41367386 TTGCAAAGAGGTATAGCTGTGGG - Intergenic
1024424919 7:49214103-49214125 ATGCTAATTAGCTTAGTTGTGGG - Intergenic
1028544959 7:91987627-91987649 TTGCTAAGATGGATACTAGTTGG + Intronic
1030341402 7:108384716-108384738 TTGTTAGAAAGCAAAGTTGTGGG - Intronic
1036056887 8:5265294-5265316 TGGCTAAGAAGAGGAGTTGTAGG + Intergenic
1036529946 8:9575865-9575887 TTGATAAGAAGTGTAGTGGTAGG + Intronic
1037101811 8:15055937-15055959 TTGCTATTAAGTTTAGTTGTTGG - Intronic
1037735002 8:21558680-21558702 TTGCCAAGATGCAAAATTGTAGG - Intergenic
1038042916 8:23741432-23741454 TTGCTAAAAGGCATGCTTGTAGG + Intergenic
1039545626 8:38408954-38408976 TTGCTAGGAAGCATAATTAAGGG + Intronic
1045831521 8:106467351-106467373 TTGCTAACAAATATAGTAGTGGG + Intronic
1046024679 8:108707976-108707998 TAGGTAAGAAGCATAGTACTTGG + Intronic
1047672070 8:127158924-127158946 ATGCTAAGAAGCTTAGTAGTGGG - Intergenic
1048613199 8:136046588-136046610 TTGCTAAAGAGCATAGGTTTTGG + Intergenic
1050144913 9:2556638-2556660 TTTGTCAGATGCATAGTTGTTGG - Intergenic
1052317807 9:27134197-27134219 TTGCTAGAAAGCAAAGTTTTAGG + Intronic
1052567921 9:30182205-30182227 TTGCTAAGAAACATGAATGTTGG - Intergenic
1052799456 9:32954539-32954561 TTGCTCACAATCATATTTGTAGG - Intergenic
1053528120 9:38849723-38849745 TTCCTAAGAAGAAGAGTTCTAGG - Intergenic
1053659195 9:40254158-40254180 TTGCTAAGAAGCATTTTGTTTGG - Intronic
1053909566 9:42883524-42883546 TTGCTAAGAAGCATTCTGTTTGG - Intergenic
1054200341 9:62074156-62074178 TTCCTAAGAAGAAGAGTTCTAGG - Intergenic
1054360226 9:64106944-64106966 TTGCTAAGAAGCATTCTGTTTGG - Intergenic
1054371320 9:64400459-64400481 TTGCTAAGAAGCATTTTGTTTGG - Intronic
1054525404 9:66122064-66122086 TTGCTAAGAAGCATTTTGTTTGG + Intronic
1054638013 9:67514208-67514230 TTCCTAAGAAGAAGAGTTCTAGG + Intergenic
1054678944 9:67890177-67890199 TTGCTAAGAAGCATTTTGTTTGG - Intronic
1186173898 X:6905161-6905183 TTTCTAAGAAACAGAGTTGTAGG - Intergenic
1187607305 X:20899608-20899630 TTGCAAAGAAGGATAGTGTTTGG + Intergenic
1193504016 X:82317592-82317614 TTGCTAAAAAGCAAAGCTGAGGG - Intergenic
1193799738 X:85920419-85920441 TGGGTAAGAAGCACAGTAGTAGG + Intronic
1196373742 X:115008004-115008026 TTACTACAAAGCATAATTGTCGG + Exonic
1202086070 Y:21138178-21138200 TTGTTAATAAGCATATTTGGTGG + Intergenic