ID: 1143811730

View in Genome Browser
Species Human (GRCh38)
Location 17:9477146-9477168
Sequence GAGGAACCTGAAGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 961
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 869}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143811730_1143811737 10 Left 1143811730 17:9477146-9477168 CCGTGCCCAGCTTCAGGTTCCTC 0: 1
1: 0
2: 5
3: 86
4: 869
Right 1143811737 17:9477179-9477201 GATACCAGGCATATTGGATTAGG 0: 11
1: 40
2: 434
3: 1165
4: 2088
1143811730_1143811738 11 Left 1143811730 17:9477146-9477168 CCGTGCCCAGCTTCAGGTTCCTC 0: 1
1: 0
2: 5
3: 86
4: 869
Right 1143811738 17:9477180-9477202 ATACCAGGCATATTGGATTAGGG 0: 11
1: 44
2: 470
3: 1275
4: 2146
1143811730_1143811735 -4 Left 1143811730 17:9477146-9477168 CCGTGCCCAGCTTCAGGTTCCTC 0: 1
1: 0
2: 5
3: 86
4: 869
Right 1143811735 17:9477165-9477187 CCTCTGCTTAAAAGGATACCAGG 0: 1
1: 0
2: 3
3: 26
4: 297
1143811730_1143811740 24 Left 1143811730 17:9477146-9477168 CCGTGCCCAGCTTCAGGTTCCTC 0: 1
1: 0
2: 5
3: 86
4: 869
Right 1143811740 17:9477193-9477215 TGGATTAGGGCCCACCACAGTGG 0: 1
1: 2
2: 15
3: 97
4: 297
1143811730_1143811736 4 Left 1143811730 17:9477146-9477168 CCGTGCCCAGCTTCAGGTTCCTC 0: 1
1: 0
2: 5
3: 86
4: 869
Right 1143811736 17:9477173-9477195 TAAAAGGATACCAGGCATATTGG 0: 2
1: 12
2: 65
3: 560
4: 1655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143811730 Original CRISPR GAGGAACCTGAAGCTGGGCA CGG (reversed) Intronic
900223834 1:1523605-1523627 GGGGACCCTGGAGCTGGGCCGGG + Intronic
900324830 1:2103589-2103611 GAGAAGCGTGAGGCTGGGCACGG + Intronic
900343830 1:2201427-2201449 AAGGGACCTGAGGCTGGGCACGG + Intronic
900395960 1:2453359-2453381 GAGGACATTGAAGCTGGGGATGG + Intronic
900457483 1:2784365-2784387 GAGGAACATGAAAGTGGACAAGG + Intronic
900833226 1:4980058-4980080 GGGGAACATGACCCTGGGCAGGG + Intergenic
901476187 1:9491196-9491218 CAGGACCGAGAAGCTGGGCAAGG - Intergenic
901559427 1:10058537-10058559 GGGGCACTAGAAGCTGGGCATGG + Intronic
901944533 1:12691063-12691085 CAGGAAGCTGAAGTTGGTCAGGG + Intergenic
902066975 1:13696508-13696530 GAGGATACTGAAGCTAGGAAGGG - Intergenic
902303728 1:15521432-15521454 GAGGAACATGAAAGTGGGCAAGG - Intronic
902306158 1:15541037-15541059 AAGGAAACTGAAGCTGGGGGAGG - Intronic
902613185 1:17609071-17609093 AAGGAGCTTGAGGCTGGGCATGG - Intronic
902727385 1:18346307-18346329 GAGGAAACTGAGGCTTGGAAAGG - Intronic
902799421 1:18820034-18820056 GAGGAAACTGAGGCTGGGGGAGG - Intergenic
902816412 1:18919009-18919031 GAGGGACGTGAAGCTGGGTGTGG - Intronic
903038172 1:20508173-20508195 CCGGAACCGGAAGCGGGGCAAGG + Intergenic
903062739 1:20681563-20681585 GAGGACCCTGCAGATGGCCAAGG + Intronic
903070892 1:20726607-20726629 GACGAGCCTGCAGCAGGGCAGGG + Intronic
903180168 1:21601366-21601388 GAGGAACCCGAAGCAGGGTTGGG - Intronic
903235818 1:21950137-21950159 CAGGTCCCTGAGGCTGGGCACGG + Intergenic
903374240 1:22855903-22855925 GATGAAATTGAACCTGGGCATGG - Intronic
903586111 1:24416360-24416382 GAGGAACGGGAAGCTTGGCAGGG + Intronic
903626247 1:24732315-24732337 TAGGAAACTGAAGCTGGGCTGGG + Intergenic
903654983 1:24943502-24943524 GGGGAAACTGAGGCTCGGCAAGG + Intronic
903671475 1:25038220-25038242 GAGGAAACTGAGGCTTAGCAAGG + Intergenic
904188922 1:28728265-28728287 AAAGAACCTGCAGCTGGGCCAGG - Intergenic
904277255 1:29392558-29392580 GAGCAGCCTGAAGCTGGGCAGGG - Intergenic
904281014 1:29418256-29418278 GAGGAAGCTGAATCTGAGCCAGG - Intergenic
904402855 1:30268084-30268106 GAGGAAGAGGAAGCTGAGCAGGG + Intergenic
904417663 1:30373088-30373110 GAGGAAGGTGAAGCAGGGCCAGG - Intergenic
904534062 1:31187678-31187700 GAGGAAACTGAAGCTCAGAAAGG - Intronic
904740038 1:32667206-32667228 GAGGAACATGAAAGTGGACAAGG - Intronic
905164997 1:36075481-36075503 AAAGTACCTGAGGCTGGGCATGG + Intergenic
905765998 1:40601554-40601576 GAAACACCTGAGGCTGGGCACGG - Intergenic
906086461 1:43139294-43139316 GAGGAACATGAAAGTGGACAAGG - Intergenic
906648157 1:47491036-47491058 GAGGAAAATAAAGCTGGGAAGGG + Intergenic
906950281 1:50329486-50329508 GTCGCACCTGCAGCTGGGCATGG + Intergenic
907410979 1:54282974-54282996 TAGGAACCAGAGGCTGGGCGTGG + Intronic
907989780 1:59568510-59568532 GAGGAAACTGAAGCTTGGAGAGG + Intronic
908299628 1:62751278-62751300 GAGGAATCTGAAATTGGGCCAGG - Intergenic
908423486 1:63982138-63982160 GAAGAAACTGAAGCTTGGAAAGG + Intronic
908639369 1:66204810-66204832 GAGCGAGCTGAAGCAGGGCAAGG - Intronic
910503403 1:87921200-87921222 GAGGAAACTGAGGCTGAGAAAGG + Intergenic
910618875 1:89230755-89230777 GGGTAAGCTGAAGCAGGGCAGGG - Intergenic
910879032 1:91905910-91905932 CATGAGCCTGAAGCTGCGCATGG - Intronic
911536531 1:99106560-99106582 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
911612642 1:99973719-99973741 GATGAAGCTGAAACTGGGCCGGG + Intronic
911802278 1:102157404-102157426 GAAAAACCTCAGGCTGGGCATGG + Intergenic
912370024 1:109166598-109166620 GAGGAACTGGAAGCTCAGCAAGG + Intronic
912493040 1:110072565-110072587 GAGGAAACTGAGGCTCAGCAAGG - Intronic
913967130 1:143385650-143385672 GAGGAAACTGAGGCTGGGCGAGG + Intergenic
914061507 1:144211257-144211279 GAGGAAACTGAGGCTGGGCGAGG + Intergenic
914117643 1:144755112-144755134 GAGGAAACTGAGGCTGGGCGAGG - Intergenic
914885104 1:151578250-151578272 GAGGAAACTGAGGCTCGGAAAGG - Intronic
915333202 1:155126284-155126306 GAGGAGCCTGGAGCTGGGGAGGG - Intergenic
915444122 1:155965251-155965273 GAGGAACATGAAGAGGGGCTGGG - Intronic
915557487 1:156668648-156668670 GAGGAAGCTGGTGCTGGGGAGGG - Intergenic
916107731 1:161443128-161443150 GAGGGACCTGAGGCGGGGCGCGG - Intergenic
916109315 1:161450501-161450523 GAGGGACCTGAGGCGGGGCGCGG - Intergenic
916110902 1:161457932-161457954 GAGGGACCTGAGGCGGGGCGCGG - Intergenic
916112488 1:161465292-161465314 GAGGGACCTGAGGCGGGGCGCGG - Intergenic
916787606 1:168097846-168097868 GAGGAAACTAAAGCAGGGAAAGG + Intronic
917640248 1:176976629-176976651 AAGGAAACTGAAGCTTGGAAAGG - Intronic
919097826 1:193059123-193059145 GAGGAGGCCCAAGCTGGGCATGG - Intronic
919849711 1:201664410-201664432 GAGGAACCTGAAGCTCAGGGAGG - Intronic
920259112 1:204677117-204677139 GAGGAAACTGAGGCTCGGAAAGG + Intronic
920414250 1:205787945-205787967 GAGGAAACTGAAGCTCAGAAAGG + Intergenic
920513563 1:206567900-206567922 GAGGAAACTGAAGCACGGGAAGG + Intronic
921042712 1:211448903-211448925 GAGCCACCTAAAGCTGGGCATGG - Intergenic
921569912 1:216765434-216765456 GAGAAACCTGAGGCAGGGAAAGG + Intronic
922320375 1:224481624-224481646 GAGATACCTGGAGCTGGGGAAGG + Intronic
923044223 1:230343652-230343674 GTGGATTCAGAAGCTGGGCAGGG - Intronic
923085985 1:230703922-230703944 GAGGACCCTGAGGCAAGGCAAGG + Intronic
923361829 1:233219221-233219243 GAGGAAACTGAAGATGGCAAGGG + Intronic
923880419 1:238098070-238098092 GAGGCCCCAGAGGCTGGGCATGG - Intergenic
924148384 1:241101203-241101225 AAAGAACATGATGCTGGGCACGG + Intronic
1063353013 10:5373806-5373828 GAGGCAGCTGAAGATGGGCTTGG - Exonic
1063548826 10:7008726-7008748 GAGAAACATGAAGCATGGCAGGG + Intergenic
1064612602 10:17118725-17118747 AAGGTACATGAGGCTGGGCACGG - Intronic
1065635854 10:27733038-27733060 AATGAAAATGAAGCTGGGCAAGG - Intronic
1066041907 10:31556975-31556997 GAAGAATCTGAGGCTGGGCCTGG - Intergenic
1066439392 10:35423944-35423966 GAGGAAACTGAGGCTGGGGTTGG + Intronic
1066602701 10:37125369-37125391 CCGGACCCTGATGCTGGGCACGG - Intergenic
1067037338 10:42930378-42930400 GAGGATCCAGAGGCTGGGGATGG + Intergenic
1067325865 10:45265944-45265966 GAATAAGCTGAAGCAGGGCAGGG + Intergenic
1067384255 10:45804246-45804268 GAGGAAACTGAGGCTGAGAAAGG - Intergenic
1068051947 10:51961348-51961370 GAGGAACCTGCAGATGTGGAGGG + Intronic
1068648839 10:59499394-59499416 GAGAAAGCTGAGGCTGGGAATGG - Intergenic
1069395082 10:67978747-67978769 GAGGCACCTGGAGCTGGGGGTGG - Intronic
1069595759 10:69669041-69669063 GAGGAAACTGAGGCTGGGGATGG + Intergenic
1069853251 10:71424168-71424190 GAGGAAACTGAGGCTAAGCAGGG + Intronic
1069862017 10:71477457-71477479 GAGGAGCCTGGGGCTGGGCGCGG - Intronic
1069915921 10:71786786-71786808 GAGGGAGTAGAAGCTGGGCATGG - Intronic
1069985313 10:72278967-72278989 GAGGAAACTGAAGCTTAGGAAGG - Intergenic
1070070846 10:73087780-73087802 AAGGAACTCAAAGCTGGGCATGG - Intronic
1070406086 10:76097299-76097321 AAGCAACATGAAGCCGGGCACGG - Intronic
1070813887 10:79311622-79311644 GAGCAAGCAGAAGCAGGGCATGG - Intronic
1071046591 10:81386944-81386966 GAGCAACCTGGAGCTGGGGGTGG + Intergenic
1071569734 10:86690391-86690413 GAGGAGCCTGCAGCTGCCCAGGG - Intronic
1072089392 10:92112433-92112455 GAGGAACCTGGGGCCGGGCGTGG - Intronic
1072212331 10:93257897-93257919 AAGAAACCTGAGGCTGGGCACGG + Intergenic
1072440997 10:95455123-95455145 GAGGAAACTGAGGCTTAGCAAGG - Intronic
1072499104 10:95994421-95994443 GAGGAACATGAAAGTGGACAAGG + Intronic
1072563834 10:96601181-96601203 AAGGAAATTGAGGCTGGGCATGG + Intronic
1072819012 10:98537861-98537883 GAGGAACATGAAAGTGGACAAGG - Intronic
1072855025 10:98937260-98937282 GCGCAAGCTGAAGCAGGGCAAGG + Intronic
1072878597 10:99202510-99202532 GAGGAAACTGAAGTTCAGCAGGG - Intronic
1073324343 10:102633870-102633892 GAGGAGCTGGAAGCCGGGCAAGG - Intergenic
1073867111 10:107817839-107817861 GAGGAAACTGAGGCTGAGCAAGG - Intergenic
1074034809 10:109727793-109727815 GAGGAAACTGAAGCTCAGGATGG - Intergenic
1074114367 10:110444400-110444422 GAGGAAACTGAGGCTCAGCAAGG + Intergenic
1074735878 10:116432004-116432026 GAGGAACCTAAAGCAGGGAAGGG - Intronic
1075131157 10:119741061-119741083 GAGGAAACTGAAGCTGAGAGGGG + Intronic
1075233485 10:120704865-120704887 AAGGAGCCTGAAGCTCAGCATGG - Intergenic
1075247711 10:120838651-120838673 GAGGAAATTGAAGCTCAGCAAGG + Intergenic
1075425941 10:122341763-122341785 AAGGAAGCTGAGGCCGGGCATGG + Intergenic
1075634616 10:124022087-124022109 GAGGAGCCTGAAGTGGGTCAAGG - Intronic
1075692462 10:124407242-124407264 GAGGTTCCTGAGGCTAGGCAGGG - Intronic
1075704234 10:124489887-124489909 GAGAAAGCTGAGGCTGGGAATGG - Intronic
1075923083 10:126229188-126229210 GAGGAACCAGGAGGTGGGCAGGG + Intronic
1076443833 10:130498382-130498404 GAGGAAACTGAGGCAGGTCAAGG - Intergenic
1076717899 10:132375775-132375797 GAGGGCCCCGTAGCTGGGCAGGG - Exonic
1077070169 11:666430-666452 GCAGATCCTGAGGCTGGGCACGG + Intronic
1077535772 11:3123201-3123223 GGGGAACCTGAGGCAGGGTAGGG + Intronic
1077571220 11:3339927-3339949 GAGGAACCTGAAGAAGGGGAAGG - Intronic
1078170986 11:8929050-8929072 GAGAAGCCAGAAGCAGGGCATGG + Intronic
1078850621 11:15159723-15159745 GAGGAAACTGAAGCTTAGCAAGG - Intronic
1079034186 11:17008205-17008227 GAGAAACCTGAAGCTAGAAAGGG + Intronic
1079058186 11:17225506-17225528 GACCAGCCTGAGGCTGGGCATGG - Intronic
1079133874 11:17765078-17765100 GAGGATTCTGAGGCAGGGCAGGG - Intronic
1079967528 11:26996749-26996771 GGGGAAACTGAGGCTGGGAAAGG + Intergenic
1080070908 11:28085402-28085424 GAGGAACATGAAAGTGGACAAGG - Intronic
1080130305 11:28786556-28786578 GAAGAAATTGAGGCTGGGCATGG - Intergenic
1080346897 11:31335372-31335394 GGGGAAGCTGAAGCAGGGCGGGG - Intronic
1080394112 11:31874218-31874240 GAGGAAACTGAAGCTCAGAATGG + Intronic
1080657891 11:34272092-34272114 GAGGAAACTGAGGGTTGGCAAGG - Intronic
1080776650 11:35393045-35393067 GAGGAACCTGAAGCTCTGAGAGG + Intronic
1080820019 11:35796706-35796728 GAGGAAAGGGAAGCTGGGGAAGG + Intronic
1081112164 11:39149510-39149532 GAGCAACATAAAGCTGGGGATGG - Intergenic
1081308683 11:41544870-41544892 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1081665675 11:44915792-44915814 GAGGAAGCTGAAGCTGGAGAAGG - Intronic
1082040515 11:47681037-47681059 AAGGAAAATGAGGCTGGGCATGG + Intronic
1082813153 11:57491063-57491085 GAGGAAACTGAGGCTAGGAAGGG - Intronic
1082945078 11:58749783-58749805 GGGCAAACTGAAGCTGGGGAGGG + Intergenic
1083341558 11:61961720-61961742 GAAGAATCTGAACTTGGGCAAGG + Intronic
1083443232 11:62690509-62690531 CAGGAGCCTGAACCTGGGCCAGG + Exonic
1083475832 11:62914826-62914848 GAGGCCCCTGCAGCAGGGCAGGG - Intronic
1083855656 11:65391913-65391935 AGGGAAACTGAAGCTGGGGAAGG - Intronic
1084199825 11:67548982-67549004 GTGGAAACTCCAGCTGGGCACGG + Intergenic
1084405127 11:68967647-68967669 GAGCCACCAGAAGCTGGGAAAGG - Intergenic
1084934294 11:72578836-72578858 GGGGCACCCAAAGCTGGGCAGGG + Intronic
1085264906 11:75231479-75231501 GCGGCAGCTGAAGCTAGGCAGGG + Intergenic
1085319905 11:75567681-75567703 GAGGAAACTGAGGCTCAGCAAGG + Intronic
1085397057 11:76211738-76211760 GAGGTACCTGTAGCTGGGTGTGG - Intergenic
1085519130 11:77127989-77128011 GAGGCACCTGAAGCTAGCCTGGG + Intergenic
1085785191 11:79441937-79441959 GAGAAAACTGAAGCCGGGTAAGG - Intergenic
1086398517 11:86441720-86441742 GAGGAAACTGAGGCTCAGCAAGG - Intronic
1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG + Intergenic
1087482448 11:98718447-98718469 GGGCAAGCTGAAGCAGGGCAGGG - Intergenic
1087783894 11:102332445-102332467 GATGAACCAGAAGCTAGGCAGGG - Intronic
1088373474 11:109116231-109116253 GAGGAAACTGGAGCTTAGCAAGG + Intergenic
1088606037 11:111533293-111533315 GAGGAAACTGAAGCTTAGTAAGG - Intronic
1088890031 11:114036970-114036992 GAAGAACCTGGAGCTGATCAGGG - Intergenic
1088938107 11:114425318-114425340 GAGCCACCTGGAGCTGGGAATGG + Intronic
1088976847 11:114823360-114823382 GAGGAAGGTGAAGCTGGCCGGGG - Intergenic
1089527454 11:119106863-119106885 GCAGAACCTGAAGCTGGGAGAGG - Intronic
1089542172 11:119195883-119195905 GAGGAGCCTGAGGCGGGGCCTGG + Intronic
1089599207 11:119603153-119603175 GATGAACGTGAAGCTGGCCCTGG - Intergenic
1090185357 11:124735851-124735873 GAGGAAACTGAGGCTGGGAGAGG - Intergenic
1090805336 11:130198786-130198808 GGAGAACCTGTAGCAGGGCAGGG + Intronic
1091462196 12:652438-652460 AAGGAAAATGAAGCTGGGCATGG + Intronic
1091931664 12:4401438-4401460 GAGCAAACGGAAGGTGGGCATGG - Intergenic
1091964566 12:4727125-4727147 GAGGAAACTGAAGCTGAGAAGGG + Intronic
1093092636 12:14938476-14938498 GAGGAACATGAACCTGGACGGGG + Exonic
1093259400 12:16917253-16917275 GAGTTGCCTGAAGCTGGGAAAGG + Intergenic
1093763310 12:22934940-22934962 GAGGAAACTGAGGCGTGGCAAGG - Intergenic
1093974615 12:25407486-25407508 GACTGACCTGCAGCTGGGCATGG - Intergenic
1094050306 12:26213184-26213206 GAGAAACATGCAGCTGGGCATGG + Intronic
1094486636 12:30930546-30930568 GAGGAAATTGAAGCTTAGCAAGG - Intronic
1094639341 12:32258839-32258861 GAGGAACATGAAAGTGGACAAGG + Intronic
1095511687 12:42957822-42957844 AAGGAACCTAAATCTGGGTAAGG - Intergenic
1095982433 12:47981048-47981070 GGGGAACAGGAGGCTGGGCAGGG - Intronic
1095996152 12:48086745-48086767 AAGGAGGCTGAGGCTGGGCATGG + Intronic
1096235913 12:49926245-49926267 AAGGAACCTTAAGCTAGGGAAGG + Intergenic
1096386137 12:51196635-51196657 GCCGATGCTGAAGCTGGGCAGGG - Intronic
1096480048 12:51934090-51934112 GAAGAACCTGAGGCCGGGCGTGG - Intergenic
1096493317 12:52024849-52024871 GAGGAAACTGAGGCTGAGGAAGG - Intronic
1096499045 12:52054474-52054496 GAAGGTGCTGAAGCTGGGCAGGG - Exonic
1096586814 12:52628282-52628304 GAGCAACCTGAGGGTGGGCTGGG - Intergenic
1096600193 12:52723597-52723619 GAGGAAACTGAGGCCTGGCAAGG - Intergenic
1096684740 12:53280656-53280678 GAGTAAGCAGTAGCTGGGCACGG - Intronic
1096721859 12:53528947-53528969 AAGGAAGCTGGGGCTGGGCATGG + Intronic
1096797399 12:54086360-54086382 GAGGTACCTGAAGGAGGGCGTGG - Intergenic
1096994846 12:55832062-55832084 GGGAAACCTGCAGCGGGGCACGG - Intergenic
1097243028 12:57589299-57589321 GAGGAACATGAAAGTGGACAAGG + Intergenic
1098294569 12:68991207-68991229 GCGGAAGCCGAAGCAGGGCAAGG + Intergenic
1098625431 12:72660265-72660287 GAGGAACGTGAAAGTGGACAAGG + Intronic
1100552599 12:95659772-95659794 GAGGAAACTGAGGCTCAGCAAGG + Intronic
1101011623 12:100456776-100456798 AAGGAAGCTGAAGCTGGCTACGG - Intergenic
1101159273 12:101956738-101956760 TAGGAATCTGAAGCTGAGCAAGG + Intronic
1101173331 12:102122000-102122022 GAGGAAGCTGAGGCAGGGAAAGG + Intronic
1101313030 12:103601116-103601138 GAGGAAACTGAAGCCTAGCAAGG - Intronic
1101349170 12:103912283-103912305 GAGGATCCACAAGCTGGCCAAGG + Intergenic
1101420106 12:104543836-104543858 GATGTATCTGAAGCAGGGCATGG + Intronic
1101575164 12:105990527-105990549 GAGGAACATGAAGGTGGATATGG - Intergenic
1101719431 12:107338410-107338432 GAGGAAGCTGAGGGTGGGAAGGG + Intronic
1101818038 12:108160919-108160941 GAGGAAACTGAAGCTCAGGAAGG - Intronic
1102045395 12:109826785-109826807 GAGGAAACTGAAGCTCGGAGAGG - Intronic
1102589410 12:113946221-113946243 GAGAAAACTGAAGCTCGGTAAGG + Intronic
1103072375 12:117955433-117955455 AAGGAAACTGAGGCTTGGCAAGG + Intronic
1103398079 12:120623222-120623244 GAGAAAAATGAAGCTGGGAAAGG - Intergenic
1103482153 12:121257669-121257691 GATGAAACTGAAGATGGGGAAGG - Intronic
1103841926 12:123872058-123872080 GAGGGACCTGCACCAGGGCATGG + Intronic
1104370280 12:128218302-128218324 GAGCCAAATGAAGCTGGGCATGG + Intergenic
1104795828 12:131516835-131516857 GAGGAACATGAAAGTGGACAAGG + Intergenic
1105211077 13:18257480-18257502 GGGGAAACTGAGGCTGGACATGG + Intergenic
1105934810 13:25089108-25089130 AAGAAACCTGAAGCTTGGCCAGG + Intergenic
1106482818 13:30149514-30149536 GAGCATCCTGCAGCAGGGCATGG + Intergenic
1106830532 13:33576522-33576544 GAGAAGCGTTAAGCTGGGCATGG - Intergenic
1107363251 13:39642387-39642409 GGGGCACCAGAGGCTGGGCATGG - Intergenic
1107749852 13:43553133-43553155 GAGGCACCAGAAGTTGGGAATGG + Intronic
1107780617 13:43898457-43898479 GAACTACCTGAGGCTGGGCACGG + Intergenic
1108186994 13:47897841-47897863 GGGGAACCTGAAGCTCACCAAGG + Intergenic
1108219147 13:48215719-48215741 GACATACCTGAGGCTGGGCATGG - Intergenic
1108796988 13:54043987-54044009 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1109091490 13:58052077-58052099 GAGGATGCTGAGGCTGTGCAGGG - Intergenic
1110416258 13:75256429-75256451 GAGGAAACTGAAGCTTAGAAAGG - Intergenic
1111215258 13:85133025-85133047 GAGGAACATGAAAGTGGACAAGG + Intergenic
1111932585 13:94526794-94526816 GGGGGAGCTGAAGCAGGGCAGGG + Intergenic
1112028963 13:95439622-95439644 GAGGCCCCAGAGGCTGGGCATGG - Intronic
1112430945 13:99349765-99349787 GAGGAACATGAAAGTGGACAAGG + Intronic
1112554777 13:100456787-100456809 GAGGAACATGAAAGTGGACAAGG + Intronic
1113129441 13:107019330-107019352 GAGGAACCTGAGGTTGAGAAAGG + Intergenic
1113191213 13:107748860-107748882 GAGGAAGCTAAAGCTGGAAAAGG + Intronic
1113255549 13:108500890-108500912 GAGGAGGCTGGAGCTGGGCAGGG - Intergenic
1113518644 13:110922209-110922231 GAGGAAACTAAGGCAGGGCAGGG - Intergenic
1113566742 13:111323845-111323867 GAGGAGGAGGAAGCTGGGCAGGG - Intronic
1113581096 13:111429618-111429640 GAGGAACATCAGGCTGGGAAGGG - Intergenic
1113720713 13:112553738-112553760 GAGGCAGCAGCAGCTGGGCAGGG + Intronic
1114072549 14:19126367-19126389 GAGGCACCTAAAGCTGGGGCTGG + Intergenic
1114451614 14:22830135-22830157 GGGGGACCAGAAGCTGGGCTAGG + Intronic
1115644667 14:35360353-35360375 GAACTACCTGAGGCTGGGCATGG - Intergenic
1116284125 14:42950184-42950206 GAGAAATCTCCAGCTGGGCATGG + Intergenic
1116422245 14:44745711-44745733 GAGCCACCTGAAGCTGGAAATGG - Intergenic
1116561451 14:46384681-46384703 GAGGAACGTGAAAGTGGACAAGG + Intergenic
1117204140 14:53423946-53423968 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1117736488 14:58773646-58773668 GAGAAAACTGCAGCTGGGCTAGG + Intergenic
1118373682 14:65158634-65158656 GAAGCACATGAGGCTGGGCATGG + Intergenic
1118614719 14:67567558-67567580 GAGGGCCCTGCAGCAGGGCAGGG - Intronic
1118748454 14:68790361-68790383 GTGGAACTTGGAGCTGGGCAGGG + Exonic
1118895761 14:69944026-69944048 GAGAAAACCGAGGCTGGGCAAGG - Intronic
1119315872 14:73694113-73694135 AAGGAACTTTAAGCTGGGCACGG + Intronic
1119460066 14:74794337-74794359 TAGAAAACTTAAGCTGGGCATGG - Intronic
1119770120 14:77215303-77215325 GAGAAACCTGAAGCAAGGCTGGG + Intronic
1119991069 14:79198066-79198088 GTGGAACCTGAAGATGGGACTGG - Intronic
1120282523 14:82457189-82457211 TAAGAACCCTAAGCTGGGCACGG - Intergenic
1121032330 14:90669406-90669428 CAAGAAAGTGAAGCTGGGCATGG + Intronic
1121514051 14:94537305-94537327 GAGCAACCTGAGGCTAGGCTGGG + Intergenic
1121579387 14:95015614-95015636 GAGGAACATGAAGCTCAGCAGGG - Intergenic
1121962837 14:98276999-98277021 GAGGAAACCGAGGCTGTGCAGGG + Intergenic
1122028106 14:98892349-98892371 GTGGGACCTGAAGCCTGGCAGGG - Intergenic
1122094376 14:99360697-99360719 GAGGCAGCTGAGGCTGGGCGAGG - Intergenic
1122156770 14:99754741-99754763 GAGGAAACTGAGGCTTGGCGAGG - Intronic
1122325332 14:100878244-100878266 GAGGAAACTGAGGCTGGGAGAGG + Intergenic
1122437753 14:101711324-101711346 GAGCTACATGAAGCTGGGAAGGG - Intergenic
1122550719 14:102547934-102547956 AAGGAAGCTGCTGCTGGGCATGG - Intergenic
1122640901 14:103158671-103158693 GAAAAACCTGAGGCTGGGCGTGG - Intergenic
1122837543 14:104437470-104437492 GAGGAACCTGAAGCCAGTGAAGG - Intergenic
1123065667 14:105618092-105618114 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123069833 14:105637337-105637359 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123089067 14:105734125-105734147 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123094851 14:105762282-105762304 GAGGGTCCTGGGGCTGGGCATGG + Intergenic
1123165691 14:106323230-106323252 GGGGAAGCAGAAGGTGGGCAGGG + Intergenic
1123777444 15:23594240-23594262 GAGGAACATGAAAGTGGACAAGG - Intronic
1123913573 15:24996984-24997006 GTGGAACCAGTGGCTGGGCATGG + Intergenic
1124081265 15:26500674-26500696 GAGCCACCTGGAGCTGGGAATGG + Intergenic
1124170508 15:27368393-27368415 GAGGAATATGGAACTGGGCATGG + Intronic
1124848336 15:33312016-33312038 GAGGAAACTGAGGCTGAGTAGGG - Intronic
1125044375 15:35229912-35229934 GAGCCACCTGGAGCTGGGGATGG + Intronic
1125837329 15:42764279-42764301 GGGCAAGCTGAAGCAGGGCAGGG + Intronic
1127450053 15:59107841-59107863 TATGACCTTGAAGCTGGGCATGG + Intronic
1127577184 15:60303292-60303314 AAGGATGCTGAAGTTGGGCATGG - Intergenic
1128130702 15:65225338-65225360 GAGGAACCGGAAGCTGGATGTGG + Intergenic
1128554728 15:68623617-68623639 AAGGAACCTGAAGCTGCCCTTGG - Intronic
1128729955 15:70014380-70014402 GAGGAGCCTGAAGCTCGGAGGGG + Intergenic
1128864955 15:71107866-71107888 GAGGAAACTGAGGCTCAGCAGGG + Intronic
1129016435 15:72473584-72473606 GAGGAACCTGAAGCTCAGAAAGG - Intergenic
1129297192 15:74606121-74606143 GAGGAGCTTGAGGCTGGGGATGG + Intronic
1129303884 15:74644227-74644249 TAGGAACCAGAAGGTGGCCAAGG - Intronic
1129434438 15:75526954-75526976 GTGAGAGCTGAAGCTGGGCAAGG - Intronic
1129468088 15:75735139-75735161 GAGGAACATGAAAGTGGACAAGG - Intergenic
1129509372 15:76109355-76109377 GAGGAACCTGGTGTTGGGCCTGG - Intronic
1129658809 15:77541826-77541848 GAGGAACCAGATGCTGAGGAGGG - Intergenic
1129696923 15:77745937-77745959 TAAGAACCAGGAGCTGGGCACGG + Intronic
1129843678 15:78758565-78758587 TAGGAACCTGTAGCTGGGGCTGG + Intergenic
1129865273 15:78902699-78902721 GAGGAACATGAAAGTGGACAAGG + Intergenic
1130011474 15:80155948-80155970 GAGGAACATGAAAGTGGACAAGG + Intronic
1130091558 15:80825325-80825347 GAGGAAACTGAGGCTCAGCAAGG + Intronic
1130627792 15:85533822-85533844 CAGGCACCTGAAGCTGCCCACGG + Exonic
1130697709 15:86147286-86147308 GGGCAAGCTGAAGCAGGGCAGGG + Intronic
1130913014 15:88283930-88283952 AAGGCAGGTGAAGCTGGGCAGGG - Intergenic
1131024654 15:89129718-89129740 GAGGAAATAGAAGCTCGGCAAGG - Intronic
1131103100 15:89709293-89709315 TTGGATCCTGAGGCTGGGCAGGG + Intronic
1131261258 15:90889256-90889278 GGGGAGCCTCAGGCTGGGCAAGG - Intronic
1131538321 15:93255535-93255557 GAGGAAACTGAGGCTTGGAAAGG + Intergenic
1131854546 15:96579487-96579509 GAACAAACTGAGGCTGGGCACGG - Intergenic
1131951438 15:97685821-97685843 GTGGAATCTGAATCTGGGGATGG - Intergenic
1132380208 15:101360863-101360885 GAGAAAAATGAAGCAGGGCAGGG - Intronic
1132410954 15:101577991-101578013 GAAGGACCTGAAGAGGGGCAGGG - Intergenic
1132436514 15:101809076-101809098 GGGGAACCTGAAACTTGGTAAGG - Intronic
1132983260 16:2750109-2750131 GAGGAGCCAGAAGCTGGGAGAGG - Intergenic
1133030560 16:3008839-3008861 GAGGAGCCTGAAGCCGCACAGGG + Intergenic
1133049727 16:3110602-3110624 GTGGACCCTGAAGGTGGGGAAGG + Intergenic
1133055743 16:3144663-3144685 CAGGATCCAGGAGCTGGGCAGGG + Intronic
1133457985 16:5959908-5959930 GAGGAACCCTAGGCTGGGCGCGG + Intergenic
1133788044 16:8988183-8988205 GGTGAAAATGAAGCTGGGCACGG - Intergenic
1133934694 16:10259187-10259209 GAGGAACATGAAAGTGGACAGGG - Intergenic
1134070537 16:11256947-11256969 GAAGAAACTGAGGCTGGGGAGGG + Intronic
1134209735 16:12266213-12266235 AAACAACCTGAAGCTGGACACGG - Intronic
1134406917 16:13969168-13969190 GAGCTACCTGAAGCTGGGAGAGG + Intergenic
1135251927 16:20907650-20907672 GATGAACATGAGGCAGGGCATGG - Intronic
1135259923 16:20971941-20971963 GAAGAAACTGAAGCTAGGAAAGG + Intronic
1135633459 16:24054421-24054443 GAGGCAACTGAAGCTCGGAAAGG + Intronic
1135738292 16:24951293-24951315 GAGGAAACTGAGGCTTGGGAGGG - Intronic
1135879659 16:26241445-26241467 GAGCCACCTAAAGCTGGGGATGG - Intergenic
1135961483 16:26998099-26998121 GAGGAAACTGAAGCTTAGCATGG - Intergenic
1136284310 16:29232278-29232300 AAGGAAACTGAGGCTGGGAAGGG + Intergenic
1136504942 16:30697262-30697284 GAGGAAACTGAAGCTCAGAAAGG + Intergenic
1136711791 16:32243464-32243486 GAGGAACGTGAAAGTGGACAAGG - Intergenic
1136756125 16:32685943-32685965 GAGGAACATGAAAGTGGACAAGG + Intergenic
1136811988 16:33184430-33184452 GAGGAACGTGAAAGTGGACAAGG - Intergenic
1136818464 16:33294510-33294532 GAGGAACGTGAAAGTGGACAAGG - Intronic
1136825028 16:33351043-33351065 GAGGAACGTGAAAGTGGACAAGG - Intergenic
1136830094 16:33449814-33449836 GAGGAACGTGAAAGTGGACAAGG - Intergenic
1137239938 16:46647707-46647729 GAAGAAACTGAAGCTGGGTGCGG + Intergenic
1137900968 16:52268543-52268565 GTGGAACCTAAAGATGGGAATGG + Intergenic
1137949739 16:52772258-52772280 GAGGAAACTGAAGCTAGGAGAGG - Intergenic
1138080285 16:54084200-54084222 GAGGAAACTGAAGCTCAGAAGGG - Intronic
1138383405 16:56619091-56619113 GAGGAAACTGAAATTGGGCAGGG - Intergenic
1138534141 16:57650996-57651018 GAGGAAACTGAGGCCGGGCGCGG - Intronic
1138977471 16:62225251-62225273 GAGTTACCAGAAGCTGGGAAGGG + Intergenic
1139531175 16:67543406-67543428 GAGGAAGCTGAAGCTCTCCAAGG - Exonic
1139802578 16:69535591-69535613 GAGGAAGGTGATGCTGGCCATGG - Intergenic
1140289770 16:73642322-73642344 CAGGAGCCTGAAGGTGGGAAGGG - Intergenic
1140321068 16:73952099-73952121 GAGGGCACTGAGGCTGGGCATGG + Intergenic
1140521268 16:75584154-75584176 AAGTAAAATGAAGCTGGGCATGG - Intergenic
1141003462 16:80330135-80330157 GCAGAACCTGAGGCCGGGCACGG - Intergenic
1141492626 16:84384757-84384779 GAAATACCTGAAGCCGGGCATGG + Intronic
1141553485 16:84821481-84821503 GAGGAAACTGAGGCTCAGCAAGG + Intronic
1141633916 16:85303764-85303786 GAGGAAACTGAGGCAGGGCCAGG - Intergenic
1141647779 16:85376708-85376730 GAGGCACCTGTGGCTTGGCAGGG - Intergenic
1142344000 16:89542340-89542362 GAGGAACAAGAGGCTGGGGAGGG - Intronic
1142393726 16:89819148-89819170 GAGGAACATGAAAGTGGACAAGG - Intronic
1202990566 16_KI270728v1_random:7400-7422 GAGGAACGTGAAAGTGGACAAGG - Intergenic
1203058263 16_KI270728v1_random:946295-946317 GAGGAACGTGAAAGTGGACAAGG + Intergenic
1142624223 17:1181568-1181590 CAGGCACCTGGAGCTTGGCAGGG + Intronic
1142658990 17:1414601-1414623 GAGGAAGATGAGGCTGGGAAGGG + Intergenic
1142863533 17:2777328-2777350 GAGGACCCTGGAGCTAGGCTGGG + Intronic
1143452959 17:7047182-7047204 GAGGAACATGAAAGTGGACAAGG + Intergenic
1143454027 17:7054209-7054231 GAGGTAGCTAAAGCTGGGTATGG - Intergenic
1143465668 17:7134533-7134555 GAGGAAAATAAGGCTGGGCACGG + Intergenic
1143499970 17:7332993-7333015 GAGGAACATGAAAGTGGACAAGG + Intergenic
1143811730 17:9477146-9477168 GAGGAACCTGAAGCTGGGCACGG - Intronic
1144036407 17:11370014-11370036 GAGGAAACTGGAGCTAGGGAAGG - Intronic
1144129626 17:12233675-12233697 GAGGAAGCTGAAGCTGAGAGAGG + Intergenic
1144601186 17:16615385-16615407 GCTGAAACTGAGGCTGGGCACGG - Intergenic
1144722759 17:17483646-17483668 GAGGAAAGGGAGGCTGGGCACGG + Intronic
1145058790 17:19719577-19719599 GAGCTACCTGAAGTGGGGCAGGG + Intergenic
1145109152 17:20146614-20146636 TAAGAAACTGACGCTGGGCATGG + Intronic
1146157490 17:30536135-30536157 GAGGAAAATGAACCTGGGAAGGG - Intergenic
1146521786 17:33531282-33531304 GGGGTACATAAAGCTGGGCAGGG + Intronic
1147047375 17:37763425-37763447 AAGGAAACTGAGGCTGGGCATGG - Intergenic
1147266936 17:39240114-39240136 GGTGAGCCTGAAGCTGGGCCTGG + Intergenic
1147383573 17:40069617-40069639 GAGCACCCCCAAGCTGGGCACGG - Intronic
1147725407 17:42563650-42563672 GAGGAAACTCAAGCATGGCATGG + Intronic
1147752313 17:42744069-42744091 TAGGAACCTGACGCTTGGCAGGG - Intronic
1147793475 17:43027167-43027189 GAGGAACCTGAAGGAAGACAGGG - Exonic
1147836383 17:43335107-43335129 GAGGAACATGAAAGTGGACAAGG + Intergenic
1147890811 17:43715421-43715443 GAAGAACATGGGGCTGGGCATGG - Intergenic
1147920224 17:43911784-43911806 GAGGAAATTGAGGCTTGGCAAGG - Intergenic
1147991656 17:44337606-44337628 GAGGAACATGAAAGTGGACAAGG + Intergenic
1148071116 17:44909229-44909251 GAGGAAACTGAGGCTGGGAGAGG - Intronic
1148354570 17:46967296-46967318 GAGGAAACTGAAGCCCAGCAAGG - Intronic
1148450974 17:47777722-47777744 GAGGAACCTGAACCTCAGCGGGG - Intergenic
1148841243 17:50498681-50498703 GAGGAAACTGAGGCAGAGCAGGG - Intergenic
1148871354 17:50660440-50660462 GAGGAGCCTGGGGCTGGGCATGG + Intronic
1148911922 17:50947400-50947422 GAGGAAACTGAGGCTGGGAGAGG + Intergenic
1149206758 17:54256741-54256763 GAGGAAGCTCAAGCTAGCCATGG - Intergenic
1149494488 17:57108706-57108728 GAGGAAGTTGAAGCTGAGAAGGG + Intronic
1150183147 17:63148399-63148421 GAGGAAACTGAGGCTTGGTAAGG + Intronic
1150230283 17:63545924-63545946 GAGGGGACTGAAGGTGGGCAAGG + Exonic
1150870804 17:68909191-68909213 GAGGAACTTGAAGCTTGAAAGGG + Intronic
1151154384 17:72114668-72114690 GACGAACACGAGGCTGGGCAGGG - Intergenic
1151178043 17:72305241-72305263 GAGGAACCCGAGGCTTGGGAAGG - Intergenic
1151510967 17:74559747-74559769 AATGTACCTGAGGCTGGGCATGG - Intergenic
1151675691 17:75596268-75596290 GAGGGACCTGTGGCTGGGCAGGG + Intergenic
1151901654 17:77019986-77020008 GAGGCCCCAGAGGCTGGGCATGG - Intergenic
1152344438 17:79742688-79742710 GAGGAAACTGAGGCTGGGGAGGG - Intergenic
1152794085 17:82298435-82298457 GAGGAGCTTGGAGCTGGGCGAGG - Intergenic
1153739261 18:8106015-8106037 GAGGTACCTGAGGGTGGGCCGGG - Intronic
1153955272 18:10090833-10090855 GAAGTCCATGAAGCTGGGCAGGG + Intergenic
1155096832 18:22564344-22564366 GAAGAAACTGAGGCTTGGCAAGG + Intergenic
1155235201 18:23811639-23811661 GAGGAACCCGAGGTTGGGCATGG + Intronic
1156206771 18:34894937-34894959 GCGCAAGCTGAAGCAGGGCAAGG + Intergenic
1157193713 18:45602399-45602421 AAGGAATTTGAAGCAGGGCAAGG + Intronic
1157409472 18:47451727-47451749 GAGGAAACTGAGGCTTGGCAAGG - Intergenic
1157494827 18:48149263-48149285 GAAGGACCAGAAGCTGGGCTGGG + Intronic
1157535566 18:48454853-48454875 GAGGAAACTGAAACTTAGCAAGG + Intergenic
1158649583 18:59273533-59273555 GAGGACCCTGTGGCTGGGCCGGG - Intronic
1160295957 18:77637263-77637285 GGGTAAGCTGAAGCAGGGCAGGG + Intergenic
1160511630 18:79456391-79456413 AAGGAACCTGAAGGTGAGCCCGG - Intronic
1160747732 19:719805-719827 GGGGAAACTGAGGCCGGGCAGGG - Intronic
1160898562 19:1415100-1415122 GAGAAACCTGAAACAGGGCCGGG - Intronic
1161226360 19:3148376-3148398 CATGAACCTCAGGCTGGGCACGG - Intronic
1161258191 19:3321325-3321347 GGGGAAACTGAGGCTTGGCAAGG + Intergenic
1161312928 19:3604660-3604682 GGGGAAACTGAGGCTCGGCAAGG - Intronic
1161498078 19:4598217-4598239 GAGGAAGCTGAGGTTGGGGAGGG + Intergenic
1161835793 19:6645449-6645471 GAGGAAAATGAGGCAGGGCAAGG - Intergenic
1161898322 19:7099253-7099275 AAGGAAGCCGAAGCTGGGCGGGG + Intergenic
1162031607 19:7919932-7919954 GAGGAAACTGAGGCTCGGCAAGG + Intergenic
1162529902 19:11229726-11229748 GAAGAACGTGAGGCTGGGCGGGG + Intronic
1162535907 19:11262618-11262640 GGGGAAACTGAGGCTGGGGACGG + Intergenic
1162737182 19:12753195-12753217 GAGAGATCTGAAGCTGGGGATGG + Intronic
1162936955 19:13986200-13986222 CAGGAAGCTCAAGGTGGGCAGGG + Intronic
1163235919 19:16030525-16030547 GAGGAACATGAAAGTGGACAAGG + Intergenic
1163361145 19:16847129-16847151 GAGGCCCCCGAGGCTGGGCAGGG - Intronic
1163420136 19:17209751-17209773 GCGGAGCCTGGTGCTGGGCAGGG + Intronic
1163441645 19:17324958-17324980 GAGGAACTTGAAGCTGAGGAAGG + Exonic
1163638501 19:18449005-18449027 GAGGCACCAGAAGCTGAGCCTGG - Intronic
1163697672 19:18772181-18772203 GAGGAACCTGAACCTTGGAGTGG - Intronic
1163834576 19:19565341-19565363 CTGGAACCTGAACCTGGGAAGGG + Intronic
1164632264 19:29769392-29769414 GAGGAAACTGAGGCTGGAGAGGG - Intergenic
1165073960 19:33270499-33270521 GAGGAGCCAGATGGTGGGCAGGG - Intergenic
1165077278 19:33286873-33286895 GAGGCCCCAGAAGCTGGCCATGG + Intergenic
1165160673 19:33813839-33813861 GAGAAAACTGGAGCTGGGGATGG - Exonic
1165300107 19:34963454-34963476 TAGGATCCTGAATCAGGGCAGGG - Intronic
1165449039 19:35871765-35871787 CAGGAACCTTGAGATGGGCATGG - Intronic
1165494883 19:36146660-36146682 GAGGAACCTGATGCAGCCCAAGG + Intronic
1165794768 19:38512332-38512354 GGAGAACCTGCGGCTGGGCAAGG + Exonic
1165838731 19:38774274-38774296 GAGGAGGCTGAAGCTGGGATGGG + Intergenic
1165852779 19:38859946-38859968 GAGGAACGTGAAAGTGGACAAGG + Intergenic
1165885845 19:39077568-39077590 GAGGAAACTGAGGCTCAGCAAGG - Intergenic
1165906739 19:39198958-39198980 AAGGAACCTGAGGCTGAGGATGG - Intronic
1166066030 19:40359500-40359522 GGTGAAACTGAAGGTGGGCACGG - Intronic
1166130989 19:40745356-40745378 GAGGAAACTGAAGCTTGGGGAGG - Intronic
1166757854 19:45204683-45204705 GCAGAAGCTGAAGCTGGGCATGG - Intronic
1167540339 19:50082529-50082551 GATGAACATGAAGCTGGGAATGG - Intergenic
1167629368 19:50615270-50615292 GATGAACATGAAGCTGGGAATGG + Intergenic
1167632862 19:50636655-50636677 GAGGAAACTGAGGCTGAGAAGGG - Intronic
1167716016 19:51143312-51143334 GAGGCACCTGAGCCTGGACAGGG + Intronic
1167768726 19:51500781-51500803 GAGGCACCTGAGCCTGGACAGGG - Intronic
1168465850 19:56600554-56600576 AAGAAACCTGAGGCTGGGAAGGG - Intronic
1168713859 19:58516163-58516185 GGGGATCCTGAGGCTGGGTAGGG - Intronic
1202700914 1_KI270712v1_random:163145-163167 GAGGAAACTGAGGCTGGGCGAGG + Intergenic
925319051 2:2948196-2948218 GGGGTACCTGGAGCTGGCCAAGG - Intergenic
925847735 2:8048927-8048949 GAGGAACCCCAGGCTGGGGAGGG + Intergenic
926229933 2:10994662-10994684 GAGAAATATGAAGCTGGGGAGGG - Intergenic
927154867 2:20215709-20215731 GAGGAAACTGAGGCTGGGGTAGG + Intronic
927249890 2:20988157-20988179 GAGCAACCTCCAGCTGGGAATGG + Intergenic
927743002 2:25589660-25589682 AGGAAACCTGAGGCTGGGCATGG - Intronic
927894374 2:26771953-26771975 GAGAAACCTGGAGCCTGGCATGG - Intronic
928360220 2:30656508-30656530 GAGGAAACTGAAGCTCAGAAAGG - Intergenic
928759196 2:34561273-34561295 GAGTGAGCTGAAGCAGGGCAAGG - Intergenic
928898817 2:36295932-36295954 GAGGAAACTGAGGCTTGGAAAGG - Intergenic
928911246 2:36423891-36423913 GAGGAAGCTGAAGCTAGGAAAGG + Intronic
928915861 2:36469573-36469595 GAGCAAGCTGATGCTGGGTACGG - Intronic
929997198 2:46836078-46836100 GAGGAAACTGAGGCTGGGAAAGG + Intronic
930077315 2:47417402-47417424 AAAGAAACTGAGGCTGGGCACGG + Intronic
930088447 2:47514900-47514922 AAGGAACTTTTAGCTGGGCATGG - Intronic
930271055 2:49257183-49257205 GGTGAATCTGAGGCTGGGCACGG - Intergenic
930614529 2:53579493-53579515 TGTGAACCTGAAGCTGGGGATGG - Intronic
931038316 2:58267569-58267591 GAACTACCTGAAGCTGGGCATGG - Intergenic
931161840 2:59701731-59701753 GAGCCACCTAAAGCTGGGGAAGG + Intergenic
932051566 2:68403566-68403588 TAGGAAGCTGGAGCTTGGCAGGG - Intergenic
932242490 2:70168270-70168292 AAGGATCCTATAGCTGGGCATGG - Intronic
932312097 2:70751261-70751283 CAGAAACCTAAAGATGGGCAGGG + Intronic
932816555 2:74866482-74866504 GCGGAACCTGCAGCAGGGCAGGG - Intronic
933198445 2:79420079-79420101 GAGGAATCAGAAGCTGAGGAGGG - Intronic
933687678 2:85156365-85156387 AAGGAAGCTGAAGCTGGACTGGG - Intronic
933831436 2:86213040-86213062 GAGGAAACTGAAGCTGAGAGAGG + Exonic
934095129 2:88594901-88594923 AAAGAACCTGAGGCTGGGCATGG + Intronic
934171842 2:89546634-89546656 GAGGAAACTGAGGCTGGGCGAGG + Intergenic
934282150 2:91620952-91620974 GAGGAAACTGAGGCTGGGCGAGG + Intergenic
935065834 2:99646644-99646666 GAGGAACCTCAGGGTGGGAAAGG - Intronic
935566887 2:104618703-104618725 TAGGAAACTCAGGCTGGGCACGG + Intergenic
935576467 2:104716799-104716821 GAGCCACCTGAAGCTGGGGGTGG + Intergenic
936396546 2:112136290-112136312 GAAGAAGCTGAATCGGGGCATGG - Intergenic
936475957 2:112839919-112839941 GAGGAACTTGCAGCTGAGAAAGG - Intergenic
936605641 2:113949851-113949873 AAACAACTTGAAGCTGGGCATGG - Intronic
937199009 2:120185014-120185036 GAGCAACCTAAACCTGGGGAGGG + Intergenic
937200142 2:120197419-120197441 TAGCAAACTGAAGCTGAGCACGG + Intergenic
937245459 2:120489465-120489487 GAGGAAGCTGAAACTGAGCATGG - Intergenic
937300707 2:120839001-120839023 GAGGAACCTGCATCTGGCAAGGG + Intronic
937460541 2:122081891-122081913 GAGGAAATTGAAGCTGTGCAGGG - Intergenic
937686748 2:124706454-124706476 GTGTATCCTGAGGCTGGGCATGG + Intronic
937982665 2:127624458-127624480 GAGGAAACAGAGGCTGGGCCTGG - Intronic
938263050 2:129908909-129908931 GAGGAGGCTGCTGCTGGGCACGG - Intergenic
938696144 2:133837227-133837249 GAGGAACCTCCAGCAGAGCAGGG + Intergenic
939053430 2:137333195-137333217 TCGGAACCTGCTGCTGGGCAGGG - Intronic
939237905 2:139521086-139521108 GAGGAACCTGACCCTTGGCCTGG - Intergenic
939562237 2:143745838-143745860 GAGGAAACTGAAGCTGAGCAAGG + Intronic
940151790 2:150610413-150610435 GAGGAAGCTGAGGCATGGCATGG - Intergenic
940421683 2:153486223-153486245 AAGGAAGGTGAGGCTGGGCACGG - Intergenic
940425502 2:153526323-153526345 GAGCCACCTGAAGCTGGGTGTGG - Intergenic
940786240 2:157984617-157984639 GAGCCACCTGGAGCTGGGGATGG + Intronic
940952118 2:159687090-159687112 GAGGAAACTGAAACTGAGAAGGG + Intergenic
942490186 2:176482158-176482180 AAGGAACCTGAAGTTGGCCCTGG - Intergenic
943279760 2:185916961-185916983 GAAGTACCTGAGGCTGGGCCTGG - Intergenic
944318201 2:198306171-198306193 GATGAATATGAAGCTGGGCGTGG + Intronic
944993137 2:205260948-205260970 TAGGAACCTGGAGCTTGGGAGGG - Intronic
945134642 2:206614373-206614395 GAGTTATCTGAAGCTGGGCATGG + Intronic
945554145 2:211258586-211258608 TAAAAATCTGAAGCTGGGCATGG + Intergenic
945716143 2:213359744-213359766 GGGCAAGCTGAAGCAGGGCAGGG - Intronic
946545417 2:220736762-220736784 GAGGAACCTGAGGCAGTGGATGG - Intergenic
946836816 2:223780719-223780741 TAAGAACCTCAAGCTGGGCATGG - Intronic
947163179 2:227235012-227235034 AAGGAAGCTTAACCTGGGCATGG - Intronic
947483536 2:230525585-230525607 GGGCAAGCTGAAGCAGGGCAGGG + Intronic
947585068 2:231350464-231350486 GAGAAACCTGAGGCCAGGCATGG + Intronic
947932537 2:233975588-233975610 AAGAAACCAGAGGCTGGGCACGG + Intronic
948192416 2:236070161-236070183 GAGGAAACTGAGTCTGGGGAGGG - Intronic
948211213 2:236194707-236194729 GGTGAACCTGAAGCTTGGCAAGG + Intergenic
948772360 2:240258197-240258219 CAGGAACCTGGAGCAGGGCTTGG + Intergenic
948934163 2:241151361-241151383 GAGGAATGTGGAGCTGGGGAAGG + Intronic
948978235 2:241477416-241477438 AAGGAACATGAGGCCGGGCACGG - Intronic
1168781814 20:498494-498516 GACGTACCTGTGGCTGGGCATGG - Intronic
1168904467 20:1392521-1392543 GAGGAAACTGAGGCTTGGCGAGG - Intronic
1169281353 20:4269530-4269552 TAAAAAGCTGAAGCTGGGCACGG - Intergenic
1169694716 20:8374450-8374472 GGGGAACCTGAAGATGGAAAAGG - Intronic
1170848488 20:19982268-19982290 GAGGAAGCTGAGGCTGGGAAAGG + Intronic
1170863986 20:20137129-20137151 GAGCCACCTGAAGCTGGGGGAGG + Intronic
1170889309 20:20365159-20365181 GAGTCACCTGAAGCCGGGGAAGG + Intergenic
1170983597 20:21238117-21238139 AAGAAACCTGCCGCTGGGCATGG - Intronic
1171247232 20:23621304-23621326 GAGCAAGCTGAAGCAGGGTAGGG - Intergenic
1171349695 20:24492899-24492921 GATGCACGTGATGCTGGGCATGG + Intronic
1172027820 20:31961096-31961118 GAGGAAACTGAGGCTTAGCAAGG + Intergenic
1172126138 20:32626454-32626476 GAGAAAACTGAAGCTGGGCAAGG + Intergenic
1172151883 20:32796576-32796598 GGGGAACATCAAGATGGGCAAGG - Intronic
1172182717 20:33013520-33013542 GAGGAAACTGAGGCTCAGCATGG + Intronic
1172391771 20:34569970-34569992 GAGGAAACTGAGGCTTGGAAGGG - Intronic
1172424424 20:34845623-34845645 GAGGAAACTGAGGCTCAGCAAGG - Intronic
1173024668 20:39296765-39296787 GATGAAATTGAAGCTTGGCAAGG - Intergenic
1173059937 20:39651293-39651315 GAGGAAAATGAGGCTGGGAAAGG - Intergenic
1173600241 20:44289764-44289786 GAGGGACCTGAAGTTCAGCAGGG - Intergenic
1173653366 20:44681996-44682018 GAGGAAACTGAGGCGGGGCAAGG + Intergenic
1173656973 20:44706115-44706137 GAAGAAACTGAGGCTGAGCAAGG + Intergenic
1173713268 20:45179053-45179075 GAAGGAGCTGAAGCTGGGAATGG + Intergenic
1173913204 20:46685838-46685860 AAAGAAACTGAGGCTGGGCAAGG + Exonic
1173914903 20:46700070-46700092 GAGGAAACTGAGGCTCGGAAAGG - Intergenic
1173957124 20:47042211-47042233 GAGGAAACTGAGGCATGGCAAGG + Intronic
1174163416 20:48567729-48567751 CAGGAACCCGAGGCTAGGCATGG - Intergenic
1174360768 20:50027765-50027787 GAGGAAACTGAGGCTGGGTGAGG - Intergenic
1174513861 20:51076328-51076350 GAGGACTCTGAGGCTGAGCATGG + Intergenic
1174577706 20:51548334-51548356 GAGGAACATGAAGCAGGGTGAGG - Intronic
1175403727 20:58714412-58714434 GAGGCAGCAGAAGCTGGGCTGGG - Intronic
1175466587 20:59193987-59194009 GAGGGGCCTGAGGCTGGGCTGGG - Exonic
1175700726 20:61135149-61135171 GAGGAACCTGAGTCCCGGCAAGG - Intergenic
1175788257 20:61725344-61725366 TAGGCACCTGCAGCTGGGAAGGG + Intronic
1177173256 21:17676976-17676998 GAGGAACATGAAAGTGGACAAGG + Intergenic
1177401153 21:20606477-20606499 GAGTTACCTAAAGCTGGGGATGG - Intergenic
1177772483 21:25531914-25531936 GAGGAACATGAAAGTGGACAAGG + Intergenic
1178426374 21:32482141-32482163 GAGGAAACTGAGGCTTAGCAAGG + Intronic
1178897591 21:36572234-36572256 GCGTAACCTGAATCTGTGCAGGG + Intronic
1178974345 21:37208765-37208787 GAGGAAAACGAAGCTGGGAAGGG + Intergenic
1179206381 21:39284186-39284208 GAAGAACCTCCAGCTGGGTAGGG + Intronic
1179251213 21:39673309-39673331 GTGGATCCTGAAGGTGGGCGGGG + Intergenic
1179373200 21:40826116-40826138 AAGAAACCTGAAGCATGGCAAGG + Intronic
1180090854 21:45533274-45533296 TGGGAACGTGGAGCTGGGCACGG + Intronic
1180627752 22:17205582-17205604 GAGAAACGTGAAGCTGAGCAAGG - Intronic
1180687184 22:17678553-17678575 GAGGAAACTGAAGCTTGGATAGG - Intronic
1180710870 22:17838569-17838591 GAGGAAACTGAAGCAGGGAGAGG + Intronic
1180765167 22:18341956-18341978 GGGGAAACTGAGGCTGGACATGG - Intergenic
1180813863 22:18777728-18777750 GGGGAAACTGAGGCTGGACATGG + Intergenic
1180998790 22:19978368-19978390 GAGAGACCTGAACCTGTGCAAGG + Intronic
1181036346 22:20171574-20171596 GAGGAAGCTGAGGGTGGCCAGGG + Intergenic
1181102796 22:20552681-20552703 GAGGAAACTGAGGCTGTCCACGG - Intronic
1181200048 22:21212063-21212085 GGGGAAACTGAGGCTGGACATGG + Intronic
1181510446 22:23386536-23386558 GAGGAGCCTGGGCCTGGGCAGGG + Intergenic
1181550168 22:23633614-23633636 GAAATACCTGAGGCTGGGCATGG - Intergenic
1181701687 22:24624896-24624918 GGGGAAACTGAGGCTGGACATGG - Intronic
1181877163 22:25948699-25948721 GAGGTACATGAAGGTGGGAATGG - Intronic
1182027942 22:27134965-27134987 GAGGAAACTGAGGCAGAGCAGGG - Intergenic
1182306416 22:29372130-29372152 AAGGGAACTGAGGCTGGGCATGG + Intronic
1182469634 22:30540211-30540233 GAGGAAACTGAGGCTGGAAATGG + Intronic
1182764410 22:32748375-32748397 GAGGAACCTGAAGCTCAGAGAGG - Intronic
1182833273 22:33321061-33321083 GAGGACCCTGAAGCTCAGAAAGG - Intronic
1183228917 22:36568807-36568829 GGGGGACCTGAAGAAGGGCAGGG + Intronic
1183271523 22:36865433-36865455 GAGGAAGCTGAGGGTGGGCAGGG - Intronic
1183598555 22:38826741-38826763 GAGGACCCTGAGGGTGGGCAAGG + Exonic
1183739911 22:39663708-39663730 CAGGACCCGGAACCTGGGCAGGG - Exonic
1184213428 22:43050811-43050833 GAATAACTTGAGGCTGGGCATGG - Intronic
1184322907 22:43756709-43756731 GAAGAACATAAAGATGGGCAGGG + Intronic
1184482835 22:44758158-44758180 GAGGCATCTGAGGCCGGGCACGG + Intronic
1184795926 22:46732320-46732342 CAGGAACCTGTAGCTGGTCCAGG - Intronic
1203226788 22_KI270731v1_random:82861-82883 GGGGAAACTGAGGCTGGACATGG - Intergenic
1203263962 22_KI270734v1_random:3415-3437 GGGGAAACTGAGGCTGGACATGG + Intergenic
949590228 3:5486528-5486550 GAGGTACCTCAGGCTGGGTACGG - Intergenic
949715575 3:6927135-6927157 TAGAAAAATGAAGCTGGGCATGG + Intronic
949829139 3:8196202-8196224 GAGCTGCCTGGAGCTGGGCAGGG + Intergenic
950098218 3:10342422-10342444 GAGGCACCTGAGGCTGGGAGGGG - Intronic
950508558 3:13411662-13411684 GAGGAGCCTGATGGTGGGGAGGG - Intronic
950522769 3:13506462-13506484 GAGGAAACTGAGGCTTGGCAGGG + Intergenic
950645884 3:14376529-14376551 GAGGAAACTGAGGCTTGGCAAGG - Intergenic
950654555 3:14428554-14428576 GAGGAACCTGAAGCAGAGACAGG + Intronic
950695520 3:14698644-14698666 GAGCCACCTGGAGCTGGGGATGG + Intronic
951585601 3:24211971-24211993 AAGGAAATTGAGGCTGGGCACGG + Intronic
951819245 3:26790508-26790530 GAGCCACCTAAAGCTGGGGATGG + Intergenic
953289554 3:41648163-41648185 GTGGGAGCTGAAGCAGGGCAAGG - Intronic
953964575 3:47293800-47293822 GAGGAAACAAAAGATGGGCAAGG - Intronic
954182177 3:48890168-48890190 GAGGAACATGAAAGTGGACAAGG - Intronic
954627885 3:52032662-52032684 GAGGAATCTGGAGCTTAGCAGGG + Intergenic
954655109 3:52189869-52189891 GAGGAAACTGAAGCTCAGAAAGG + Intergenic
954740076 3:52742359-52742381 GAGCAAGCTGAAGCTGGGCATGG - Intronic
955156932 3:56426157-56426179 GAGGAGCCTGAAGCTGAGCCAGG + Intronic
955429727 3:58830164-58830186 GAGAAACCTGAAGGTATGCAAGG + Intronic
955736830 3:62047550-62047572 TAGGAAGCTGGGGCTGGGCATGG - Intronic
956294804 3:67700667-67700689 GAAGAAACTGAAGCCTGGCATGG - Intergenic
956675739 3:71730305-71730327 GAGGAATCTGGAGCTCAGCAAGG - Intronic
957474765 3:80709275-80709297 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
958266319 3:91441628-91441650 CATGAACCTGAAGATGGGTAAGG + Intergenic
958862152 3:99457466-99457488 GAGCCACCTAAAGCTGGGCATGG + Intergenic
960291360 3:115889160-115889182 GGTGAGCCTGAAGATGGGCAAGG + Intronic
960618580 3:119618420-119618442 GAGGAACCTGTATGTGGGAAGGG - Intronic
961450988 3:127002215-127002237 GTGGAGCCCAAAGCTGGGCAGGG - Intronic
961475888 3:127146061-127146083 GAGAAAACTGAAGCAGGGAAAGG - Intergenic
961687102 3:128641398-128641420 GAGGAAGGTGAAGCTGTGTAGGG - Intronic
961816095 3:129551158-129551180 AAGGCCCCTAAAGCTGGGCAGGG + Exonic
961823540 3:129587242-129587264 GAGGAATCTGAGGCTGGGAGCGG + Intronic
961921607 3:130432262-130432284 GAGGAAACTGGGGCTGGGCGCGG + Intronic
962624428 3:137211176-137211198 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
962645078 3:137430651-137430673 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
962802126 3:138899329-138899351 GTGGAAGCAGATGCTGGGCACGG - Intergenic
963080969 3:141393489-141393511 GAGGAACCTGGAGCAGGGAAAGG + Intronic
963126208 3:141819477-141819499 GAAATACCTGAGGCTGGGCATGG + Intergenic
963140270 3:141941139-141941161 GAGGCTCAAGAAGCTGGGCATGG + Intergenic
963326955 3:143873910-143873932 GAGGAACATGAAAGTGGACAAGG + Intergenic
964338837 3:155686633-155686655 GAGGATGCTGAGGCTGGGAAAGG - Intronic
964473249 3:157076276-157076298 CAGGACCCAGAAGATGGGCAGGG + Intergenic
964736400 3:159923053-159923075 GAGGAAACTGAAGCTTTGCGAGG - Intergenic
965420603 3:168453694-168453716 GAGGAACCTGTAGATAGGAAGGG - Intergenic
966318041 3:178670786-178670808 GAGGAAGCTGAAGCCGGGAGAGG + Intronic
966493642 3:180556138-180556160 GGGTAACCTGAAGCAGGGTAGGG + Intergenic
966662103 3:182426254-182426276 GCGCAAGCTGAAGCAGGGCAAGG + Intergenic
966962645 3:184955246-184955268 GAGGAACATGAAAGTGGACAAGG - Intronic
967465479 3:189800681-189800703 GAGGAAACTGAAGCTCCACAAGG - Intronic
968172421 3:196521285-196521307 GAGGAACATGAAAGTGGACAAGG - Intergenic
968801718 4:2747277-2747299 GAGGAAACTGAAGCAGAGCCAGG - Intronic
969027908 4:4189253-4189275 GAGGAAACCGAGGCTGGGCGAGG - Intronic
969497297 4:7533449-7533471 CAGGAACTCGAAGCTGGGCCAGG - Intronic
969535654 4:7754940-7754962 CAGGAGCCTGAACCTGGGAATGG + Intergenic
969585367 4:8088310-8088332 GAGGAGCCAGAAGGTGGGCCTGG - Intronic
969622719 4:8286809-8286831 GAAGCACCTGGGGCTGGGCATGG + Intronic
970189220 4:13495077-13495099 GAGGGCCCTTATGCTGGGCATGG - Intergenic
970569807 4:17368658-17368680 GAGAAAACTGATGCTGAGCAAGG + Intergenic
970940339 4:21625431-21625453 GAGGAAGCTGAAGCTTGGTAAGG + Intronic
971155563 4:24078079-24078101 GAGGAAACTGAGGCAGTGCAGGG - Intergenic
971231115 4:24800603-24800625 GAGGAACCTGAAGGCGGGAAGGG - Exonic
971361621 4:25943340-25943362 GAGGCATCTGAGGCTGGGAAAGG + Intergenic
972095162 4:35339967-35339989 TAGGACCCTGAAACTTGGCAAGG + Intergenic
972289399 4:37677678-37677700 GAAATACCTGAGGCTGGGCACGG + Intronic
972497358 4:39646432-39646454 TAGGGATCTGGAGCTGGGCAAGG - Intergenic
973337895 4:48974981-48975003 GAGGAAACTGAGGCTCGGAAAGG + Intergenic
973960912 4:56108884-56108906 GAGGAACATGAAAGTGGACAAGG + Intergenic
974127482 4:57714262-57714284 GGGTAAGCTGAAGCAGGGCAGGG + Intergenic
974895100 4:67928334-67928356 GAGTCACCTGAGGCTGGGCATGG - Intronic
974956397 4:68646200-68646222 GTGTAAGCTGAAGCAGGGCAAGG - Intronic
975095213 4:70449822-70449844 GAGCCACCTAAAGCTGGGGATGG + Intronic
975140336 4:70912185-70912207 GATGGACCTAAGGCTGGGCACGG - Intronic
975252830 4:72198889-72198911 GAGGCACCTGGAGCTGGGGGTGG - Intergenic
975557163 4:75676127-75676149 AAGGGGCCTGAACCTGGGCAGGG - Intronic
976105111 4:81608295-81608317 GAGGAAACTGAGGCTTAGCAAGG - Intronic
976260222 4:83138276-83138298 GAGGAATCTGCAGCTGAGAAAGG - Intergenic
976273911 4:83256850-83256872 GAGGAAGCTGAGGCCGGGCACGG - Intergenic
976366361 4:84237342-84237364 GAGCCACCTGAAGCTGGAAAAGG + Intergenic
976552616 4:86413887-86413909 GGGCAAGCTGAAGCAGGGCAGGG - Intronic
976802921 4:89013118-89013140 GAGCACCCTGAAGCCGGGGATGG - Intronic
976941391 4:90705936-90705958 GCGTAAGCTGAAGCAGGGCAAGG - Intronic
977915587 4:102588846-102588868 GAGGAAACTGAAGCTAGGAGGGG - Intronic
978116595 4:105025916-105025938 GAGCCACCTAAAGCTGGGGATGG - Intergenic
978205351 4:106074084-106074106 GGGCAAGCTGAAGCAGGGCAGGG - Intronic
978773805 4:112485705-112485727 GAAGAAACTGAAGCTAAGCAAGG - Intergenic
979747731 4:124238760-124238782 GGAAAAACTGAAGCTGGGCAAGG - Intergenic
979782733 4:124674518-124674540 GAGGAACCTAAAGCTCAGAAAGG + Intronic
979926902 4:126579330-126579352 GAGGAATCTGCAGCTGCGAATGG - Intergenic
980260610 4:130442855-130442877 GGGCAAGCTGAAGCAGGGCAGGG - Intergenic
981250402 4:142594663-142594685 GGGGAACATGAGGCCGGGCATGG + Intronic
981698178 4:147580087-147580109 GAAATACCTGAGGCTGGGCACGG + Intergenic
982213794 4:153063023-153063045 GAGGAAAGGGAAGCTTGGCAAGG + Intergenic
982395103 4:154907723-154907745 GAGGAACATGAAAGTGGACAAGG + Intergenic
983218982 4:165026571-165026593 GAGGAAGCTGCAGCTATGCATGG - Intergenic
983872149 4:172834790-172834812 GAGGAGCCTGAAGCAAAGCAGGG + Intronic
984483312 4:180334239-180334261 GAAGAAATTGAAGATGGGCAAGG - Intergenic
984559547 4:181252404-181252426 GAGGAAACTGAAACTTGGAAAGG + Intergenic
985038163 4:185861953-185861975 GGGCAACTGGAAGCTGGGCAAGG + Intronic
985287752 4:188354325-188354347 GGGAAGCCTGAAGCTGAGCATGG + Intergenic
985319900 4:188699173-188699195 CAGGTACCTGAATCTGGGAAGGG + Intergenic
985534595 5:456901-456923 GAGGAACGTGGAGCTGGCCCCGG + Exonic
985591284 5:766740-766762 GAAGATCCTGAAGGTGGCCAAGG + Exonic
985591798 5:769578-769600 GAGGAACGTGCAGCCTGGCACGG - Intergenic
985609713 5:880537-880559 GAGGAACGTGCAGCCTGGCACGG - Intronic
985768871 5:1796599-1796621 GAGGGGCCTGAGGCTGGGCACGG - Intergenic
986195634 5:5534551-5534573 GAGGAAACTGTGGCTGAGCAAGG - Intergenic
986226594 5:5821144-5821166 GAGGAAACTGAGGCAGGACAGGG - Intergenic
986631055 5:9774804-9774826 GAGCTGCCTGAAGCTGGGAAAGG + Intergenic
987371880 5:17201027-17201049 GAGGAAAATGAAGCAGGGTAAGG + Intronic
988023708 5:25655812-25655834 GAGCAAGCTGAAGCAGGGCGCGG - Intergenic
988344636 5:30021235-30021257 GAGGAACTGGTAGGTGGGCAGGG - Intergenic
988731114 5:33973959-33973981 GAGGAACCAGGAGCTGAACAGGG + Intronic
989146540 5:38256476-38256498 GAGGAACCTGAAGCATGGGAAGG - Intergenic
989349898 5:40474404-40474426 CAGGAAGCTTAAACTGGGCAGGG - Intergenic
990006975 5:50955060-50955082 GAACAACTTGAAGCGGGGCAGGG - Intergenic
990488176 5:56279346-56279368 GAGGTGCCTGAAGCTGTGGAAGG + Intergenic
990761938 5:59139311-59139333 GAGGAAACAGAAGATGGGGAAGG + Intronic
990773843 5:59283056-59283078 GAGGAAACTGAAGCCAGGGAAGG - Intronic
990823844 5:59875169-59875191 AAGGAATCTGTGGCTGGGCATGG + Intronic
991018877 5:61959556-61959578 GGGGAACCAGGAGCTGGGTAGGG - Intergenic
991045043 5:62213674-62213696 GAAGAAGCTGAATCTGGGCGAGG - Intergenic
991971549 5:72146594-72146616 GAGGAACCTGAGGCACAGCATGG + Intronic
992014491 5:72561609-72561631 GAGGAAACTAAAGCAGGGAAAGG - Intergenic
992191328 5:74294843-74294865 GAGAAACCTGAAGCTTGGAGTGG - Intergenic
993197145 5:84764049-84764071 GAGGCACCTAAATCTGGGGATGG + Intergenic
993389247 5:87298117-87298139 AAGGAACAGGAGGCTGGGCACGG + Intronic
993420095 5:87690537-87690559 CAGGAAGCTGAGGCTGCGCACGG - Intergenic
993481165 5:88426148-88426170 AAGGAAAGTGAGGCTGGGCATGG - Intergenic
993512374 5:88787450-88787472 GAGGAACCTAAAGCCCAGCAAGG + Intronic
993591461 5:89800587-89800609 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
993703680 5:91146869-91146891 AAAGAATTTGAAGCTGGGCATGG + Intronic
994043558 5:95284479-95284501 GAAGAACCTGCAGCTGGGGGTGG - Exonic
994388280 5:99158973-99158995 GAGGAACCTGGACCTGAGGAGGG + Intergenic
995324145 5:110872501-110872523 GAGGAAACTGAGGCCCGGCAAGG - Intergenic
997070701 5:130618943-130618965 GATATACCTGAAGCAGGGCAAGG + Intergenic
997154199 5:131534964-131534986 GAAGGACCTCAAGCTGGGCAAGG + Intronic
997180618 5:131825042-131825064 GAAGAAGAAGAAGCTGGGCATGG + Intronic
997231489 5:132247546-132247568 GAGGAATGAGAGGCTGGGCACGG + Intronic
998095928 5:139395415-139395437 GAGGAAACTGAAGCCCAGCAGGG + Exonic
999559712 5:152787751-152787773 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
999648037 5:153738406-153738428 GGGGAAACTGAAGCTTGGCAAGG - Intronic
999833594 5:155344361-155344383 GAGGAAACTGAGGCTGAGAAAGG + Intergenic
999959786 5:156742164-156742186 AAGAAACCTGAGGCCGGGCACGG - Intronic
1000136095 5:158352483-158352505 GAAAAATCTCAAGCTGGGCATGG - Intergenic
1000442892 5:161284019-161284041 GAGGAAGCTGAAGCTTCCCAAGG - Intergenic
1001278087 5:170365516-170365538 GGGGAACCTGCCGCTGGGAAAGG + Intronic
1001347829 5:170922789-170922811 GGGCAAGCTGAAGCAGGGCAGGG - Intronic
1001704772 5:173733933-173733955 GAGGAAGCTGAGGCTTGGCGAGG + Intergenic
1001866487 5:175110435-175110457 TAAGAAGCTGAGGCTGGGCATGG - Intergenic
1001879907 5:175234361-175234383 TAGGATCCTGAAGGTGGGAAGGG - Intergenic
1002001727 5:176199918-176199940 GGGGAGCCTGAAGCTGGGGTAGG - Intergenic
1002303786 5:178272008-178272030 GAGGACCCTGATGCTGGGCCTGG - Intronic
1002423176 5:179160762-179160784 GAGGAAGCTGGAGGAGGGCAAGG + Intronic
1003542115 6:7027008-7027030 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1003826311 6:9956070-9956092 AAGGAATTTGAAGCTGGGCCTGG - Intronic
1005209380 6:23443137-23443159 TTGGAAACTGAAGCTGGGCTTGG - Intergenic
1005855696 6:29861442-29861464 GAGGACCCAGGAGCTGGACATGG - Intergenic
1005899310 6:30204170-30204192 GAGGAAACTGAGGCTCAGCAGGG + Intronic
1006389114 6:33748224-33748246 GAGGGACCAGAAGATGGGTAAGG - Intergenic
1006459576 6:34150613-34150635 GGGGAAACTGAGGCTGGGGAAGG - Intronic
1006459592 6:34150678-34150700 GGGGAAACTGAGGCTGGGGAAGG - Intronic
1006472576 6:34237048-34237070 GAGGGGCAGGAAGCTGGGCACGG - Exonic
1006474895 6:34247321-34247343 GAGTAACCTGAGGCTGGGGCAGG + Intronic
1006484513 6:34327630-34327652 GAGGAACATGAAAGTGGACAAGG + Intronic
1006837478 6:37007690-37007712 GAGGAAACAGAAGCTGGCCAGGG + Intronic
1007474255 6:42108242-42108264 GAGGAAACTGAGGCTCAGCAAGG - Intronic
1008880878 6:56378850-56378872 GAGCCACCTGAAGCTGGGGGTGG - Intronic
1008960792 6:57263386-57263408 GAGCCACCAGAAGCTGGGAAGGG - Intergenic
1009687699 6:66985864-66985886 GAGTCACCTAAAGCTGGGGATGG + Intergenic
1009771130 6:68144467-68144489 GAGCCACCTGAAGCTGGGGGCGG + Intergenic
1010282276 6:74035665-74035687 GGGCAAGCTGAAGCAGGGCAGGG - Intergenic
1010785366 6:79993993-79994015 CAGTATCCTGAAGCTGAGCAGGG - Intergenic
1011063036 6:83293114-83293136 GGGCAAGCTGAAGCAGGGCAGGG - Intronic
1011700170 6:89948496-89948518 GAGGAGCCTGGGGCCGGGCATGG - Intronic
1012437286 6:99227661-99227683 GAGGAAACTGAGGCTGAGCCAGG - Intergenic
1013505422 6:110795259-110795281 CAGGAAGTTTAAGCTGGGCATGG - Intronic
1013732572 6:113185669-113185691 GAGGAGCCTCAAGATGTGCAAGG - Intergenic
1014440393 6:121467187-121467209 AAAGAACCTGAGGCTGGGCGTGG - Intergenic
1014838227 6:126184509-126184531 GAAGAACCTGAAGCTCAGAATGG + Intergenic
1015133003 6:129835577-129835599 GGGCAAGCTGAAGCAGGGCAGGG + Intronic
1015235357 6:130964464-130964486 GAGGAAGCTGAAACTCAGCAAGG - Intronic
1015755349 6:136600482-136600504 AATGAACATGAGGCTGGGCATGG - Intronic
1015872532 6:137791584-137791606 CAGGAAGCTGTAGATGGGCAAGG - Intergenic
1016034077 6:139367874-139367896 GAGGAGCCTGTAGCAAGGCAAGG - Intergenic
1016607945 6:145955174-145955196 GAGGTATCTGAACCTGGGCAGGG + Exonic
1016976708 6:149815865-149815887 GATGAAGCTGGGGCTGGGCATGG - Intergenic
1017064742 6:150518523-150518545 GAAGAAGCTGAGGCTTGGCAGGG + Intergenic
1017659894 6:156663655-156663677 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1017780018 6:157708508-157708530 GAGGAACCTGAATTTGGCTAAGG - Intronic
1018085439 6:160297601-160297623 GAGGGGCCTTACGCTGGGCATGG - Intergenic
1018317277 6:162569407-162569429 GAAGAACATGAAGCTGGCCCTGG + Intronic
1019071107 6:169345923-169345945 AAGGAACCTGAGACTGGGCTTGG + Intergenic
1019196906 6:170288437-170288459 GAGGCACCTGACGGTGGGCGAGG - Exonic
1019296621 7:280301-280323 GAGGAACTAGAAAATGGGCAAGG + Intergenic
1019571162 7:1713077-1713099 GAGGAGCCTGAACTTGGGCTGGG - Intronic
1019698724 7:2461847-2461869 GAGGAAACTGAGGCAGAGCAAGG + Intergenic
1019743000 7:2684415-2684437 GGGGAAACTGAGGCAGGGCAAGG + Intronic
1020100155 7:5389904-5389926 GAGGAAACTGAGGCTTGGGAAGG - Intronic
1020272690 7:6606661-6606683 CTGGGACCTGAAGCTGGGAAGGG + Intronic
1021437615 7:20638520-20638542 GAGTTGCCTCAAGCTGGGCATGG - Intronic
1021466522 7:20950324-20950346 GAGGAACTGGAAGATGGGAATGG - Intergenic
1021942021 7:25687399-25687421 GATGAGCCTGAAGCTTAGCAGGG - Intergenic
1022348364 7:29539844-29539866 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
1022488632 7:30799832-30799854 GAGGAAAGTGGAACTGGGCAGGG + Intronic
1022849497 7:34245855-34245877 GAGGAACAAGAGGCTGGGCGCGG + Intergenic
1023059347 7:36313442-36313464 TAGAAACCTGAAGCTGGTCAGGG - Intergenic
1023639719 7:42245356-42245378 GAGGAAACTGCAGCTAGGAATGG - Intergenic
1024274130 7:47664066-47664088 GAAGAAACTGAAGCTCAGCAAGG + Intergenic
1024563853 7:50665724-50665746 GAGGAAGCAGAGCCTGGGCAGGG + Intronic
1024783156 7:52875397-52875419 GAGGAACATAAAGTTGGGCCAGG - Intergenic
1025079585 7:55970064-55970086 GAGGAAACTGAAGAAGGGAAAGG - Intronic
1025911377 7:65831628-65831650 AAGGAACATGAAGCCAGGCATGG + Intergenic
1026074309 7:67152371-67152393 GAGGAAACTGATGGTGAGCAAGG - Intronic
1026175311 7:67991457-67991479 GAGTCACCTCATGCTGGGCATGG - Intergenic
1026548372 7:71345083-71345105 GTGACACCAGAAGCTGGGCAAGG + Intronic
1026571988 7:71539222-71539244 GAGTATCCTGAGGCTGGGCACGG - Intronic
1026962266 7:74416544-74416566 GAGAAAACTGAAGCTGGGGAGGG - Intergenic
1027149169 7:75720449-75720471 AAGAAACTTGAGGCTGGGCATGG - Intronic
1027214432 7:76174675-76174697 GTGGAAAATGAGGCTGGGCAGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029424559 7:100487850-100487872 AAGGAACCTACAGCTGGGCATGG + Intronic
1030061584 7:105625539-105625561 AAGTAAATTGAAGCTGGGCACGG - Intronic
1030071067 7:105697941-105697963 GTGGAAGAGGAAGCTGGGCAGGG + Intronic
1030412022 7:109192731-109192753 GAGATACCTGAAACTGGTCAGGG + Intergenic
1030642538 7:112022564-112022586 GAGGAAACTGAAGCACAGCACGG - Intronic
1031472531 7:122183366-122183388 GAGTCACCTGAACCTGGGAATGG - Intergenic
1032259903 7:130327081-130327103 GAGGACCATGCGGCTGGGCATGG + Intergenic
1032626924 7:133601558-133601580 AAGGAACATGAAGATGGGGAGGG - Intronic
1033213989 7:139481032-139481054 AAGGCTCCTGAAGCTGGGCACGG - Intronic
1033389956 7:140917472-140917494 GAGGAACTAGGAGCTGGGCTTGG + Intronic
1033916221 7:146329761-146329783 GAAGAACCTTAGGTTGGGCAAGG - Intronic
1034946840 7:155267694-155267716 GAGGCAGCTGCAGCTGGGAAAGG - Intergenic
1035156792 7:156920805-156920827 GAGGAACATGAAAGTGGACAAGG + Intergenic
1035444355 7:158929647-158929669 GCCCAACCTGCAGCTGGGCAGGG - Intronic
1036991967 8:13608187-13608209 GAGGAACATGAAAGTGGACAAGG - Intergenic
1037025273 8:14028046-14028068 GAGGAACATGAAAGTGGACAAGG + Intergenic
1037712327 8:21364745-21364767 GAGGAACAGGCTGCTGGGCAGGG + Intergenic
1037967249 8:23144671-23144693 GGGGACCCTGAAGCTGAGCCCGG - Intronic
1038052025 8:23823006-23823028 GAAGAACCTGAAGCAAGTCAGGG + Intergenic
1038060138 8:23903517-23903539 AATGAACCGGAAGCTGGGCGCGG + Intergenic
1038695861 8:29805682-29805704 CACCAAGCTGAAGCTGGGCATGG - Intergenic
1039217340 8:35286866-35286888 TTGGAACCTGTAGTTGGGCACGG - Intronic
1040072348 8:43198575-43198597 TAAGAACCAGAGGCTGGGCACGG - Intronic
1040535079 8:48302023-48302045 GAGGAAACTGAGGCTTAGCAGGG + Intergenic
1040860665 8:51995958-51995980 GAGGTACCTGAAAATTGGCATGG - Intergenic
1040883776 8:52237029-52237051 GAGGAACCTGAAGGTGAGGGAGG - Intronic
1041005978 8:53497342-53497364 GAGGAAGCTGAGGCTCTGCAGGG - Intergenic
1041049956 8:53924612-53924634 AATGAACTTGCAGCTGGGCATGG - Intronic
1041079877 8:54206287-54206309 GAGGAACCAGGAGGTGGACATGG + Intergenic
1041155869 8:54986143-54986165 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1041203739 8:55476570-55476592 GAGCAAGCTGAAGCAGGGCGAGG + Intronic
1041876368 8:62691936-62691958 GCCTAACCTGAAGCTGGCCATGG - Intronic
1042415886 8:68518267-68518289 GAGGAAGCTGAAGCTCAACATGG - Intronic
1042933915 8:74039804-74039826 GAGGAACATGAAAGTGGACAAGG + Intergenic
1045071200 8:98506369-98506391 GGGCAAGCTGAAGCAGGGCAGGG - Intronic
1045497826 8:102723049-102723071 GAGGAAACTGAGGCTTGGAAGGG - Intergenic
1045899573 8:107261413-107261435 AAAGAACATGAAGCCGGGCACGG + Intronic
1046612975 8:116446095-116446117 AAGGAACCGGAGGCCGGGCACGG + Intergenic
1046711811 8:117519269-117519291 GTGGAACCTGAAGGTGGATAGGG - Intergenic
1047196268 8:122724761-122724783 GAGGAACCTGAAGCTTGCAAAGG + Intergenic
1047319562 8:123767139-123767161 GAGGAGACTGAGGCTTGGCAGGG - Intergenic
1047642789 8:126838331-126838353 GAAGAACTTCCAGCTGGGCATGG - Intergenic
1048042756 8:130747001-130747023 GAGGAACATGAAAGTGGACAAGG - Intergenic
1048299631 8:133241903-133241925 CAGAAAGCTGAAGCTGGCCAGGG + Intronic
1048440241 8:134454369-134454391 GAGGCACCTGGAGCTGGTCCTGG + Intergenic
1048529790 8:135236844-135236866 AGGGGACCTGAAGCTGGGTAGGG + Intergenic
1049086674 8:140483799-140483821 GAACTACCTGAGGCTGGGCACGG - Intergenic
1049472409 8:142782409-142782431 GGGGAAACTAAGGCTGGGCAAGG - Intergenic
1049721993 8:144121517-144121539 GGGGGACCTGGGGCTGGGCACGG - Intergenic
1049722150 8:144123369-144123391 GAGGATACTGAGGCTGGGAAGGG + Intergenic
1049808965 8:144554698-144554720 GAGGAAACGGAAGCTCGGGAAGG + Intronic
1049875845 8:145019779-145019801 GTGAGACCTGAAGCAGGGCAAGG - Intergenic
1051157798 9:14170349-14170371 AAGGAACCTGAGGCCAGGCATGG + Intronic
1051538608 9:18188927-18188949 GAGGAAACTGAGGCTTGGGAAGG + Intergenic
1052352084 9:27468415-27468437 GAGGAAATCGAGGCTGGGCAAGG - Intronic
1052476940 9:28971919-28971941 GAGCAACCTAAAGCTGGGGGTGG - Intergenic
1052607550 9:30723751-30723773 GAGCTACCTGGAGCTGGGGATGG - Intergenic
1052896675 9:33753864-33753886 GAGAAGCCTGAGGCTGGGAAAGG + Intronic
1053294279 9:36901775-36901797 GAGGAAGCTGAGGCTCAGCAAGG - Intronic
1055302166 9:74892809-74892831 GAGCTACCTGGAGCTGGGTATGG - Intergenic
1055338730 9:75259646-75259668 GTGTGAGCTGAAGCTGGGCAAGG - Intergenic
1055484300 9:76742321-76742343 GAAGAAAGTGAGGCTGGGCATGG + Intronic
1056108766 9:83373696-83373718 GAGGTCCCTGAAGCTGCTCAGGG + Intronic
1056264545 9:84883249-84883271 AAGGACCATGAAGCTGGGTAAGG + Intronic
1056891569 9:90498885-90498907 GAAAAACTTGGAGCTGGGCACGG - Intergenic
1056902269 9:90611257-90611279 GAGGAATCTGAAGGGGGCCACGG + Exonic
1056957458 9:91093492-91093514 GAGCCACCTGAAGCTGGGGCAGG - Intergenic
1057200297 9:93136157-93136179 GAGGAAACTGAGGCTGGGAGAGG - Intergenic
1057422690 9:94925277-94925299 TAGGAACTTGAGGCTGGGCGCGG - Intronic
1057587599 9:96343397-96343419 GAGGAACAAAAAGCTGGGGATGG + Intronic
1057746775 9:97758692-97758714 GAGGAAACTGAGGCTCAGCAAGG - Intergenic
1058120822 9:101136788-101136810 TGGGTACCTGAAGCTGGGAAGGG + Intronic
1058988894 9:110235727-110235749 GTGTGACCTGAAGCAGGGCAAGG - Intergenic
1059123237 9:111661405-111661427 GTGGCACCTGCAGCTGGGCCTGG - Exonic
1059185965 9:112271115-112271137 AAGGAACCTAAAGCTGAGCATGG - Intronic
1059655650 9:116355074-116355096 GGGGAACCTGAGGAGGGGCACGG - Intronic
1059950205 9:119454402-119454424 GAGGAAAGTGATTCTGGGCATGG - Intergenic
1059968834 9:119643398-119643420 GAACTACCTGAGGCTGGGCATGG - Intergenic
1059974375 9:119699929-119699951 GAGGAAACTGAGGCTCAGCAGGG + Intergenic
1060237218 9:121873258-121873280 GAAGAAACTGAGGCTTGGCAAGG + Intronic
1060433716 9:123574598-123574620 GGGGAAACTGAAACTGGGTAAGG - Intronic
1060828565 9:126700076-126700098 GAGGGACAAAAAGCTGGGCATGG + Exonic
1061053126 9:128207667-128207689 GAGGAAATAGCAGCTGGGCAGGG - Intronic
1061204895 9:129157133-129157155 GGGGTACCCGGAGCTGGGCAAGG + Intergenic
1061222583 9:129260779-129260801 GAGGGCCCTGAGGCTGGGCCAGG + Intergenic
1061615312 9:131775197-131775219 GAGGAAACAGAAGCCGGGAAGGG - Intergenic
1061805838 9:133137485-133137507 GAGGAGCCTGAGGGAGGGCAGGG + Intronic
1061841031 9:133358697-133358719 GAGGCACCTGAAGCTTGGCAGGG + Intronic
1061845784 9:133387280-133387302 GAGGAAGCTGAAGGTGGGGCAGG + Intronic
1061876707 9:133547699-133547721 GTGGAGCCTGAAGCTAGGTAGGG - Intronic
1061915469 9:133750890-133750912 GAGTCACCTAAAGCTGGGGATGG + Intergenic
1062002862 9:134225578-134225600 GAGGAAACTGAGGCTGGGGGAGG - Intergenic
1062043567 9:134415114-134415136 GTGTATCCTGAAGCTGGGGATGG + Intronic
1186473074 X:9836250-9836272 GAGAAAACTGAGGCTGAGCATGG - Intronic
1187102110 X:16204216-16204238 TAGCTACCAGAAGCTGGGCAGGG + Intergenic
1187268799 X:17761372-17761394 GAGCATCCTGAGGCTGGGGATGG - Intergenic
1187320677 X:18234954-18234976 GAGCATCCTGAGGCTGGGGATGG + Intergenic
1187360843 X:18626357-18626379 GAGTAAACAGAGGCTGGGCATGG - Intronic
1187410424 X:19046152-19046174 CAGTAACTTGGAGCTGGGCATGG - Intronic
1187623696 X:21086593-21086615 GAGCCACCTGAACCTGGGGATGG - Intergenic
1187636937 X:21239062-21239084 GAGCCACCTGGAGCTGGGGAAGG - Intergenic
1187652876 X:21429607-21429629 AATTAACCTGAGGCTGGGCATGG + Intronic
1187672985 X:21686964-21686986 GAGGAACATGAAAGTGGACAAGG - Intergenic
1188749907 X:33892745-33892767 GAGCCACCTAAAGCTGGGAATGG + Intergenic
1188939081 X:36215407-36215429 AAGGAGCCTGAAACTGAGCATGG + Intergenic
1189295000 X:39911715-39911737 GAGGAAACTGAAGCTTAGAAAGG - Intergenic
1190311962 X:49123065-49123087 TGGGAACCTGGAGCTGGGGAAGG - Intronic
1190503804 X:51105451-51105473 GTGGAATCTGAAGTAGGGCAGGG - Intergenic
1190886285 X:54533096-54533118 GAGGAAACTGAAGCTTAGCAAGG + Intronic
1190919453 X:54838654-54838676 GAGCCACCTGAAGCTGGGGGTGG + Intergenic
1190946247 X:55096710-55096732 GAGGAATCTGAGGCTCAGCATGG + Intronic
1191716972 X:64200417-64200439 GAGGAAACTGAAGCTTGGGAGGG + Intronic
1192547152 X:72023635-72023657 GAGGAAACTGAGGCTGAGCCAGG - Intergenic
1192625709 X:72725743-72725765 AAGAACCCTGAGGCTGGGCACGG - Intergenic
1193078771 X:77383421-77383443 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
1193147379 X:78091948-78091970 GAGCCACCTAAAGCTGGGGATGG + Intronic
1193204753 X:78735731-78735753 GAGGTACCTAAAGCTGGGGGTGG + Intergenic
1194062522 X:89222135-89222157 TATGAACATGAGGCTGGGCACGG + Intergenic
1194692805 X:97008797-97008819 GAGCTACCTGGAGCTGGGGAAGG + Intronic
1195155992 X:102125503-102125525 GAGGGACCGGAGGCTGGGGACGG - Intergenic
1195971395 X:110477658-110477680 GAGCCACCTGAAGCTGGGGGTGG + Intergenic
1195988320 X:110657046-110657068 GGGCAAGCTGAAGCAGGGCAGGG + Intergenic
1197961098 X:132006848-132006870 AAGGAAACTGAAGCTCAGCAAGG - Intergenic
1198037459 X:132815398-132815420 GAGGAAACTGAAGCTGAGAGAGG + Intronic
1198128793 X:133673706-133673728 GAGGAAACTCAAGTTCGGCAAGG - Intronic
1198335838 X:135665501-135665523 GTGTGAGCTGAAGCTGGGCAGGG - Intergenic
1198889521 X:141377598-141377620 GTGGGATCTGAAGCTGGGCATGG - Intergenic
1199247787 X:145626262-145626284 GAGCCACCTGAAGCTGAGCATGG - Intergenic
1199373869 X:147084164-147084186 GAAGAACATGAAGTTTGGCAGGG + Intergenic
1199841052 X:151649449-151649471 GAGGAAACTGAGGCTGTCCAAGG - Intronic
1199851003 X:151724885-151724907 GAGGAGGCTGCAGCTGGGAAGGG + Intergenic
1199865852 X:151849256-151849278 GAGGAAGCTACAGCTGGGGAAGG + Intergenic
1200032314 X:153306689-153306711 GAGGACCCGGATGCTGGGGAGGG + Intergenic
1200180863 X:154149986-154150008 GAGGTCCTAGAAGCTGGGCATGG - Intronic
1200186506 X:154187100-154187122 GAGGTCCTAGAAGCTGGGCATGG - Intergenic
1200192158 X:154224238-154224260 GAGGTCCTAGAAGCTGGGCATGG - Intronic
1200197913 X:154262042-154262064 GAGGTCCTAGAAGCTGGGCATGG - Intronic
1200359827 X:155592896-155592918 GGGGAGTCTGAGGCTGGGCATGG - Intronic
1200370646 X:155720571-155720593 GAGCCACCTGAAGCTGGGGGTGG - Intergenic
1200820308 Y:7575888-7575910 GTGGCAGCTGAAGCAGGGCAAGG - Intergenic
1201050324 Y:9926397-9926419 GAGAAACCAGAGGCAGGGCATGG + Intergenic
1201230648 Y:11860909-11860931 GTGGCAGCTGAAGCAGGGCAAGG - Intergenic
1201421297 Y:13802574-13802596 GAGAAACTTCAGGCTGGGCATGG - Intergenic
1202177892 Y:22114409-22114431 GAGAAACCTGAAAATGGGGATGG - Intergenic
1202213469 Y:22471986-22472008 GAGAAACCTGAAAATGGGGATGG + Intergenic