ID: 1143813230

View in Genome Browser
Species Human (GRCh38)
Location 17:9489484-9489506
Sequence CTTTACATGCATAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143813230 Original CRISPR CTTTACATGCATAATTTGGT GGG (reversed) Intronic
905117000 1:35650830-35650852 CTTGACATTTATAACTTGGTGGG - Intergenic
907722743 1:56987371-56987393 CATTACATTTCTAATTTGGTTGG - Intergenic
908823517 1:68112542-68112564 CTTCACAAGCATTATTTGGGTGG - Intronic
909146726 1:71943555-71943577 CTTTACATGTAAAAATTGTTTGG - Intronic
909194871 1:72606510-72606532 CTTCACATGCATCAATTGGTCGG - Intergenic
910689700 1:89953482-89953504 GTTTTTATGGATAATTTGGTGGG - Intergenic
911798140 1:102099754-102099776 CTTTTTAGGGATAATTTGGTGGG - Intergenic
914377639 1:147086276-147086298 GTTTTCAAGGATAATTTGGTGGG + Intergenic
915881459 1:159676684-159676706 CGTTACAGGCATAAATTGGTTGG + Intergenic
916231233 1:162543525-162543547 CTTCTCAAGCATAATTTAGTGGG + Intergenic
917472113 1:175334727-175334749 GTTTTTATGGATAATTTGGTGGG - Intronic
918019909 1:180677362-180677384 GTTTATAAGGATAATTTGGTGGG + Intronic
918542188 1:185644610-185644632 TTTTGCAAGCATAGTTTGGTGGG + Intergenic
918621566 1:186611539-186611561 GTTTTTATGGATAATTTGGTGGG - Intergenic
918719952 1:187840177-187840199 GTTTTCAAGTATAATTTGGTGGG - Intergenic
919333513 1:196203032-196203054 CTTTACATGCATTATCTCTTCGG + Intergenic
919648944 1:200126162-200126184 CTTTAAAATCATAATTTGGAAGG + Intronic
921403864 1:214757510-214757532 GTTTTTATGGATAATTTGGTGGG + Intergenic
921771261 1:219042414-219042436 GTTTTTATGGATAATTTGGTGGG - Intergenic
922125553 1:222717861-222717883 CTGTATATCCAGAATTTGGTAGG - Intronic
923585596 1:235267481-235267503 CTTAAAATGCACAATTTGGTGGG + Intronic
1064501563 10:15978859-15978881 CTATACTTGCTTAATTTTGTAGG - Intergenic
1064858469 10:19797895-19797917 GTTTTTATGGATAATTTGGTGGG - Intergenic
1065469869 10:26066623-26066645 CATTACATTCCTAATTTTGTTGG - Intronic
1066733326 10:38452002-38452024 CATTATATGAATATTTTGGTAGG + Intergenic
1069267534 10:66481107-66481129 GTTTATATGTATAAATTGGTAGG + Intronic
1069323390 10:67201562-67201584 AGTTAAATGAATAATTTGGTAGG - Intronic
1071271102 10:84008455-84008477 CTTTAGTTTCATAATTAGGTTGG + Intergenic
1073864181 10:107783643-107783665 CTTACCAAGCTTAATTTGGTGGG + Intergenic
1074653899 10:115559718-115559740 CTTTTCATTCCTAATTTGTTGGG - Intronic
1075364051 10:121867060-121867082 TCTTTCATCCATAATTTGGTAGG - Intronic
1077693152 11:4367719-4367741 CATTACATGCATATTTGGCTAGG + Exonic
1080028748 11:27638579-27638601 GTTTTCAAGGATAATTTGGTGGG + Intergenic
1080216116 11:29843134-29843156 ATTTACATGTATAAAGTGGTAGG + Intergenic
1080990866 11:37533162-37533184 CTTTTTAAGGATAATTTGGTAGG + Intergenic
1081507896 11:43737164-43737186 CTTTACAGTCAGAATTTTGTGGG + Intronic
1083060367 11:59863816-59863838 CTTTGGATGCATAATTTTTTAGG + Intronic
1085489986 11:76906512-76906534 ATTTTCAAGGATAATTTGGTGGG - Intronic
1087667383 11:101066203-101066225 CTTGCCAAGAATAATTTGGTTGG - Intronic
1088101588 11:106161890-106161912 TTTTGAATGGATAATTTGGTTGG + Intergenic
1089026300 11:115274082-115274104 CTTTACCTGCAGAAGTTGGCTGG - Intronic
1089084895 11:115808650-115808672 CTTTTCAAGGATAGTTTGGTGGG + Intergenic
1090141431 11:124267976-124267998 CTTTACAAGTATATTTTTGTAGG - Intergenic
1091953799 12:4618985-4619007 CCTTTCACCCATAATTTGGTTGG - Intronic
1092678372 12:10947880-10947902 CTTAAAAAGCTTAATTTGGTTGG + Intronic
1094566448 12:31602373-31602395 CTTTACTTGCATATTTCTGTAGG - Intergenic
1094745509 12:33340315-33340337 CTTTATATGCAAATTTTGGCAGG + Intergenic
1095484149 12:42666865-42666887 CTTTACATGCAGAAGTGGGCGGG + Intergenic
1097373578 12:58814260-58814282 CCTTACATTCCTAATTTAGTGGG - Intergenic
1097395817 12:59073472-59073494 CTTTAAACGCATACTTTGGTAGG + Intergenic
1100170274 12:91967912-91967934 CAATACATGCATAATATGGCAGG + Intergenic
1100705656 12:97197574-97197596 GTTTTTATGAATAATTTGGTGGG - Intergenic
1103305044 12:119957439-119957461 CTTTTCAAGGATAGTTTGGTTGG + Intergenic
1105464821 13:20629521-20629543 CTTTAAAAGAATAATTTGCTTGG + Intronic
1107167497 13:37299588-37299610 CTTTTAAAGGATAATTTGGTGGG + Intergenic
1108315767 13:49235773-49235795 GTTTTTATGGATAATTTGGTGGG + Intergenic
1108938564 13:55918851-55918873 CTTAACATTCATAATTGTGTGGG - Intergenic
1109236154 13:59823527-59823549 CTATCCTTGCTTAATTTGGTGGG - Intronic
1109274794 13:60291462-60291484 CTTTACTTGGATCATTTGGATGG - Intergenic
1111456239 13:88487649-88487671 GTTTTTATGAATAATTTGGTGGG - Intergenic
1114343664 14:21771988-21772010 GTTTTTATGGATAATTTGGTGGG - Intergenic
1115440329 14:33427002-33427024 TTTTACAGGCATGATTTTGTAGG + Intronic
1117180085 14:53182602-53182624 GTTTATATGGACAATTTGGTGGG - Intergenic
1117249688 14:53924142-53924164 CTTTATTTGAATACTTTGGTTGG - Intergenic
1117872199 14:60212863-60212885 CTTGATTTGCATAATTTTGTGGG + Intergenic
1123854248 15:24391476-24391498 CTTTCTATGCCTAATTTGCTCGG + Intergenic
1125879260 15:43178443-43178465 CTTTAAATTCAGAATTTGGCAGG - Intronic
1126345422 15:47688857-47688879 TTTCACAAGCATATTTTGGTTGG + Intronic
1126579736 15:50231927-50231949 CTTTACATGCCCTAGTTGGTGGG - Intronic
1127041990 15:54987567-54987589 GTTTTTATGAATAATTTGGTGGG + Intergenic
1129418963 15:75407595-75407617 CTTAAAAAGCATAATTTGCTGGG + Intronic
1130851750 15:87801741-87801763 CTTTACATGCTTTATCTGGAAGG - Intergenic
1133945207 16:10342156-10342178 GTTTTAATGGATAATTTGGTGGG - Intronic
1135034461 16:19065256-19065278 TTTTTAATGGATAATTTGGTGGG + Intergenic
1140134090 16:72189824-72189846 TTTTTAATGGATAATTTGGTGGG + Intergenic
1141184154 16:81775091-81775113 CTTTACATGCATGAGTTGCATGG - Intronic
1143813230 17:9489484-9489506 CTTTACATGCATAATTTGGTGGG - Intronic
1145122367 17:20271907-20271929 ATTTTCATTCATAATTTTGTGGG + Intronic
1146292125 17:31616139-31616161 CTTCATCTTCATAATTTGGTTGG - Intergenic
1146966715 17:37037457-37037479 CTTTACTTGCATGATTTGCAGGG + Intronic
1147230522 17:39014699-39014721 GTTTTCAAGGATAATTTGGTGGG - Intergenic
1147957497 17:44144435-44144457 CTTAAAATACAAAATTTGGTCGG - Intronic
1149070965 17:52542481-52542503 ATTTACATCCTTAATTTTGTTGG + Intergenic
1149162151 17:53707137-53707159 GTTTTCATGGACAATTTGGTGGG - Intergenic
1151000543 17:70370400-70370422 GTTTTTATGGATAATTTGGTGGG + Intergenic
1152494641 17:80662430-80662452 GTTTTTATGGATAATTTGGTGGG + Intronic
1153775754 18:8451838-8451860 CATTTAATGCATAATTTTGTAGG - Intergenic
1155263775 18:24072119-24072141 TTTTACATGGATAATTTTCTTGG + Intronic
1156139771 18:34093102-34093124 ATTTAAATGCTTAATTTAGTCGG + Intronic
1156300154 18:35829277-35829299 GTTTTTAAGCATAATTTGGTAGG + Intergenic
1156590899 18:38486970-38486992 CTTTACATGCAAAAATTCTTTGG - Intergenic
1156727295 18:40144467-40144489 CTTGATTTGCATAATTTTGTGGG + Intergenic
1158780049 18:60637838-60637860 GTTTTCAAGTATAATTTGGTAGG + Intergenic
1159490867 18:69132784-69132806 TTTTACAAGAATAGTTTGGTGGG + Intergenic
1159798349 18:72868666-72868688 CTTTGCAGGAGTAATTTGGTGGG - Intergenic
1160525981 18:79537615-79537637 CTTTACATGCATGTATTTGTGGG + Intergenic
1165126508 19:33601651-33601673 TTTTAAAAGGATAATTTGGTGGG - Intergenic
1165192430 19:34076271-34076293 TTTTTCATGTATAGTTTGGTGGG - Intergenic
1165300742 19:34966980-34967002 GTTTTCAGGGATAATTTGGTGGG - Intergenic
1167760857 19:51448016-51448038 TTTTACATGGCTAATTTGGCTGG - Intergenic
928671969 2:33611513-33611535 GTTTAAAAGGATAATTTGGTGGG - Intergenic
928752000 2:34481584-34481606 CTTTACTCCCCTAATTTGGTTGG + Intergenic
929041134 2:37745867-37745889 TTTGAGATGCATAATTTAGTTGG + Intergenic
930224711 2:48780501-48780523 TTTAAAATGTATAATTTGGTGGG - Intergenic
930983079 2:57551371-57551393 GTTTTAATGGATAATTTGGTGGG - Intergenic
931982389 2:67707773-67707795 CTTTTCATGTTTAAGTTGGTTGG + Intergenic
933983462 2:87572348-87572370 CTTTCCCTGCATGATTTGATGGG - Intergenic
935162516 2:100541520-100541542 CTTTTTAAGAATAATTTGGTGGG + Intergenic
936034124 2:109096997-109097019 GTTTTTATGTATAATTTGGTGGG - Intergenic
936310387 2:111378446-111378468 CTTTCCCTGCATGATTTGATGGG + Intergenic
936748149 2:115605828-115605850 CTTTGCATTCATAATATTGTTGG - Intronic
936891025 2:117370501-117370523 GTTTTCAAGGATAATTTGGTGGG + Intergenic
937640706 2:124207779-124207801 CTGTTCATGCATAATTTGAAGGG + Intronic
939042597 2:137208641-137208663 TTTTTCAAGGATAATTTGGTGGG + Intronic
939759773 2:146160417-146160439 CTTTAAATGTATAATTTGGGAGG - Intergenic
940852984 2:158705734-158705756 GTTTTTATGGATAATTTGGTGGG + Intergenic
941717752 2:168781553-168781575 TTTTTCAAGAATAATTTGGTGGG + Intergenic
942244364 2:173993337-173993359 CTAAATATGCAGAATTTGGTGGG + Intergenic
942856270 2:180553110-180553132 CTTTTTATGCATAATTTTCTTGG - Intergenic
942899976 2:181103732-181103754 CTTTAAATGGAAAATTTGGAGGG + Intergenic
942943840 2:181651488-181651510 CTTTCCATACCTAATTTGTTGGG - Intronic
943974545 2:194456512-194456534 CTTAATATGCATATTTTGTTAGG - Intergenic
944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG + Intronic
944996829 2:205303549-205303571 CTGTACTTGCATCATTTGGAGGG - Intronic
946095138 2:217268041-217268063 CTTTTTATGGAAAATTTGGTGGG - Intergenic
1170338584 20:15298249-15298271 CTTTACATGCATTATCTCATAGG - Intronic
1170979979 20:21203268-21203290 ATTTACATGCTCTATTTGGTTGG + Intronic
1176518560 21:7806528-7806550 CTTCACAGGAATAATTTGGAAGG - Intergenic
1177260367 21:18722031-18722053 CTTTTCAAGGATAGTTTGGTGGG - Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1178652588 21:34436541-34436563 CTTCACAGGAATAATTTGGAAGG - Intergenic
1178775036 21:35541844-35541866 CTTAGCATGCACAATTTGCTGGG - Intronic
1183190045 22:36316380-36316402 CTTTGCATGAAGACTTTGGTTGG - Intronic
1185195787 22:49468532-49468554 CTTTCCTGGCATAATTTGCTGGG + Intronic
1203293403 22_KI270736v1_random:17437-17459 TTTGAGATGCATAATTTAGTTGG + Intergenic
949674143 3:6433502-6433524 ATATACATGCAGAATTTGTTTGG - Intergenic
949811562 3:8012184-8012206 GTTTTCAAGGATAATTTGGTGGG - Intergenic
950379195 3:12596621-12596643 CTTTACTTCCATAAGTGGGTGGG + Intronic
951083528 3:18481902-18481924 TTTTAATTGCATAATTTGGTAGG + Intergenic
951297544 3:20957485-20957507 TTTTTAATGTATAATTTGGTAGG + Intergenic
952003719 3:28816897-28816919 TTTTCCATGCATTTTTTGGTAGG + Intergenic
952119814 3:30228896-30228918 CTTTACATGTATAACTTTCTTGG - Intergenic
952270819 3:31829775-31829797 ATTTACATCCATATTTTTGTAGG + Intronic
954823731 3:53353057-53353079 GTTTTTATGGATAATTTGGTGGG + Intergenic
955858209 3:63297712-63297734 GTTTTTATGAATAATTTGGTGGG + Intronic
956694322 3:71905752-71905774 CCTTAGATCCATAATTTGGTTGG + Intergenic
956915522 3:73867159-73867181 TTTTGCAAGCATAATGTGGTAGG - Intergenic
958510740 3:95044865-95044887 CAATGCATGGATAATTTGGTAGG - Intergenic
958566315 3:95815922-95815944 GTTTTCAAGGATAATTTGGTGGG + Intergenic
958994538 3:100888425-100888447 CTAGAGATGCATAATTTTGTTGG - Intronic
959151899 3:102617989-102618011 TTTTATATGGACAATTTGGTGGG + Intergenic
959639085 3:108611313-108611335 CGTTACCTGCATAGTTTGGAAGG - Exonic
960842444 3:121973901-121973923 CTTTCCAAGGATAGTTTGGTGGG - Intergenic
962288107 3:134105604-134105626 CTTTACTTCTATGATTTGGTGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963089883 3:141473885-141473907 CTTGAGATGCATCATTAGGTTGG + Intergenic
963840935 3:150105711-150105733 CTTTGTATGCATAATGGGGTTGG + Intergenic
963873133 3:150441591-150441613 CTCTACATAAATAATTTGCTGGG + Intronic
964220855 3:154343183-154343205 CTATACATGCTTAATTTTCTGGG - Intronic
964563009 3:158019193-158019215 CTTTACATTCTTACTTTTGTAGG - Intergenic
965873315 3:173286431-173286453 ATTTATATGCATAAGTTGTTTGG - Intergenic
966589026 3:181659583-181659605 CTTTACTTCCATAATCTGTTCGG + Intergenic
967603668 3:191418316-191418338 CTTTACATTCACAACTTGGCTGG - Intergenic
970366931 4:15368909-15368931 CTTTACATTCACCATTTGGTTGG - Intronic
970403670 4:15741920-15741942 CTCCAGATGCATAATATGGTTGG + Intergenic
970723016 4:19009886-19009908 GTTTTCAAGGATAATTTGGTGGG + Intergenic
971218427 4:24683167-24683189 TTTTTCAGGCATAGTTTGGTGGG + Intergenic
973095163 4:46188389-46188411 CTTTTCATGCATAATTTCTTTGG - Intergenic
974386851 4:61211682-61211704 CTTGATTTGCATAATTTTGTTGG - Intronic
976998933 4:91470842-91470864 CTGTGCATACATAATTTTGTGGG - Intronic
977398059 4:96496262-96496284 ATTTACTTTTATAATTTGGTGGG - Intergenic
978392871 4:108245790-108245812 CTTACCATGCATAATTTGCAAGG - Intergenic
979162184 4:117475982-117476004 CTTTAGATAAATAATTTAGTAGG - Intergenic
979458597 4:120953889-120953911 GTTTTTATGGATAATTTGGTGGG - Intergenic
979639507 4:122997178-122997200 CTTTAAATGAATAAATTGTTTGG - Intronic
981251820 4:142612024-142612046 GTTTACATGCATTATTTTTTTGG + Intronic
981536941 4:145809835-145809857 TTTTTTATGGATAATTTGGTGGG - Intronic
981655656 4:147110042-147110064 CTTTACATGTATTATTAGGTTGG + Intergenic
982526520 4:156485612-156485634 CTTTACATGCAGTATTCTGTGGG - Intergenic
982809918 4:159812210-159812232 CTGAACTTGCAGAATTTGGTTGG - Intergenic
983154453 4:164329003-164329025 CATTACATGTATACTTAGGTTGG - Intronic
983827007 4:172275526-172275548 CTTTACATGTATTAATTGATTGG - Intronic
987035725 5:14016505-14016527 CTTTACTTTCATAATTTTGGGGG + Intergenic
987456549 5:18154402-18154424 TTTTTCAAGCATAGTTTGGTTGG + Intergenic
987491207 5:18582419-18582441 TTTTTCAAGGATAATTTGGTGGG + Intergenic
988904143 5:35768568-35768590 CTTTACATACATTATTTCATTGG - Intronic
989409705 5:41104671-41104693 CTTTACCTTCTTATTTTGGTGGG + Intergenic
989618370 5:43359966-43359988 GTTTTTATGGATAATTTGGTGGG - Intergenic
990287017 5:54310427-54310449 CTGTACATGGATTATCTGGTAGG - Exonic
990996350 5:61735985-61736007 CTTTGCATAAATAACTTGGTTGG - Intronic
991997350 5:72401020-72401042 GTTTACAAGGATAATTTGGTGGG - Intergenic
992539667 5:77751816-77751838 GTTTCTATGAATAATTTGGTGGG + Intronic
992991562 5:82289000-82289022 TTTTGCATGCTTATTTTGGTAGG - Intronic
993154422 5:84204766-84204788 CTTTACAAGCATAAGTTAATTGG + Intronic
993352581 5:86868356-86868378 TTTTAAATGAATAATTTGCTGGG + Intergenic
994756675 5:103801575-103801597 CTTACCATGGATAATTGGGTTGG + Intergenic
994824916 5:104700338-104700360 TTTTACATGCATACCTTAGTAGG + Intergenic
994903258 5:105803379-105803401 GTTTTCATGGATAATTTGGCAGG + Intergenic
996132518 5:119798767-119798789 GTTTTTAAGCATAATTTGGTGGG - Intergenic
996787372 5:127255012-127255034 GTTTGTATGGATAATTTGGTGGG + Intergenic
1000405989 5:160889057-160889079 ATTTACATGCTTAATATGATGGG + Intergenic
1000718610 5:164678699-164678721 CTTTTCAAGGATAGTTTGGTGGG + Intergenic
1000847865 5:166304090-166304112 GTTTTTATGGATAATTTGGTGGG + Intergenic
1002157187 5:177292256-177292278 CTTTCCATGCATAATTTTGAGGG + Intronic
1004604349 6:17179778-17179800 TTTTACAAGGATAGTTTGGTAGG + Intergenic
1008103347 6:47416379-47416401 GTTTTTATGGATAATTTGGTGGG + Intergenic
1010013195 6:71073792-71073814 ATTTACTTATATAATTTGGTGGG + Intergenic
1010063757 6:71655979-71656001 CATTACATTCAGAAATTGGTGGG + Intergenic
1010855855 6:80838017-80838039 CTTTACATGAATCATTTCATAGG + Intergenic
1011680412 6:89777856-89777878 GTTTTTATGGATAATTTGGTGGG - Intronic
1011894072 6:92201899-92201921 TTTTGTATGGATAATTTGGTAGG - Intergenic
1012321408 6:97851516-97851538 CTCTACATGCAGAATTTACTTGG + Intergenic
1012853270 6:104471860-104471882 GTTTTCATGCCTGATTTGGTAGG - Intergenic
1014145610 6:117994741-117994763 ACTGACATGAATAATTTGGTGGG + Intronic
1016941952 6:149489708-149489730 CTTTTCTTGCATATCTTGGTAGG + Intergenic
1017143558 6:151213644-151213666 GTTTTAATGAATAATTTGGTGGG - Intergenic
1018408294 6:163511295-163511317 CTTTAAATGTTTAATTAGGTAGG - Intronic
1018636694 6:165867067-165867089 ATTTACCTTTATAATTTGGTGGG - Intronic
1021314872 7:19136180-19136202 CTTTTCCTCCATGATTTGGTAGG - Intergenic
1021856821 7:24865211-24865233 CTTTACAAGCAAAATATGGAAGG + Intronic
1022067837 7:26878673-26878695 CTTTAAAAACATAATTTAGTAGG - Intronic
1024217821 7:47262917-47262939 CTTCACAACCATTATTTGGTTGG + Intergenic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1024745703 7:52403433-52403455 CTTTCCAAGAATTATTTGGTTGG - Intergenic
1024793265 7:52991611-52991633 CTTGACCTGCATAATTTGTCAGG - Intergenic
1024875468 7:54017680-54017702 CTTTACATGCATAGGTGAGTGGG + Intergenic
1025626525 7:63227239-63227261 GTTTTCATGGATAATTTGGCCGG - Intergenic
1026967938 7:74452342-74452364 GTTTTTATGGATAATTTGGTGGG + Intergenic
1028248415 7:88511060-88511082 TTTTTCAAGGATAATTTGGTGGG + Intergenic
1030713032 7:112775170-112775192 CTGTACCTGCAGAAGTTGGTGGG + Exonic
1033005974 7:137562943-137562965 CTTTTCTTGCATAATTTGATTGG - Intronic
1034968686 7:155406430-155406452 TTTTACATGCATAATTGCCTGGG - Intergenic
1035860131 8:3019522-3019544 AGTTACTTGCATAATTTGTTGGG + Intronic
1039679837 8:39720413-39720435 CTTTAAGTGCATAATTTGATAGG - Intronic
1039988293 8:42466380-42466402 CTTTAAATGCATAATCTGGCCGG - Intronic
1041177657 8:55213244-55213266 TTTTCGAAGCATAATTTGGTGGG + Intronic
1042444636 8:68870198-68870220 GTTTTCATGAATAATTTGGTGGG + Intergenic
1042947978 8:74174000-74174022 GTTTTCATGGATAACTTGGTGGG + Intergenic
1043522381 8:81060084-81060106 ATTTACTTGCTTAATTTGGATGG - Intronic
1043710606 8:83412789-83412811 CTATACATGCATAATGTTATTGG + Intergenic
1044233167 8:89802000-89802022 GTTTTTATGGATAATTTGGTGGG - Intergenic
1045207923 8:100062397-100062419 CTTTAAATCCATAATAAGGTGGG - Intronic
1046164847 8:110418979-110419001 GTTTTTATGGATAATTTGGTGGG - Intergenic
1046321991 8:112590932-112590954 CTTTACATTTATTATTTTGTAGG - Intronic
1047742228 8:127815823-127815845 CCTTACATCTATAATTTTGTAGG - Intergenic
1048015543 8:130493296-130493318 CATTACAAGCATAATTTGTGTGG + Intergenic
1048043823 8:130754901-130754923 TTTTTCAAGGATAATTTGGTGGG - Intergenic
1050104851 9:2155107-2155129 CTTCACATTTATAATTTGGTAGG + Intronic
1050376927 9:4984183-4984205 CTTTAAATGCATAATGTGCGGGG - Intergenic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1051631097 9:19141635-19141657 GTTTTCAAGCACAATTTGGTGGG - Intronic
1052551730 9:29959313-29959335 CTGTACATGCAGAGTTGGGTGGG - Intergenic
1052623837 9:30948742-30948764 CTTTAGATGCCTATTTTGATTGG + Intergenic
1055813822 9:80181893-80181915 TTTTACAAGGATCATTTGGTGGG - Intergenic
1057129554 9:92643819-92643841 AATTACATGCATATTTTTGTGGG + Intronic
1057695148 9:97317883-97317905 CTTTCCATGCAGTATCTGGTTGG - Intronic
1057920008 9:99089619-99089641 GTTTTCATGGATAATTTTGTGGG + Intergenic
1059883458 9:118718135-118718157 CTTTACAAGCATGATATGATTGG - Intergenic
1059914957 9:119088832-119088854 CTTTGTATGTATAATTTGATTGG - Intergenic
1186841602 X:13489746-13489768 GTTTTTATGAATAATTTGGTGGG - Intergenic
1188291430 X:28393395-28393417 CTTTGCATACATAACTTGGTTGG + Intergenic
1189888500 X:45575153-45575175 GTTTACCTTCATGATTTGGTGGG + Intergenic
1190439682 X:50464806-50464828 CTTAACATACACAATTTTGTGGG + Intronic
1192712823 X:73609375-73609397 CTTTCCATTCCTAATTTGTTTGG + Intronic
1194073730 X:89361617-89361639 GTTTATAAGGATAATTTGGTGGG + Intergenic
1194138562 X:90178813-90178835 CTTTTCATGCATGCTTAGGTTGG - Intergenic
1194412595 X:93575491-93575513 CTTTACCTGCATTATTTTCTGGG - Intergenic
1194461000 X:94167716-94167738 CTTTAAATGCATTATTTTATTGG - Intergenic
1194577146 X:95627150-95627172 CTTTTTAAGGATAATTTGGTGGG - Intergenic
1194784172 X:98061955-98061977 CTTTACCTGCGTAACTTAGTGGG - Intergenic
1195430058 X:104779095-104779117 CTTTAGATGCATCAGTTGGGTGG - Intronic
1195484903 X:105393149-105393171 TTTTTCAAGGATAATTTGGTGGG + Intronic
1195610015 X:106855772-106855794 CTTTTGAAGCATAATTTGGCAGG - Intronic
1195935147 X:110118279-110118301 CTTTTCATCCATAGTTTGGTTGG + Intronic
1196333683 X:114503884-114503906 CTTTCCGTGCATAGTTTGTTGGG - Intergenic
1196785435 X:119417704-119417726 CTATATATGCATTATTTGGAAGG - Intronic
1197836823 X:130703635-130703657 CTTTACATGCATAAGTAGTTTGG - Intronic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200484363 Y:3749048-3749070 CTTTTCATGCATGCTTAGGTTGG - Intergenic
1200729111 Y:6713175-6713197 GTTTATAAGGATAATTTGGTGGG + Intergenic