ID: 1143815202 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:9507146-9507168 |
| Sequence | GTTTCATAGATCCGGGATGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 51 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 47} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1143815202_1143815212 | 26 | Left | 1143815202 | 17:9507146-9507168 | CCTGCATCCCGGATCTATGAAAC | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||
| Right | 1143815212 | 17:9507195-9507217 | CATGCCCCCGGCCTGCCCAAAGG | 0: 1 1: 0 2: 4 3: 14 4: 186 |
||||
| 1143815202_1143815207 | 14 | Left | 1143815202 | 17:9507146-9507168 | CCTGCATCCCGGATCTATGAAAC | 0: 1 1: 0 2: 0 3: 3 4: 47 |
||
| Right | 1143815207 | 17:9507183-9507205 | GCCCCCTACAGACATGCCCCCGG | 0: 1 1: 0 2: 1 3: 15 4: 161 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1143815202 | Original CRISPR | GTTTCATAGATCCGGGATGC AGG (reversed) | Intronic | ||