ID: 1143815202

View in Genome Browser
Species Human (GRCh38)
Location 17:9507146-9507168
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143815202_1143815212 26 Left 1143815202 17:9507146-9507168 CCTGCATCCCGGATCTATGAAAC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1143815212 17:9507195-9507217 CATGCCCCCGGCCTGCCCAAAGG 0: 1
1: 0
2: 4
3: 14
4: 186
1143815202_1143815207 14 Left 1143815202 17:9507146-9507168 CCTGCATCCCGGATCTATGAAAC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1143815207 17:9507183-9507205 GCCCCCTACAGACATGCCCCCGG 0: 1
1: 0
2: 1
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143815202 Original CRISPR GTTTCATAGATCCGGGATGC AGG (reversed) Intronic