ID: 1143815212

View in Genome Browser
Species Human (GRCh38)
Location 17:9507195-9507217
Sequence CATGCCCCCGGCCTGCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143815204_1143815212 19 Left 1143815204 17:9507153-9507175 CCCGGATCTATGAAACAGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1143815212 17:9507195-9507217 CATGCCCCCGGCCTGCCCAAAGG 0: 1
1: 0
2: 4
3: 14
4: 186
1143815206_1143815212 18 Left 1143815206 17:9507154-9507176 CCGGATCTATGAAACAGTCGGGC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1143815212 17:9507195-9507217 CATGCCCCCGGCCTGCCCAAAGG 0: 1
1: 0
2: 4
3: 14
4: 186
1143815202_1143815212 26 Left 1143815202 17:9507146-9507168 CCTGCATCCCGGATCTATGAAAC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1143815212 17:9507195-9507217 CATGCCCCCGGCCTGCCCAAAGG 0: 1
1: 0
2: 4
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143815212 Original CRISPR CATGCCCCCGGCCTGCCCAA AGG Intronic