ID: 1143815807

View in Genome Browser
Species Human (GRCh38)
Location 17:9513662-9513684
Sequence CTTTGGATAAGTGCCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 7, 3: 40, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143815807 Original CRISPR CTTTGGATAAGTGCCCAGTA GGG (reversed) Intronic
902894511 1:19469688-19469710 CTTGAGATAAGTCCCCAGGAGGG - Intronic
906572168 1:46852118-46852140 CTTTGGGTATATACCCAGTAAGG - Intergenic
910496761 1:87838315-87838337 CTTTGGGTATATACCCAGTAAGG - Intergenic
910608445 1:89113177-89113199 CTTTTTAGAAGTGCTCAGTAAGG + Intronic
910941139 1:92535399-92535421 CTTTGGGTATATACCCAGTAAGG - Intronic
911338761 1:96612230-96612252 CTTTGGGTATATACCCAGTAAGG + Intergenic
911724808 1:101232202-101232224 CTTTGGGTATATACCCAGTAAGG - Intergenic
912034228 1:105291151-105291173 CTTTGGATATATACCCAGTAAGG + Intergenic
912743736 1:112226916-112226938 CTTTGGGTATATACCCAGTATGG - Intergenic
912926702 1:113919342-113919364 CTTTGAATATATGCCCAGAATGG - Intergenic
913373405 1:118125873-118125895 CTTTGGATAAATACCTAATAGGG + Intronic
915151526 1:153836144-153836166 CTTTAGAAAAGTACACAGTAAGG + Intronic
916635748 1:166666810-166666832 CTTTGGGTATATACCCAGTAAGG - Intergenic
917323648 1:173810001-173810023 CTTTGGGTATATACCCAGTAAGG - Intronic
918832044 1:189411135-189411157 CTTTGGGTATATACCCAGTAAGG + Intergenic
919361115 1:196596231-196596253 CTTTGAGTAGGTACCCAGTATGG + Intronic
920594233 1:207252469-207252491 TTTTGGGTATGTGCCCAGCAGGG + Intergenic
920642874 1:207770902-207770924 CTTTGGGTATATACCCAGTAAGG + Intronic
922713688 1:227853548-227853570 CCTTGGATAAATGCCTTGTATGG - Intergenic
923066449 1:230521686-230521708 CTTTGGCTATATACCCAGTATGG + Intergenic
923238749 1:232060185-232060207 CTTTGGACAACTGCCCAGAGTGG - Intergenic
924575216 1:245274729-245274751 CTTTGGGTATATACCCAGTAAGG + Intronic
924575229 1:245274824-245274846 CTTTGGGTATATACCCAGTAAGG + Intronic
1062869361 10:886438-886460 CTTTGGATAAATACTCAGAAAGG - Intronic
1063250995 10:4274688-4274710 CTTTGGGTATATACCCAGTAAGG - Intergenic
1065561263 10:26966123-26966145 CTTTGGATATATACCCAGAAAGG - Intergenic
1068041760 10:51834181-51834203 CTTTGGAAAAGAGGCCATTATGG - Intronic
1068050296 10:51941951-51941973 CTTTGGGTATATACCCAGTAAGG + Intronic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1072384661 10:94912289-94912311 CTTTGGCTATATACCCAGTAAGG - Intergenic
1073821828 10:107273040-107273062 CTTTGGATATATACTCAGTAGGG + Intergenic
1075814101 10:125251195-125251217 CTTTGGGTATCTACCCAGTAAGG + Intergenic
1076981312 11:206441-206463 CTTGGGAAAAGTACCCAGCAAGG + Intronic
1077449939 11:2634679-2634701 CTTTGGGTATATACCCAGTAAGG + Intronic
1078152110 11:8768105-8768127 ACTTGGATAAGTGCCCAGCCTGG - Intronic
1078389593 11:10925442-10925464 CTTGGGATAAATGCCGAGCATGG + Intergenic
1079182109 11:18202831-18202853 TCTAGGATAAATGCCCAGTATGG + Intronic
1082151084 11:48739512-48739534 CTTTGGGTATATACCCAGTACGG - Intergenic
1082793226 11:57361789-57361811 CTTTGGGTATATACCCAGTAAGG + Intronic
1083106913 11:60367114-60367136 GTTTGTGTATGTGCCCAGTAAGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1086513093 11:87581827-87581849 CTTTGGATATGTACTGAGTAGGG + Intergenic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1087694855 11:101364978-101365000 CTTTGGGTATATGCCCAGTAAGG + Intergenic
1088403850 11:109450251-109450273 CTTTGGGTACATACCCAGTAAGG - Intergenic
1092639410 12:10487298-10487320 CTTTGGGTATATACCCAGTAAGG - Intergenic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1093064071 12:14638357-14638379 CTTTGGATAAATACTCAGCAGGG - Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1093965039 12:25315433-25315455 CTCTGGGTAGGTACCCAGTAGGG - Intergenic
1094742108 12:33301715-33301737 CTTTGGGTATATACCCAGTAGGG + Intergenic
1094808285 12:34111163-34111185 CTTGGCAGAAATGCCCAGTAGGG + Intergenic
1095258986 12:40076653-40076675 CTTTGGGTATATACCCAGTAAGG + Intronic
1095519507 12:43045935-43045957 CTTTGGATATGTATCCAATAAGG - Intergenic
1095635609 12:44429632-44429654 CTGAGGATAAGTGGCCAGTGAGG + Intergenic
1096204015 12:49706814-49706836 CTTAGGAGAAGTCCCCAGTTCGG - Intronic
1097312439 12:58134997-58135019 CTTTGGAGAAATTCCAAGTATGG - Intergenic
1097634706 12:62108486-62108508 CTTTGGGTACATACCCAGTAAGG + Intronic
1097650895 12:62296228-62296250 CTTCAGATAAGAGCCCAGCAGGG + Intronic
1099398125 12:82167444-82167466 CTTTGAATATATACCCAGTAAGG - Intergenic
1100173213 12:92000962-92000984 CTTTGGATAATTGCCCAGTAGGG - Intronic
1100948521 12:99817514-99817536 TTTTGGATATGTACCCAGCAGGG + Intronic
1105612649 13:21982476-21982498 CTTGAGAGAAATGCCCAGTACGG - Intergenic
1106433157 13:29701514-29701536 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1106905229 13:34400838-34400860 CTTTGGATACATGCCCAGTAGGG - Intergenic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109897043 13:68706407-68706429 CTTTGGATATATACCCAGTAAGG + Intergenic
1111922799 13:94430301-94430323 CTTTGGGTAGATGCCGAGTAGGG - Intergenic
1112713557 13:102158161-102158183 CTTTGGGTATATACCCAGTAAGG - Intronic
1114889425 14:26898872-26898894 CCTTGGATAAGAGTCCAGTGGGG + Intergenic
1115669108 14:35588744-35588766 CTCTGGATATATACCCAGTAGGG - Intronic
1115724982 14:36203936-36203958 TTTTGGATAAATACCCAGAATGG - Intergenic
1116672740 14:47864088-47864110 CTTTGTAAAGATGCCCAGTAAGG + Intergenic
1117030392 14:51663254-51663276 CTTTGGGTATATACCCAGTAGGG - Intronic
1117552041 14:56846365-56846387 CTTTGGATAAGCACCCACAAAGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1119510722 14:75208955-75208977 CTCTAGATAAGAGCCCAGTGTGG + Intergenic
1120282965 14:82462900-82462922 CTTTGGGTATATGCCCAGAAGGG - Intergenic
1121987558 14:98522677-98522699 CTTTGAATATGTACCCAGCAGGG + Intergenic
1122781970 14:104147519-104147541 CTTTGGAGAGGTGCCCAGCTGGG + Intronic
1123228705 15:17079186-17079208 CTTTGGGTATATACCCAGTAAGG - Intergenic
1123508190 15:20967220-20967242 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123565410 15:21540967-21540989 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123601675 15:21978257-21978279 CTTTGGATATATGCCCAGAAGGG + Intergenic
1124066647 15:26350515-26350537 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1125686248 15:41564990-41565012 CTCAGAATCAGTGCCCAGTAGGG - Intronic
1127369391 15:58323261-58323283 TTTTGGATATATACCCAGTAAGG + Intronic
1127764483 15:62171790-62171812 CTTAGAATAGGTGCCCATTAAGG - Intergenic
1128238252 15:66081905-66081927 CTTTAGATCAGTGCCCTCTAAGG - Intronic
1128843330 15:70868322-70868344 GCTTGGATACGTACCCAGTAGGG + Intronic
1128926914 15:71664994-71665016 CTTTGGGTATATACCCAGTAAGG + Intronic
1129270242 15:74415746-74415768 CATTGGTTCAGTGTCCAGTAGGG - Intronic
1129693524 15:77727682-77727704 CCATGTATAAGTGCACAGTAAGG - Intronic
1130363918 15:83215673-83215695 CTTTGGGTATATACCCAGTAAGG + Intergenic
1202973782 15_KI270727v1_random:268057-268079 CTTTGGATATATGCCCAGAAGGG + Intergenic
1134769262 16:16792107-16792129 CTTTGGGTATATACCCAGTAGGG - Intergenic
1137082431 16:36077432-36077454 CTTTGGGTATATACCCAGTAAGG - Intergenic
1138725231 16:59130079-59130101 CTTTGGATATAAACCCAGTAGGG + Intergenic
1142501100 17:333698-333720 CTTAGGATAAGTTCCCAAAAGGG + Intronic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1144055839 17:11539827-11539849 CTTTGGCACAGTGCCCAGTCAGG - Intronic
1144612083 17:16729091-16729113 CTTTGGGTAGATGCCCAGTAGGG + Intronic
1144900651 17:18586291-18586313 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1145131800 17:20359448-20359470 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1146423724 17:32715303-32715325 CTTTGGGTATATACCCAGTAAGG - Intronic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1149083071 17:52681155-52681177 CCTTGGTTCAGTGCCTAGTATGG + Intergenic
1150353960 17:64467515-64467537 CTTAGGATATGTGACCAGCAAGG - Intronic
1150784521 17:68151802-68151824 GTTTGGATAATTGCTCAGCAAGG + Intergenic
1150944824 17:69733596-69733618 TTTTGCATTTGTGCCCAGTAGGG + Intergenic
1154396148 18:13991221-13991243 ATTTGGATAAATACCCAGTATGG - Intergenic
1155335485 18:24760381-24760403 CTTTGGTTACATACCCAGTAAGG - Intergenic
1155395773 18:25385428-25385450 CTTTGGGTATACGCCCAGTATGG - Intergenic
1156887913 18:42156841-42156863 CTTTGGGTCTCTGCCCAGTATGG + Intergenic
1157018578 18:43750433-43750455 CTTTGGGTATATACCCAGTAAGG + Intergenic
1157473268 18:48006033-48006055 ATTTGGATATATACCCAGTAAGG + Intergenic
1158746881 18:60210372-60210394 GTTTGGATATGTGCTCACTAAGG + Intergenic
1158793969 18:60818763-60818785 CTTTGGGTATATACCCAGTAAGG + Intergenic
1161537583 19:4829680-4829702 GTTTAGATCAGTGCCCAGCAAGG + Intronic
1165269648 19:34694851-34694873 CTTTGCATAAATGTCCAGCAGGG - Intergenic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
925354208 2:3226140-3226162 CTTTGGATATATACCCAGAATGG + Intronic
925376912 2:3392822-3392844 CTTTGGATACATACCCAGAATGG - Intronic
925720778 2:6824547-6824569 CTTTGGGTATATACCCAGTAAGG - Intergenic
926308918 2:11660338-11660360 CTCTGGATAAGTGTCCACTCTGG + Intronic
929286557 2:40141517-40141539 CTTTGGAGAACTCCCCAGTGAGG + Intronic
930239185 2:48918260-48918282 CTTTGGGTATATACCCAGTATGG + Intergenic
931307092 2:61040227-61040249 CTTTGGATATATACCCAGTAAGG - Intronic
931420880 2:62126271-62126293 CTTTGGGTATATACCCAGTAAGG + Intronic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
933001919 2:76936079-76936101 CTTTGGGTATATACCCAGTATGG - Intronic
935439853 2:103079937-103079959 CTTTGGGTAAATTCCCAGTAGGG - Intergenic
935604823 2:104960027-104960049 CTTTGGAGAAATGCCCATTTAGG + Intergenic
937860408 2:126703771-126703793 CATTGCACAGGTGCCCAGTATGG - Intergenic
939837351 2:147147163-147147185 CTTTGGGTATATACCCAGTAAGG + Intergenic
940669170 2:156646563-156646585 CTTTGGGTAAATATCCAGTATGG - Intergenic
942400505 2:175596923-175596945 TTTTGGATATGTACCCAGTAAGG + Intergenic
942672851 2:178395050-178395072 CCTTGGACATGGGCCCAGTAGGG + Intronic
943138261 2:183943557-183943579 TTTTGAATAAATACCCAGTAGGG - Intergenic
943506447 2:188765978-188766000 ATTTGGAAAACTACCCAGTAGGG + Intronic
943592786 2:189819381-189819403 CTTTGGGTAGATACCCAGTAGGG + Intronic
944359507 2:198836381-198836403 CTTTGGGTATATGCCCAGAAGGG - Intergenic
947240608 2:227990157-227990179 TTTTGGATAAGTGCCCAGTCAGG + Intronic
947376368 2:229500522-229500544 CTTTGGATATATATCCAGTAGGG - Intronic
948493328 2:238328086-238328108 TTTTGGATAAATACCCAGAAGGG + Intronic
1170093551 20:12619703-12619725 CTTTGGGTAAATACCCATTAAGG - Intergenic
1171185651 20:23122445-23122467 CTTTGGAGCACTGCCCAGTTGGG + Intergenic
1171999480 20:31761755-31761777 TTTTGGATATATACCCAGTAGGG + Intronic
1173707969 20:45127022-45127044 TTTTGGATAAATACCCAGAAGGG + Intergenic
1177348401 21:19901776-19901798 CTTTGGGTATATACCCAGTAAGG + Intergenic
1184315173 22:43682285-43682307 CTTAGCCTAAGTGCCCAGCACGG + Intronic
949151478 3:773058-773080 CTTTGGGTATATACCCAGTAAGG + Intergenic
949301128 3:2585330-2585352 CCTTGGGTATATGCCCAGTAAGG - Intronic
949401729 3:3671833-3671855 CTTTGGGTATATACCCAGTAAGG + Intergenic
950092966 3:10310124-10310146 CTTTGGAGAAATGACCAGGAGGG - Intronic
950475728 3:13213890-13213912 CTGTGGATACGAGCCCAGGATGG - Intergenic
951030183 3:17872843-17872865 CTTTGGGTAGATGCCCAGTAGGG + Intronic
951153915 3:19325825-19325847 CTTTGGGTATGTACTCAGTAAGG - Intronic
951774170 3:26290325-26290347 CCTTGAACAAGTGCCCAATAAGG - Intergenic
954294283 3:49665525-49665547 CCTTGGAGAAGAGCCCAGCACGG + Intronic
954487231 3:50863961-50863983 CTTTGGATATGTACCAAGCAGGG + Intronic
954949272 3:54455094-54455116 CTTTGGATATATACCCAGTAGGG + Intronic
956357767 3:68412876-68412898 CTTTGGGTATATACCCAGTAAGG + Intronic
957111714 3:75969416-75969438 CTTTGGGTATGTACCCAGCAGGG + Intronic
957530203 3:81431169-81431191 CTTTGGGTATATACCCAGTAAGG - Intergenic
958423547 3:93955217-93955239 CTTTGGGTATATACCCAGTAAGG - Intronic
958593049 3:96184652-96184674 TTTTGGATAAATACCCAGAATGG - Intergenic
959494363 3:107032188-107032210 CTTTGGGTATATACCCAGTAAGG - Intergenic
960251760 3:115463421-115463443 CTTTGGGTATATACCCAGTAAGG - Intergenic
960492107 3:118329851-118329873 CTTTGGATATATACCCAGAATGG - Intergenic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
960772273 3:121207974-121207996 CTTTGGGTATATACCCAGTAAGG - Intronic
961122643 3:124385806-124385828 AATTGAATAAGTGGCCAGTAAGG + Intronic
961221474 3:125204223-125204245 CTTTGGATAAGTACCCACAGTGG - Intronic
961400280 3:126636352-126636374 CTTTGGATCAGTGCACACAAAGG - Intronic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962586387 3:136846511-136846533 CATGGGGTAAGTGCCCACTAAGG - Intronic
962911052 3:139850035-139850057 CTTTGGATATATACCCAGTAAGG + Intergenic
963695269 3:148559416-148559438 CTTTGGGTATATACCCAGTAAGG + Intergenic
963717358 3:148819146-148819168 CTTTGGGTATATCCCCAGTAAGG + Intronic
964689946 3:159438990-159439012 CTTTGGATATATACCCAGTAAGG + Intronic
965241639 3:166207821-166207843 CTTTGGATATATACCCAGTTAGG + Intergenic
965383323 3:168016533-168016555 CTTTGGGTATATACCCAGTAAGG - Intronic
965477642 3:169177107-169177129 CTTTGGGTATATACCCAGTAAGG - Intronic
965891153 3:173515005-173515027 TTTTGGATAAATACCCAGAATGG + Intronic
966340496 3:178920486-178920508 CTTTGGGTAGGTGCCCAGTAGGG - Intergenic
966654998 3:182346257-182346279 CTTTGGGTATATACCCAGTATGG - Intergenic
967479383 3:189956528-189956550 CTCTGGATCAATGCCCAGTTTGG + Intergenic
968658982 4:1791256-1791278 CTTGGCAGAAATGCCCAGTAGGG - Intergenic
972963044 4:44476872-44476894 CTCTGGGTATATGCCCAGTAAGG - Intergenic
973790940 4:54377667-54377689 CCTTGGATAACTGCCCTGTGGGG + Intergenic
973922264 4:55700002-55700024 CTTTGGGTATATACCCAGTAAGG - Intergenic
974250302 4:59376471-59376493 CATTGCATTTGTGCCCAGTAAGG - Intergenic
976680894 4:87754595-87754617 CTTTGGGTATATACCCAGTATGG + Intergenic
976821154 4:89208608-89208630 TTTTGGATATGTACCCAGAAGGG + Intergenic
976984435 4:91275136-91275158 CTCTGCCTAAGTGCCCAGTAGGG + Intronic
977063589 4:92286490-92286512 CTTTGGATATATACCCAGTAGGG + Intergenic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
977771220 4:100863287-100863309 CTTTGGGTATATGCCCAGTCAGG + Intronic
978052305 4:104216667-104216689 CTTTGGGTATATTCCCAGTATGG - Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
978572664 4:110156016-110156038 ATTTGGATATGTGCCCACTAAGG - Intronic
978978428 4:114910745-114910767 GTTTGGAGAAGGGCCTAGTAAGG - Intronic
979814993 4:125089243-125089265 GTAGGGATAAGTGCCCAGTCAGG + Intergenic
981123649 4:141081044-141081066 TTTTGGATAAGTGGCCAGTATGG + Intronic
981738517 4:147978174-147978196 TTTTGGATATATACCCAGTAAGG + Intronic
981838968 4:149089093-149089115 CTTTGGGTATATACCCAGTAAGG + Intergenic
982507186 4:156234115-156234137 CTTTGGGTATATACCCAGTAAGG - Intergenic
984190241 4:176596778-176596800 GTTTGGTTAAATGCCCAGTGTGG + Intergenic
984592054 4:181627836-181627858 CTTTGGGTATATGCCCAGTAAGG + Intergenic
984625615 4:182004574-182004596 CTTTGGGTATATACCCAGTAAGG + Intergenic
985091744 4:186370197-186370219 CTTTGGGTATATACCCAGTAAGG - Intergenic
985109287 4:186532721-186532743 CTTTGGGTATATACCCAGTAAGG + Intronic
985249431 4:188008542-188008564 CTTTGGCTATATGCCCAGAAAGG + Intergenic
985526102 5:402664-402686 ATTTGGGTAAATGCCCAGCAGGG - Intronic
985526112 5:402720-402742 CTTTGGGTAAATGCCCGGCAGGG - Intronic
986359045 5:6957758-6957780 CTTTGGGTATATACCCAGTAAGG - Intergenic
986507526 5:8468060-8468082 CTTTGGAGAAATGCCTAGCAGGG - Intergenic
987199515 5:15561563-15561585 CTTTGGATATATACCCAGCAGGG + Intronic
987663738 5:20908692-20908714 CTTTGGTAAATTGCCCAGTCTGG + Intergenic
987669313 5:20986678-20986700 CTTTGGGTATATACCCAGTAAGG + Intergenic
988324416 5:29743425-29743447 CTTTGGGTATATGCCCAGTATGG - Intergenic
988412871 5:30909721-30909743 CTTTGGGTATATACCCAGTAAGG - Intergenic
988758947 5:34293497-34293519 CTTTGGTAAATTGCCCAGTCTGG - Intergenic
990770001 5:59232660-59232682 CTTTAGATAAACACCCAGTAGGG - Intronic
990859871 5:60314986-60315008 CTTTGGGTATATACCCAGTAAGG + Intronic
991172220 5:63641739-63641761 CTTTGGGTAGATACCCAGTAGGG + Intergenic
991239359 5:64439867-64439889 CTTTGGATATATTCCCAGAAAGG - Intergenic
994357356 5:98808825-98808847 CTCTGGATAAATGCCCATAATGG - Intergenic
995174677 5:109161740-109161762 CTTTGGGTATATGCCCATTATGG + Intronic
995535667 5:113133626-113133648 TTTTGGATATATACCCAGTAAGG + Intronic
995768930 5:115648849-115648871 CTTTGCATAAGTGCACAGTGCGG - Intergenic
996429378 5:123355285-123355307 CTTTGGGTATATACCCAGTAAGG + Intronic
997186540 5:131887340-131887362 CTTTGGGTATATACCCAGTAAGG + Intronic
997887601 5:137644520-137644542 CTTTGGATGCATACCCAGTATGG + Intronic
999253419 5:150196086-150196108 CTTTGGATAGGTGCCCACGGGGG + Intronic
1001895426 5:175375544-175375566 CTTTGCAAAAGTGCCAAGCATGG - Intergenic
1002681142 5:180965881-180965903 CTTTTGATATTTACCCAGTAGGG - Intergenic
1004095979 6:12554824-12554846 CTTTGGGTATATACCCAGTAAGG - Intergenic
1004406597 6:15338787-15338809 CTTTGAATTTGGGCCCAGTAAGG + Intronic
1005026977 6:21472345-21472367 CTTTGGAGAAGTGCCTATTCAGG + Intergenic
1007346984 6:41238407-41238429 CTGTGTATATGTGCCCAGCAAGG - Intronic
1008097456 6:47353525-47353547 GTGTGTATAAGTGCCCAGCAGGG - Intergenic
1008239503 6:49091882-49091904 CATTGGATAAACTCCCAGTAGGG + Intergenic
1008463609 6:51805020-51805042 CTTTGGATATATACCCAGTAAGG - Intronic
1011195195 6:84773623-84773645 CTGTTGATAAGTGCAAAGTACGG + Intergenic
1011229654 6:85146102-85146124 CTTTGGATATATACCCAGTATGG + Intergenic
1011571461 6:88741087-88741109 CTTTAGATATATACCCAGTAAGG - Intronic
1012010223 6:93774370-93774392 CTTTAAATAAGTGCTCAGTGGGG - Intergenic
1012025940 6:93991363-93991385 CTTTAGATAAATGCCCATTGGGG - Intergenic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1014348689 6:120310583-120310605 CTTTAGATAGATACCCAGTAGGG + Intergenic
1014423456 6:121272750-121272772 CTTTGGGTATATACCCAGTAAGG - Intronic
1014511781 6:122331434-122331456 CTTTGGGTATATACCCAGTATGG - Intergenic
1014598308 6:123373414-123373436 CTTTGGTAAATTGCCCAGTGTGG + Intronic
1014636312 6:123851195-123851217 CTTTGGATATATACTCAGTAGGG + Intronic
1015281473 6:131439446-131439468 CTTTGGATATACACCCAGTAAGG - Intergenic
1015830734 6:137366065-137366087 CTTTGTATCTGTGCCCAATATGG - Intergenic
1015889094 6:137951488-137951510 CTGTGGCTAAGTGCACAGTCAGG - Intergenic
1016542878 6:145185980-145186002 TTTTGGGTATATGCCCAGTAAGG - Intergenic
1018553968 6:165031620-165031642 CTTTGTAGAAGTGACCAGGAAGG + Intergenic
1019035756 6:169057230-169057252 CTTTGGGTATATGCCCATTATGG - Intergenic
1020831171 7:13097245-13097267 CTTTGGATATTTGTCCACTAGGG + Intergenic
1020917878 7:14219584-14219606 CTTTGGATAAATGTCTATTAAGG + Intronic
1021351288 7:19596980-19597002 CTTTGTATATATACCCAGTAAGG + Intergenic
1021367412 7:19796906-19796928 CTTTGGATAAATATACAGTATGG + Intergenic
1023631543 7:42169601-42169623 CTTTGGGTATGTACCCAGCAAGG - Intronic
1024171592 7:46793234-46793256 CTTTGGATATATACCCAGAAGGG + Intergenic
1024949951 7:54850197-54850219 CTTTGGGTATATACCCAGTATGG + Intergenic
1026974951 7:74491828-74491850 CTTTGGGTATATACCCAGTAAGG + Intronic
1027349485 7:77296098-77296120 CTCTGGATAAATTTCCAGTAGGG + Intronic
1027783664 7:82552048-82552070 CTTTGGGTATGTTACCAGTAAGG + Intergenic
1028045496 7:86112434-86112456 CTTTGGATATATAACCAGTAGGG + Intergenic
1028064800 7:86370111-86370133 CTTTGGATAAATATTCAGTAGGG + Intergenic
1028969572 7:96842726-96842748 CTTTGGATATATACCCAGTAAGG + Intergenic
1030119403 7:106092969-106092991 CTTTGGCTCTGTGACCAGTATGG - Exonic
1031070383 7:117155109-117155131 ATTTAGATAAGTGCTCAGGAAGG + Intronic
1032191528 7:129768687-129768709 CCTTGGATACATGCCCAGGAAGG - Intergenic
1033626641 7:143116933-143116955 CTTTGGGTATATACCCAGTAAGG - Intergenic
1037257765 8:16974351-16974373 CTTTGGGTATATACCCAGTATGG + Intergenic
1037696512 8:21228647-21228669 CTTGGGCTATGTGCCCTGTATGG - Intergenic
1039173603 8:34778926-34778948 CTTTGGATATATACCCAGTATGG - Intergenic
1039400387 8:37264093-37264115 TTTTGGATAAATACCCAGTAGGG - Intergenic
1039747451 8:40441784-40441806 CATTGGATTAGGGCCCACTAGGG + Intergenic
1041156614 8:54993653-54993675 TTTTGGTTAAGTCCCCAGTCTGG - Intergenic
1042000466 8:64118025-64118047 CTTTAGATGAATACCCAGTAGGG - Intergenic
1043252003 8:78086712-78086734 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1043840764 8:85101054-85101076 CTATAGATAATTACCCAGTAGGG + Intergenic
1043949496 8:86291991-86292013 CTGTGGATAGGTGTCCAGGAAGG - Intronic
1044440230 8:92215409-92215431 CTTTGGGTATATCCCCAGTAAGG + Intergenic
1046563349 8:115867360-115867382 CTTTGGACACGTGCTCAGGATGG + Intergenic
1046607043 8:116382655-116382677 TATTGGGGAAGTGCCCAGTAGGG - Intergenic
1047383733 8:124388905-124388927 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1047892047 8:129323669-129323691 CATTGGATAAGTGCCCTCTCTGG + Intergenic
1048435878 8:134417064-134417086 CTTTGGGTATATACCCAGTATGG - Intergenic
1049077823 8:140414010-140414032 CTTTGGGTATATACCCAGTAAGG + Intronic
1049948678 9:623246-623268 CTTTGGAAAAGTGTCTATTAAGG - Intronic
1050347558 9:4707361-4707383 CTTTGGCTAAGTACCCATTAAGG + Exonic
1050368509 9:4896578-4896600 CTTTGGGTATATACCCAGTAAGG + Intergenic
1050761642 9:9079498-9079520 CTTTGGATAGATTCTCAGTAGGG + Intronic
1050960779 9:11727582-11727604 CTTTGGATATGTGCCCAAAGTGG - Intergenic
1052694901 9:31865241-31865263 CTTTGGGTATATACCCAGTATGG + Intergenic
1055903009 9:81262703-81262725 CTTTGGCTATATACCCAGTATGG - Intergenic
1056040020 9:82655638-82655660 TTTTGGATATGTATCCAGTAGGG + Intergenic
1056644633 9:88400110-88400132 CTTTGGGTAGTTGCCCAGCACGG + Intronic
1056994010 9:91438009-91438031 CTTTGGGTATATGCCCAGAAAGG + Intergenic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1060556731 9:124511796-124511818 CTTTGGGAAAGTCCCCAGTTAGG - Intergenic
1060708860 9:125835839-125835861 TTTTGGATATATGCCCAGCAGGG - Intronic
1185686393 X:1932358-1932380 CTTTGGATAAATTCCCAGCAGGG + Intergenic
1186920901 X:14279122-14279144 CTTTGGATGAATACCCAATAGGG - Intergenic
1186941556 X:14513906-14513928 CTCTGGGTAGATGCCCAGTAAGG - Intergenic
1188863275 X:35284429-35284451 CTTTGGATATATGCCCAGGAAGG - Intergenic
1189573631 X:42326357-42326379 CTCTGGGTATATGCCCAGTAAGG - Intergenic
1189583468 X:42432058-42432080 CTTTGCAGAAGTGGTCAGTATGG - Intergenic
1189867220 X:45343467-45343489 CTTGGTATAAGTGCCCAAGAAGG + Intergenic
1190587352 X:51959865-51959887 CTTTGGGTATATACCCAGTAAGG + Intergenic
1190591609 X:52008238-52008260 CTTTGGGTATATACCCAGTAAGG + Intergenic
1191058425 X:56268304-56268326 CTTTGGATATATACCCAGAAGGG + Intronic
1191205780 X:57832917-57832939 CTTTGGGTATATACCCAGTAAGG - Intergenic
1191789469 X:64953809-64953831 CTTTGGGTATATACCCAGTAAGG - Intronic
1192015903 X:67330599-67330621 CTTTGGGTACATACCCAGTAGGG - Intergenic
1192749347 X:73972277-73972299 CTTTGGATATGTACCCAAAAGGG + Intergenic
1194096450 X:89645425-89645447 TTTTGGATATATACCCAGTAAGG - Intergenic
1194588795 X:95771217-95771239 CTTTGGATATATACCCAGTAAGG - Intergenic
1194990062 X:100537626-100537648 CTTTGGGTATATACCCAGTAAGG + Intergenic
1195940522 X:110163868-110163890 ATCTGCATCAGTGCCCAGTATGG - Intronic
1196531370 X:116790838-116790860 CTTTGGGTATATACCCAGTAAGG - Intergenic
1198585100 X:138111672-138111694 CTTTGTATAAATACTCAGTAGGG - Intergenic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic
1200449462 Y:3306807-3306829 TTTTGGATATATACCCAGTAAGG - Intergenic
1200717258 Y:6562251-6562273 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1201244439 Y:11989113-11989135 CTTTGGGTATATACCCAGTAAGG + Intergenic
1201535925 Y:15048209-15048231 CTTTGGCTATATACCCAGTAAGG + Intergenic
1201939856 Y:19448031-19448053 CTTTGGGGAAGTGGCCAGAAAGG + Intergenic
1202351792 Y:24000595-24000617 CTTTGGTTATATGCGCAGTAAGG - Intergenic
1202518987 Y:25669524-25669546 CTTTGGTTATATGCGCAGTAAGG + Intergenic