ID: 1143816597

View in Genome Browser
Species Human (GRCh38)
Location 17:9521078-9521100
Sequence GTGAATATAAAGATGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143816595_1143816597 11 Left 1143816595 17:9521044-9521066 CCTTTTTCAGAACTTTTTTTGGT 0: 1
1: 1
2: 3
3: 65
4: 729
Right 1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG 0: 1
1: 0
2: 0
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143816597 Original CRISPR GTGAATATAAAGATGCACAG AGG Intronic
900279525 1:1857352-1857374 GTTAATAGAGAGATTCACAGAGG - Intronic
900712554 1:4123600-4123622 GTTAATAGAAAAATGCAAAGAGG + Intergenic
904105039 1:28073055-28073077 TTGACTATAAAGAGGCACAAGGG + Intronic
905598179 1:39226930-39226952 ATGAATATAGTGAAGCACAGTGG + Intronic
905765853 1:40600180-40600202 GGGAATGTAAAGAGGTACAGCGG - Intergenic
907295241 1:53447411-53447433 GTGAATATAGAGATTCACTATGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
909531145 1:76683110-76683132 TTGAATATAAAGGTACACACTGG + Intergenic
910964233 1:92791998-92792020 TTGAATATACACATTCACAGAGG - Intronic
911395149 1:97296882-97296904 ATAAATATAAAAAAGCACAGTGG + Intronic
911724651 1:101230293-101230315 GTGAATAAAAAAATGGAAAGTGG + Intergenic
913327891 1:117643503-117643525 GTGAATGCATAGAAGCACAGAGG - Intergenic
916358685 1:163942766-163942788 GTGTAAATCAAGATGCAAAGAGG - Intergenic
919101641 1:193104253-193104275 ATGAATAGAAACATGCACGGAGG + Intronic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
1063926709 10:10985191-10985213 GGGAATATTAAAATGTACAGGGG + Intergenic
1065280365 10:24131583-24131605 TGGGATATAAAGATGTACAGCGG - Intronic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075057085 10:119227158-119227180 GTGATGATAAAGATACAGAGAGG - Intronic
1077986232 11:7354100-7354122 GTGAACATAAAGATGGACACAGG - Intronic
1078572070 11:12467925-12467947 GGGAATATAAATGTGCACAGGGG - Intronic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1080711471 11:34751969-34751991 GTGAATGGAAGGAGGCACAGGGG - Intergenic
1081097639 11:38958760-38958782 GTGAAGACACAGATACACAGAGG + Intergenic
1083116760 11:60467574-60467596 GTTAATAAGAAGATGCACAGAGG - Intronic
1087450754 11:98319868-98319890 TTGAATACAAAGAGGCAAAGGGG + Intergenic
1087728303 11:101749422-101749444 GTGAATATAAATATGAAACGGGG - Intronic
1087997278 11:104825166-104825188 GTGAATACCAAAATCCACAGAGG - Intergenic
1091018360 11:132074996-132075018 GAGTATATAAAGATGCATACAGG + Intronic
1091124023 11:133080655-133080677 GTGAAAATAAACGGGCACAGTGG - Intronic
1092211306 12:6648018-6648040 GTGCATGTAAAGATGCTAAGTGG - Intergenic
1092411354 12:8255606-8255628 GTGTATATATAGTGGCACAGTGG + Intergenic
1092705173 12:11275413-11275435 ATTAAAATAAAGAAGCACAGAGG - Intergenic
1092709570 12:11321053-11321075 ATTAAAATAAAGAAGCACAGAGG - Intergenic
1094419991 12:30260356-30260378 ATAAATATAACCATGCACAGTGG + Intergenic
1095375646 12:41525131-41525153 ATGCATATAAAGATGCTGAGTGG + Intronic
1096292605 12:50353766-50353788 GTGTATTGAAAGATGTACAGCGG - Exonic
1099118873 12:78663273-78663295 GTGAACAGATAGATGCCCAGAGG + Intergenic
1101751353 12:107585161-107585183 GTTAAAATAAAGATGGTCAGGGG + Intronic
1102768227 12:115451536-115451558 GAGAAGATAGAGATGCAGAGAGG + Intergenic
1103212472 12:119176773-119176795 GTGAAAAAACAGAGGCACAGAGG - Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105785131 13:23740812-23740834 GGGGATAGGAAGATGCACAGAGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107143462 13:37030983-37031005 GTGAATATAAAAAACAACAGAGG + Intronic
1108051413 13:46444428-46444450 GTGTATACACACATGCACAGGGG + Intergenic
1108398751 13:50017156-50017178 ATGAAAATAAAGTTGTACAGAGG - Intronic
1109347399 13:61131531-61131553 GTAAACACTAAGATGCACAGTGG - Intergenic
1109543969 13:63818051-63818073 GTGTATACACACATGCACAGGGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109870800 13:68329758-68329780 TTGAAGATGAATATGCACAGAGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110365879 13:74685253-74685275 TTAAATATAAAGAAGCACAGGGG + Intergenic
1111510224 13:89251384-89251406 GTGAAGATAGAGATGCTCAGTGG - Intergenic
1113277470 13:108747793-108747815 TTGAATATAAAGATGCAGACAGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116914848 14:50514785-50514807 GGGAATATAAAGATATAAAGAGG + Intronic
1118541098 14:66826587-66826609 GTGAATCTGAAAATGCAGAGTGG - Intronic
1119201986 14:72760842-72760864 TTTAATATAAAGATGCAAATAGG + Intronic
1121832607 14:97065223-97065245 ATGAACTTAAACATGCACAGAGG + Intergenic
1123972217 15:25517910-25517932 GATCATATAAAAATGCACAGAGG - Intergenic
1124852991 15:33359349-33359371 GGGAAAATAAAGACACACAGGGG - Intronic
1127412015 15:58718792-58718814 GTGAAGAGAGAGCTGCACAGAGG - Intronic
1128383092 15:67127553-67127575 GTGAGTATTAATATGCACAAGGG - Intronic
1131150053 15:90042195-90042217 GAAAATACAAAGAGGCACAGGGG - Intronic
1131577832 15:93609779-93609801 TTTAATATAAAGATTCACATTGG + Intergenic
1131709965 15:95042671-95042693 GTGAATGAAAAAAAGCACAGTGG - Intergenic
1132071592 15:98781922-98781944 GTGCATGAAAAGATGCTCAGAGG - Intronic
1133839860 16:9397959-9397981 GAGGATATAAAGATCCAGAGAGG - Intergenic
1133866008 16:9644051-9644073 GAGAAAATAAAGAGGCACAGAGG + Intergenic
1134426549 16:14154017-14154039 TTAAATATAAAGATGCAGATGGG - Intronic
1138929010 16:61629585-61629607 GTGAATAAATAGATTCAGAGAGG + Intergenic
1139408194 16:66736472-66736494 GTGCAATTAAAGATGCCCAGGGG - Intronic
1140249363 16:73281851-73281873 GAGAATATAAATATGATCAGGGG + Intergenic
1140708594 16:77655280-77655302 GTGAAAATAAATAGCCACAGAGG + Intergenic
1141335286 16:83148524-83148546 GTGCATAAAATGAGGCACAGAGG - Intronic
1142633435 17:1241212-1241234 GAAAATATATAGATGCCCAGTGG - Intergenic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1149953667 17:61021024-61021046 GTAAATATAAAGATGGGGAGGGG - Intronic
1151129937 17:71886226-71886248 TTGAATATATTGATGCAAAGGGG - Intergenic
1153044244 18:841313-841335 ATGAATTTAGAGATGCTCAGTGG - Intergenic
1153860395 18:9198165-9198187 GTGAAGATAAAGATACAGAGGGG + Intronic
1155283560 18:24265848-24265870 GGGAATAACAAGAAGCACAGTGG - Intronic
1155791544 18:29977158-29977180 GTTAAAATAAATATTCACAGGGG + Intergenic
1156297906 18:35809268-35809290 GTGATCAAAAAGAAGCACAGAGG + Intergenic
1156837120 18:41567658-41567680 GAGGATGTAAAGATGCACTGGGG - Intergenic
1157001796 18:43536208-43536230 ATCAAAATAAAGATGCATAGTGG + Intergenic
1157185262 18:45534874-45534896 GTGACTACAAAGATGCCCTGTGG - Intronic
1157269928 18:46265566-46265588 TTGGATATTAAGATGCAGAGGGG + Exonic
1157897835 18:51485396-51485418 ATGAACATAAAGATGAACGGGGG - Intergenic
1158091617 18:53721261-53721283 GGGAATATACAAAGGCACAGTGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158880357 18:61773279-61773301 GTGAAAATAAATCTGCACATGGG - Intergenic
1159168942 18:64737566-64737588 GTGTGTATAAAAATGCACACAGG - Intergenic
1159714331 18:71803261-71803283 GTGTATATATATATTCACAGAGG + Intergenic
1160070387 18:75623047-75623069 TTGAACACAAACATGCACAGAGG + Intergenic
1160164876 18:76501737-76501759 GTCAATATAAAGAAACAGAGTGG + Intergenic
1160224636 18:77002640-77002662 TTGAATATTGAGATGCACAGAGG + Intronic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1162881617 19:13663935-13663957 GTGATTATAAAGCTCCTCAGAGG - Intergenic
1164957235 19:32397081-32397103 GTTAATATAAAGTTGAACAAAGG + Intergenic
925824037 2:7829462-7829484 GCGAATTTCAAGATGCACATAGG - Intergenic
926805138 2:16702069-16702091 GTGCATTTAAAAATGCACAATGG + Intergenic
927140664 2:20128830-20128852 TTGAATATAAAATTGGACAGGGG + Intergenic
927254865 2:21032280-21032302 TTTAATACAGAGATGCACAGAGG + Intronic
927732647 2:25488207-25488229 GTGACTATGAAGATGGACAGTGG + Intronic
928248765 2:29655952-29655974 GTGGATATAAATATGGACACAGG - Intronic
928290187 2:30029869-30029891 GTGAAAAGCAAGAGGCACAGAGG + Intergenic
933711445 2:85328833-85328855 GAGAAAATAAATATGCATAGAGG - Intergenic
933849898 2:86357688-86357710 GTGAACATAAAGGTGTACAAAGG + Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
936022855 2:109008197-109008219 GTGAAAATACAGAAGCACATAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937973148 2:127565449-127565471 GAGAAGAAAATGATGCACAGGGG + Intronic
938074596 2:128325021-128325043 CTGAATACAATCATGCACAGAGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939117498 2:138077173-138077195 TTGAATATACAGATGCATGGGGG + Intergenic
939369777 2:141284104-141284126 TTGAAAATAAAAATGCACAGTGG + Intronic
939920888 2:148111731-148111753 GTATATATACAGATACACAGAGG + Intronic
940659330 2:156527432-156527454 GTGGATATAATGATCTACAGAGG - Intronic
941152261 2:161929340-161929362 CTGAACATAAAGAAGCATAGTGG - Intronic
941504026 2:166317799-166317821 GTAAAAACAAAGATGTACAGTGG + Intronic
942645221 2:178102957-178102979 GTAAAGACAGAGATGCACAGGGG + Intronic
943978779 2:194519191-194519213 TTGAATAGATAAATGCACAGAGG - Intergenic
944163042 2:196686804-196686826 GAGAATATATGGATACACAGAGG - Intronic
945076108 2:206041326-206041348 TTAAATATAAAGATGCAAATAGG + Intronic
945410477 2:209500503-209500525 ATGAAGATAAAGATTCACAGAGG - Intronic
946437618 2:219668355-219668377 CTGAATATAAAAATGCCCAGAGG - Intergenic
947683294 2:232056479-232056501 GTAAATATTAATCTGCACAGTGG + Intronic
1169774158 20:9234115-9234137 GTGAATAAAAAAAGGCACTGAGG + Intronic
1169824595 20:9753491-9753513 GTGTATATAGAGTTTCACAGAGG + Intronic
1169993927 20:11535422-11535444 ATAAATAGAAAGATGCAAAGAGG + Intergenic
1170015509 20:11777004-11777026 GTGAATAGAAAAATGCAATGTGG + Intergenic
1172499926 20:35418467-35418489 GTGAAGAGAAAGATGGGCAGAGG - Intergenic
1173724705 20:45289256-45289278 ATGAATGTGAACATGCACAGTGG - Intergenic
1174219102 20:48938125-48938147 ATGAAAATCAAGATCCACAGAGG - Intronic
1175320717 20:58086111-58086133 ATGGATATAATAATGCACAGTGG + Intergenic
1180118746 21:45730902-45730924 TTAAATATAAACATACACAGAGG - Intronic
1181742993 22:24936197-24936219 GTGAATAAATAGGTGGACAGAGG - Intronic
1183520569 22:38294179-38294201 GTGAGTATGAGGCTGCACAGGGG - Exonic
1184925763 22:47636076-47636098 GTGAAGAACAAGATGCAGAGAGG - Intergenic
1184977724 22:48074924-48074946 GTGAATAAAGTCATGCACAGAGG + Intergenic
951532257 3:23709139-23709161 GTGGTTATAAAGAAGCAAAGTGG + Intergenic
951997076 3:28743113-28743135 GTGAAAACAGAGATGCAAAGTGG + Intergenic
952069912 3:29622304-29622326 GTGAAGAAAAAGAAGCACATAGG + Intronic
953223735 3:40998189-40998211 GTGAATTCAAAGATGAAAAGGGG + Intergenic
953716678 3:45321907-45321929 GGGAAAATTAAGAGGCACAGTGG + Intergenic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
957380492 3:79421964-79421986 GTGGATATAAAAATGTACAGTGG - Intronic
958649220 3:96915933-96915955 GTGATTCTAGAGATGCAAAGTGG + Intronic
959239147 3:103766451-103766473 GTGTATATATATATGCACTGTGG + Intergenic
960176765 3:114526538-114526560 TGGAATGTAAAAATGCACAGTGG - Intronic
963511474 3:146252961-146252983 ATGAATGTAAACATCCACAGTGG + Intergenic
963699255 3:148603407-148603429 GTGCATATATATTTGCACAGAGG - Intergenic
963815487 3:149825955-149825977 GTAAATATAAAGATACAAAGAGG - Intronic
963979083 3:151515993-151516015 GTGAAAATGAATATGCACTGTGG - Intergenic
964717548 3:159738461-159738483 GTGAATATTAACATGGAGAGAGG - Intronic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
966318982 3:178679741-178679763 GTTAAAATAAAGATGCCCAAAGG + Intronic
967333480 3:188316896-188316918 GTCCATCTAAAAATGCACAGTGG - Intronic
967598902 3:191360924-191360946 TTCAAGATAAAGATGCAAAGAGG - Intronic
971003018 4:22343445-22343467 GTGAAGATGGAGATGCACAGCGG + Intergenic
971262877 4:25073046-25073068 GGGAATAGCAAGATGTACAGAGG + Intergenic
971876222 4:32312107-32312129 ATAAATAAAAATATGCACAGTGG - Intergenic
972658706 4:41092796-41092818 ATGAATTTAAAGTTGAACAGAGG - Intronic
973262316 4:48177602-48177624 GGGGATATAAATATGCACTGGGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974833984 4:67224566-67224588 GTGAATATAAAGAAGGAGAGTGG + Intergenic
976021890 4:80639407-80639429 GGGGATATAAAAATTCACAGCGG + Intronic
977231855 4:94460986-94461008 GTGAATACACAGTTGAACAGTGG + Intronic
977246552 4:94638201-94638223 AAGAAATTAAAGATGCACAGAGG + Intronic
978713014 4:111808518-111808540 GTGAATGTAAAGACACAAAGAGG - Intergenic
979495536 4:121378853-121378875 GTGAAAATAATTATGCAAAGTGG - Intronic
980476761 4:133328304-133328326 GTGTATTTATACATGCACAGAGG + Intergenic
983793158 4:171824290-171824312 GTGAAAGTCAATATGCACAGTGG + Intronic
984042945 4:174759513-174759535 TTGAATATAAAGATGAGCACTGG - Intronic
984665328 4:182421189-182421211 GTGAAGATGAAGATGAAGAGGGG - Intronic
985078114 4:186238165-186238187 GTTAGTATTAAAATGCACAGTGG - Intronic
987596384 5:20004802-20004824 ATGAATATAAAGAGGAATAGTGG + Intronic
987657699 5:20828502-20828524 GTAAATATAAAGATACAAAGAGG - Intergenic
988275074 5:29069943-29069965 GTGAAAATAAAGATGGGCATTGG + Intergenic
988765841 5:34375449-34375471 GTAAATATAAAGATACAAAGAGG + Intergenic
988995281 5:36709101-36709123 TTGAACATAAAGATGTTCAGAGG - Intergenic
990674153 5:58164526-58164548 GTGAATAAAAAAATACACTGTGG + Intergenic
992202540 5:74398615-74398637 CTGAATATGAAGAGGAACAGAGG - Intergenic
993565956 5:89475894-89475916 GTAAAAATAAAAATGCACTGAGG + Intergenic
993797651 5:92287801-92287823 GTGGAGATTAGGATGCACAGAGG - Intergenic
994077280 5:95667659-95667681 GTGAATATATGAATTCACAGTGG + Intronic
995857103 5:116605044-116605066 GTGAAAGTACAGATGCACAGGGG - Intergenic
996273888 5:121640861-121640883 CTGAAGATAAAGGTGCACTGGGG + Intergenic
996444056 5:123524140-123524162 GTAAATATATAAATGCAAAGTGG + Intronic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997099613 5:130954948-130954970 GTGATGAAAAAGATGCATAGGGG + Intergenic
997426979 5:133809917-133809939 GGGAATATCATGATGCACAAAGG + Intergenic
999405205 5:151300831-151300853 GAGCAAATAAAGATGCCCAGAGG - Intronic
999775686 5:154811459-154811481 GTGAGGATAAAGAAGCTCAGAGG - Intronic
999985009 5:156995329-156995351 GTGTATGTAAATATGCACATGGG + Intergenic
1000393044 5:160745272-160745294 ATGAAAATAAAGCTGCCCAGTGG - Intronic
1001017222 5:168152504-168152526 GTGGCTATAAGGATGCTCAGTGG + Intronic
1001415136 5:171540332-171540354 GTCCATATTAGGATGCACAGAGG - Intergenic
1001782059 5:174377571-174377593 ATGAATATATAGTTGCACAATGG + Intergenic
1001837263 5:174842953-174842975 GTCAATATAATGAGACACAGAGG - Intergenic
1002083638 5:176754075-176754097 ATGACTATAAACAGGCACAGGGG + Intergenic
1005510401 6:26507295-26507317 GCCAATATGAAGAAGCACAGAGG + Intronic
1006025931 6:31146821-31146843 GAGAACAGAAAGATGCACTGTGG - Intronic
1007977214 6:46113823-46113845 GAGGACATAAACATGCACAGTGG + Intergenic
1008096426 6:47344010-47344032 GAGAATACATAGAAGCACAGAGG - Intergenic
1009964180 6:70561000-70561022 GTGAAAATAAAAATGCACTAAGG + Exonic
1010902095 6:81440802-81440824 GTAAATATAAAGTTGCATACCGG + Intergenic
1011780083 6:90778786-90778808 ATGAAGATAAAGATACACTGGGG + Intergenic
1012975075 6:105771871-105771893 ATTAATTTAAATATGCACAGTGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013745264 6:113337980-113338002 GTAAAGACATAGATGCACAGTGG - Intergenic
1015977580 6:138806487-138806509 GTGAATTTTCAGCTGCACAGGGG - Intronic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017064303 6:150515216-150515238 GGGAATATTTACATGCACAGAGG + Intergenic
1018345794 6:162898003-162898025 GTGAATGTAGACATGGACAGGGG - Intronic
1018480440 6:164184209-164184231 GTGAATATAAAGACACTCAGTGG - Intergenic
1018501929 6:164420595-164420617 GTGAATATGATGAAGCAGAGAGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021736639 7:23645761-23645783 GAGAATATAGAGAAGCACAATGG + Intergenic
1022004687 7:26256630-26256652 AAGAATATGATGATGCACAGGGG - Intergenic
1022997938 7:35777349-35777371 GTGAATATCAAGTAGTACAGAGG + Intergenic
1023941626 7:44772085-44772107 ATGAAAATAAAAAGGCACAGTGG - Intergenic
1024056785 7:45664525-45664547 GAGAACACAAAGATGCACAAGGG + Intronic
1026425857 7:70292843-70292865 GTTAATAGAAAGCTGCACAAGGG - Intronic
1026825978 7:73581765-73581787 AAAGATATAAAGATGCACAGTGG + Intergenic
1028624218 7:92859710-92859732 CTGAATATAAAAAGGCCCAGGGG + Intergenic
1028737463 7:94233447-94233469 GAGAATAGGAAGCTGCACAGAGG + Intergenic
1030011787 7:105176621-105176643 GTATATATATATATGCACAGTGG + Intronic
1030926888 7:115468341-115468363 ATGAATATAAACAGGCACACAGG + Intergenic
1031462591 7:122069893-122069915 GAGACTATAAAGATATACAGGGG + Intergenic
1031814510 7:126416641-126416663 GAGAAAATAAACATGGACAGGGG + Intergenic
1033506764 7:142010773-142010795 GTGAACCTATAGAGGCACAGAGG - Intronic
1033581090 7:142736503-142736525 GGCAATATAAATATGCACAAGGG - Intergenic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1041594852 8:59637194-59637216 GTGCATAGAAAGATGCTCAAAGG + Intergenic
1041814756 8:61957453-61957475 GTGAATAGACAGATCTACAGAGG + Intergenic
1041858872 8:62488381-62488403 GTAATAATAAAGAGGCACAGTGG - Intronic
1044491022 8:92815237-92815259 CTAAAGATAAAGAAGCACAGAGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046584034 8:116129584-116129606 TGGAATATAAAGATGGAAAGGGG + Intergenic
1047846153 8:128807589-128807611 GTGAATATAATCATGAACTGAGG - Intergenic
1050139216 9:2500061-2500083 TTGAATACAAACATGCAAAGAGG + Intergenic
1050718722 9:8560896-8560918 GTGTAAATAAAGATGCAGAAAGG + Intronic
1050860109 9:10418138-10418160 GTGAAAATAAAGAAGCATAATGG + Intronic
1051192846 9:14533517-14533539 GTGAATATAAAAATACCCAAAGG - Intergenic
1051766615 9:20531434-20531456 GTGAATATAAAGTTGAAAGGAGG - Intronic
1051889833 9:21930422-21930444 GGGAGTATAAAGATGTCCAGGGG - Intronic
1052899719 9:33781991-33782013 GGCAATATAAATATGCACAAGGG - Intronic
1053618931 9:39796817-39796839 TTAAATATAAAGATGCAAATAGG - Intergenic
1053877099 9:42556166-42556188 TTAAATATAAAGATGCAAATAGG - Intergenic
1053895576 9:42738527-42738549 TTAAATATAAAGATGCAAACAGG + Intergenic
1054234597 9:62545556-62545578 TTAAATATAAAGATGCAAATAGG + Intergenic
1054265225 9:62910612-62910634 TTAAATATAAAGATGCAAATAGG + Intergenic
1055004849 9:71494321-71494343 TTAAATATAAAGATGCATATAGG + Intergenic
1055100148 9:72455911-72455933 GTGACTATAAATCTGCAAAGAGG + Intergenic
1056588894 9:87949518-87949540 TTAAATATAAAGATGCAAAGAGG - Intergenic
1058839857 9:108895564-108895586 GAGAATGGAAAGATACACAGAGG + Intronic
1059346301 9:113631337-113631359 GTCACTATAAGGATTCACAGAGG + Intergenic
1060302709 9:122384632-122384654 GTGAAAATCAAGATTCAGAGAGG + Intronic
1185988735 X:4868234-4868256 TTGAGTACAAAGAGGCACAGGGG + Intergenic
1186588826 X:10906255-10906277 GAGAAGATAGAGATGCCCAGTGG - Intergenic
1188059643 X:25585287-25585309 GAGAATACACAGATTCACAGAGG + Intergenic
1188344163 X:29043748-29043770 GTGAATGTAAAGATACCCAATGG + Intronic
1190293171 X:49006673-49006695 GAGGATATAAAGACGCATAGTGG - Intergenic
1190568663 X:51759420-51759442 GAGAATATAAAGAACCACAGAGG + Intergenic
1191603426 X:63035449-63035471 GTACATATGAACATGCACAGTGG - Intergenic
1192019557 X:67371263-67371285 GAGAATATAAAGATACAGAAAGG + Intergenic
1193104656 X:77656571-77656593 GTGAATCCGAAGATGAACAGCGG - Exonic
1193894708 X:87098808-87098830 GCCAATATGAACATGCACAGAGG - Intergenic
1194382720 X:93215500-93215522 GTGAATACACAGATGCACTGTGG + Intergenic
1195473874 X:105262513-105262535 GTGATTATAAAGATTAACTGAGG - Intronic
1195514022 X:105751520-105751542 TTGCAGATAAAGATGCAAAGTGG - Intronic
1196112414 X:111961308-111961330 GTTAATTTAAAAATGCATAGGGG - Intronic
1197829806 X:130629621-130629643 ATGTTAATAAAGATGCACAGGGG - Intronic
1199376677 X:147120224-147120246 GTGAATACCAAGAAGCGCAGGGG + Intergenic
1199776335 X:151015194-151015216 GTGCATAAAAAGATGCTCAGGGG - Intergenic
1200779856 Y:7204871-7204893 GTGGATTTAAAGTTGCACTGTGG - Intergenic