ID: 1143818632

View in Genome Browser
Species Human (GRCh38)
Location 17:9541293-9541315
Sequence ATGTGGAAGAGGAGAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 803
Summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 714}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143818632 Original CRISPR ATGTGGAAGAGGAGAATGGA GGG Intronic
900543168 1:3214196-3214218 GTGTCCAATAGGAGAATGGAAGG - Intronic
901244814 1:7721514-7721536 AGGTGGATGAGGAGAAAGGTTGG + Intronic
901270736 1:7951458-7951480 ATGTGGAAGATAAGAAAGAAGGG + Intergenic
902146849 1:14408890-14408912 ATGGGGTAGAGAATAATGGAGGG + Intergenic
902919929 1:19659620-19659642 AAGGGGAAGAAGAGAAAGGAAGG + Intergenic
903337227 1:22633273-22633295 AGGAGGAGGAGGAGACTGGAAGG + Intergenic
903478439 1:23636267-23636289 ACATGGGAGAGGAGAAGGGAAGG + Intronic
903543664 1:24110617-24110639 ATCAGGAAAAAGAGAATGGATGG + Intronic
904104764 1:28069915-28069937 AAATGGAAGAAGAGACTGGAGGG + Intronic
904463213 1:30692671-30692693 ACCTGGAGGAGGAGAATGGGAGG + Intergenic
904632573 1:31853860-31853882 AGATGGAGGAGGAGAAAGGAGGG - Intergenic
905498843 1:38419744-38419766 ATGTGGAGGAGCTGAGTGGAAGG - Intergenic
905954671 1:41982293-41982315 GTGCGGAAGAAGAAAATGGAAGG - Intronic
906268755 1:44457141-44457163 AGGAGGAAGAGGAGAGAGGAAGG - Intronic
906745969 1:48222444-48222466 ATGAGCAGGAGGAGAAAGGAGGG - Intergenic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
906957927 1:50392026-50392048 ATGAGAAAAAAGAGAATGGAGGG - Intergenic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907531146 1:55098741-55098763 AAGAGGAAGAGGAGGAGGGATGG + Intronic
907934847 1:59032941-59032963 ATGATGCAGAGGAGGATGGAGGG - Intergenic
908994213 1:70132235-70132257 ATCTGGAAGAGCAGGAGGGAAGG - Intronic
909131262 1:71739976-71739998 CTGTGGAAGAGAAGAATGTCTGG - Intronic
909224130 1:72994382-72994404 ATGAGGATGAGAAGAATGGGAGG - Intergenic
910638896 1:89439318-89439340 ATGGGGAAGAGGTATATGGATGG - Intergenic
910670673 1:89769612-89769634 ATGAGGAAGAGGAGCAGGAAAGG + Intronic
910730724 1:90392937-90392959 TTGGGCAAGAGGAGAGTGGAGGG - Intergenic
911119460 1:94280935-94280957 AGATGGCACAGGAGAATGGAAGG - Intergenic
911344622 1:96681526-96681548 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
911757551 1:101576772-101576794 ATATGGGAGAGGATAATGGTGGG + Intergenic
911783193 1:101910041-101910063 AGCAGGAGGAGGAGAATGGAGGG - Intronic
911978491 1:104534564-104534586 AAGAGGAAAAGGAAAATGGAAGG + Intergenic
912411783 1:109484840-109484862 AGGTGGAGGAGGAGACTGCACGG + Intronic
912572991 1:110638103-110638125 ATGCCGAAGAGGAGAGGGGAGGG - Intergenic
912777275 1:112513610-112513632 AAGTGGGTGAGGAGAAGGGAGGG - Intronic
913325971 1:117629202-117629224 ATGTGGATGGGCAGAATGAAGGG - Intergenic
913996568 1:143655631-143655653 ATATGAAAGAAGAGAGTGGAGGG - Intergenic
914393352 1:147241728-147241750 TAGAGGAAGATGAGAATGGAGGG + Intronic
914505685 1:148287180-148287202 ATATGAAAGAAGAGAGTGGAGGG + Intergenic
914506870 1:148296979-148297001 ATATGTAAGAAGAGAGTGGAGGG - Intergenic
915040562 1:152964996-152965018 AGGTAGAAGAAGAGAAGGGAAGG + Intergenic
915366584 1:155320329-155320351 ATGTGAATGAGGGGAGTGGAGGG + Intronic
915736808 1:158090371-158090393 GTGGGGGAGAGGAGAAAGGAGGG - Intronic
916003841 1:160641513-160641535 AAGAGGAAGAGGAAAAGGGAGGG + Intronic
916078810 1:161219163-161219185 ATGGGGAAGAGAAGAAGGGTGGG - Exonic
916285417 1:163100176-163100198 ATGGGGAAGAGGTGTGTGGATGG + Intergenic
916994029 1:170276437-170276459 TTGTGGAAGAGGAGCATGAAAGG - Intergenic
917387495 1:174492859-174492881 ATATGGAAGAGGGGAAGGAAAGG - Intronic
917471254 1:175327779-175327801 TTGTGGAAGAGGAGTCTGGGTGG - Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917834870 1:178933559-178933581 ACGTGGAAGAGGAGAGTCCATGG + Intergenic
918639634 1:186824078-186824100 ATGTGGAAGAGAATAGTAGAAGG + Intergenic
919464835 1:197914935-197914957 GTGTGGAATAGAAGAATGAATGG + Intronic
919683057 1:200455040-200455062 CTGTGCAAGATGAGACTGGAAGG - Intergenic
919745610 1:201006543-201006565 ATGGGGAAGAGGAGATGGAAAGG + Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920442921 1:205993389-205993411 ATGTTGAAGAGGGAAAAGGAGGG + Intronic
920445755 1:206014921-206014943 ATGTGGGAGAGGGGAATGAGAGG + Intronic
920449702 1:206050717-206050739 ATGTGGAAGGGGACAACAGAAGG + Intronic
920881198 1:209881994-209882016 AGGTGGAAGAGCAGACTGTAGGG - Intergenic
922887069 1:229028338-229028360 AGGAAGGAGAGGAGAATGGAAGG + Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924813614 1:247424323-247424345 ATGAGGAAGAGGATTCTGGAGGG - Exonic
1063111340 10:3040297-3040319 ATGTGGTATTGGAGAAAGGATGG + Intergenic
1063190103 10:3685687-3685709 ATGAAGAAGAGGAAAATGAAAGG - Intergenic
1063914908 10:10871610-10871632 AGGAGGAAGAGGAGGAGGGAAGG + Intergenic
1063958226 10:11284710-11284732 ATGGGTGAGAGGATAATGGATGG + Intronic
1064193970 10:13230631-13230653 ATGTGCAAGAGGAGGCTGGGGGG + Intronic
1064242971 10:13647255-13647277 TTGTGAAGGAGGAAAATGGAAGG + Intronic
1065106507 10:22393244-22393266 GGGTGGAAGAGGAGAAGGAAAGG - Intronic
1065304071 10:24352116-24352138 ATGTGGCAGAGGGGAAAGGCAGG - Intronic
1065540843 10:26765615-26765637 CTGAGGAAGAGGGGAAGGGAAGG + Intronic
1065643093 10:27805143-27805165 AAGTGCAAGAAGAGAAGGGAAGG + Intergenic
1066228659 10:33410646-33410668 ATGTGTAAGAGCAGAATTTAGGG + Intergenic
1066710013 10:38223357-38223379 ATTTTGAAGAGGAGAATTGGTGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1066979999 10:42404097-42404119 ATTTTGAAGAGGAGAATTGGTGG + Intergenic
1067062289 10:43083681-43083703 ATGTGGACCAGGACAAGGGATGG - Intronic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1068191898 10:53663323-53663345 ATGTGCAAGAGAAGAGTGGGTGG - Intergenic
1069162575 10:65109363-65109385 AGGAGGAAGAGAAGAATAGAGGG + Intergenic
1069323151 10:67198987-67199009 AGATGGAGGAGGAGAAAGGAAGG + Intronic
1070549913 10:77482938-77482960 ATGGGGGAGAGAAGAAGGGAAGG - Intronic
1070575420 10:77673526-77673548 AAGGGGAAGAGGAGAGTGAATGG - Intergenic
1071598674 10:86945475-86945497 ACCTGGAAGAGGAGAAGGGCTGG + Exonic
1071822331 10:89291214-89291236 ATGAGGAAGAAGAGAATGGAGGG - Intronic
1071874460 10:89829613-89829635 ATGTTCAATAGTAGAATGGATGG - Intergenic
1073287616 10:102398233-102398255 ATGAGGATGATGAGAATGGATGG + Exonic
1074153327 10:110778018-110778040 GGAAGGAAGAGGAGAATGGATGG - Intronic
1074169615 10:110919599-110919621 AGGAGGAAGAGGAGGAAGGAGGG + Exonic
1074174113 10:110978662-110978684 ATGTGGGAGAGGAGACTGCAAGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1074881590 10:117663577-117663599 ATCTGGAAAAGGTGAATGGTAGG + Intergenic
1075523115 10:123156440-123156462 TTGAGCAACAGGAGAATGGATGG + Intronic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1075974779 10:126685827-126685849 ATGGGGAGGAGGAGATTGGATGG - Intergenic
1076143896 10:128101438-128101460 AGGTGGCAGAGGAGAGCGGAGGG - Exonic
1076174426 10:128356347-128356369 ATGTCTAAGAGGAGAAAGAAAGG + Intergenic
1077760390 11:5089211-5089233 AAGAGAAAGAGGAGAATAGAAGG + Intergenic
1077975999 11:7250001-7250023 AAATGAAAGAGGAGATTGGAAGG - Intronic
1078072744 11:8128679-8128701 AGGTGGAAGAAAATAATGGATGG - Intronic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078639969 11:13085333-13085355 AGGTGGAAGAGGAAAAGGGTGGG - Intergenic
1078660648 11:13282863-13282885 TTGTGGAGGAGGAGATGGGATGG + Intronic
1079129236 11:17737876-17737898 AAGTTGCAGAGGAGAGTGGAGGG + Intronic
1079368654 11:19831292-19831314 ATTTGGAAGAACAGGATGGAGGG + Intronic
1079438713 11:20486169-20486191 CTGGGCAAGAAGAGAATGGATGG + Intronic
1079771531 11:24466215-24466237 AAGCGGAAGAGGAGAATGTGTGG + Intergenic
1079845066 11:25455396-25455418 ATTTTGAAGAGGAGAAAGGCTGG + Intergenic
1080464668 11:32485575-32485597 ATGTGGAAAAGAAGAATAGGAGG - Intergenic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081307777 11:41534680-41534702 ATGTGGCAAAGGAGAATTGCTGG + Intergenic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1081669032 11:44933161-44933183 ACGTGGCAGAGCAGAATGGGAGG - Exonic
1082297773 11:50463857-50463879 ATCTGCAAGGGGATAATGGAAGG + Intergenic
1082693077 11:56328632-56328654 CCATGGAACAGGAGAATGGAAGG - Intergenic
1082987953 11:59184118-59184140 ATTTGGGAGCAGAGAATGGATGG + Intronic
1083186057 11:61018481-61018503 AAGGGGAAAAGGAGAAAGGAAGG + Intronic
1083409103 11:62479708-62479730 TCGTGGAAGAAGGGAATGGAAGG - Intronic
1083657902 11:64238573-64238595 AGTTGGAAGAGGAGACTGGGAGG + Exonic
1083697953 11:64455229-64455251 ATGTGGGGGAGGAGGATGGGGGG + Intergenic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084776852 11:71382758-71382780 AGGAGGCAGAGGAGAGTGGAGGG + Intergenic
1085101012 11:73799946-73799968 GTGTGGAAGAATAGAAGGGATGG + Intronic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085382171 11:76129814-76129836 AGTTGGGAGAGCAGAATGGAGGG - Intronic
1085882943 11:80489288-80489310 AGGAGGACGAGGAGAAGGGAGGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086918877 11:92563132-92563154 ACTTGGAAGAGGAGAATCCATGG - Intronic
1088002085 11:104894594-104894616 ATGTTGAATAGGCAAATGGATGG - Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088227160 11:107633774-107633796 GAGGGAAAGAGGAGAATGGACGG - Intronic
1088358263 11:108965789-108965811 ATGTGGAAAGAGAGTATGGAGGG + Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088900460 11:114112472-114112494 ATGAGGAAGAGGAGAAAGACTGG + Intronic
1088986432 11:114913402-114913424 ATGTGGAGGAGAAGAAGAGAAGG + Intergenic
1089302587 11:117507595-117507617 AGGTGGAAGATGACATTGGAAGG - Intronic
1089317140 11:117599918-117599940 AGGTGGAAGAGCACAGTGGAAGG + Intronic
1089453651 11:118613329-118613351 ATGGTGAAGAGGAGAATGAAAGG + Exonic
1089920762 11:122207427-122207449 ATGAGGAGGATGAGAATGGAAGG + Intergenic
1090584781 11:128199572-128199594 AGTTGGAAGAGCAGAATGGCAGG + Intergenic
1090998931 11:131892119-131892141 AGGAGGAAGAGGAGAAGGGGAGG - Intronic
1091152732 11:133343796-133343818 ATGTGGTACAGGAGAAGAGAAGG - Intronic
1091590542 12:1840433-1840455 ATGTGGAAGAGGGGGGTGGGTGG + Intronic
1091676349 12:2493450-2493472 ATGGGGAGGAGGAGAAAGGGAGG - Intronic
1091706671 12:2698295-2698317 ATGTAGGAGAGAAGAAAGGAGGG + Intergenic
1092125782 12:6074133-6074155 ATGGGGAAAAGGAGGAGGGATGG - Intronic
1092245734 12:6863355-6863377 ATGTCGGAGAGGAGAAGTGAGGG - Exonic
1092921374 12:13234521-13234543 ATGTGGAGAAGGAGAATGTGTGG - Intergenic
1093618964 12:21264543-21264565 CTAGGGAAGAGGAGAAAGGAAGG + Intergenic
1093641882 12:21537038-21537060 ATGAGGAAGAGGAGGCTGAAAGG - Exonic
1094100594 12:26757892-26757914 ATGTGGAAGATGGGAAAGTAAGG + Intronic
1094423674 12:30297652-30297674 ATGGGGAAGAAGAGAAAGAAGGG - Intergenic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095508911 12:42928081-42928103 AGGTGGGAGAAGAGAAAGGAGGG - Intergenic
1095955042 12:47801062-47801084 ATTTGGAAAAGTAGAATGTAGGG - Intronic
1096724778 12:53552769-53552791 AACTGGAAGAGGAGAAGAGATGG + Intronic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1096791734 12:54049187-54049209 ATGTGGAAGGGGAAAAATGAAGG - Intronic
1097279273 12:57834529-57834551 ATGGGGCAGAGGAGGAAGGAGGG + Intronic
1097504052 12:60441965-60441987 ATGTTGAAGAGGAGAGGTGAGGG - Intergenic
1097537679 12:60894187-60894209 CTGAGGGAGAGGAGAATGGGAGG - Intergenic
1098316948 12:69202787-69202809 CTATGGAACAGGAGACTGGAGGG + Intergenic
1098401283 12:70079162-70079184 CAATGGAAGAGGAGAAAGGAGGG - Intergenic
1098421090 12:70298921-70298943 ATGTGGGAGAGTAGAATTGAGGG + Intronic
1098432613 12:70436188-70436210 ATGAGGAAAGGGAGAATGAACGG + Intergenic
1098598974 12:72307002-72307024 AGGAGGAAGAGTAGAATGGTAGG + Intronic
1099225994 12:79969842-79969864 TTGTGGAAGTTGAGACTGGAAGG + Intergenic
1099530150 12:83769052-83769074 ATCAGAAAGAGGAGAATGGGAGG + Intergenic
1100336718 12:93638361-93638383 ATGTGGAAAAAGGGAATGGATGG - Intergenic
1100650817 12:96586438-96586460 ATGTGAAGTAGGGGAATGGAAGG + Intronic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1101139133 12:101777106-101777128 AGGAGGAAGAGGAGAATGAAAGG - Intronic
1101162648 12:101994546-101994568 AGTGGGAAGAGGAGAAAGGATGG - Intronic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101467314 12:104961096-104961118 ATGTGGAGGAGGAGATCAGAAGG + Intergenic
1101517468 12:105450064-105450086 ATGTAGAGGAGAAGAATAGAAGG + Intergenic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1101663985 12:106793064-106793086 ATGAGGAAGGGCAGAATGGAAGG - Intronic
1102047172 12:109836537-109836559 CTGGGGGAGAGGAGAATGGGAGG + Intergenic
1102394265 12:112574254-112574276 AAGAGGAAGAGGAGAGTGGGAGG + Intronic
1102446165 12:113004377-113004399 AGGAGGAAGAGGAGGAGGGAGGG + Intronic
1102531114 12:113547271-113547293 AGGAGGAGGAGAAGAATGGAGGG + Intergenic
1103583899 12:121936869-121936891 AATTGGAAGGGGAGAAGGGAAGG + Intronic
1104190792 12:126480137-126480159 ATGGAGAAGAGGAGAAGGGGAGG + Intergenic
1104266655 12:127239772-127239794 CTCTGGAAGAAGAGAAAGGAGGG + Intergenic
1104544506 12:129698743-129698765 AGGGGGAAGAGGAGAGGGGAGGG + Intronic
1105580352 13:21689940-21689962 ATGTGGGAGAGGTGAGAGGAAGG - Intronic
1105766628 13:23566451-23566473 ATGCTGATGAGGAGAATGTAAGG + Intergenic
1106007625 13:25785834-25785856 ATGAGGAAGAAGATAAAGGAAGG + Intronic
1106319349 13:28623816-28623838 ATGGGGAAGAGGAGAATTGAAGG + Intergenic
1106898973 13:34334921-34334943 CTGAGGAAGAGGAGAGTGCAGGG + Intergenic
1108455516 13:50609840-50609862 AGGTGGCAGAGGAGGAGGGATGG - Intronic
1110293644 13:73837113-73837135 AGGAGGAAGAGGAGAAGGTATGG - Intronic
1110456281 13:75693754-75693776 ATGTGGCCGAGGAGCATGGGTGG + Intronic
1110519236 13:76455853-76455875 AGGAGGAGGAGGAGAAGGGAAGG + Intergenic
1110689503 13:78415806-78415828 ATATGGAAGTAGAGAATGGAAGG + Intergenic
1110719299 13:78743694-78743716 ATGTGGGAGGTGAGAAGGGAGGG + Intergenic
1110929627 13:81198923-81198945 GTGAGGAAGAGGAGAATGAAAGG - Intergenic
1110935260 13:81279696-81279718 AGGTGGAAGGGGAGACAGGAGGG - Intergenic
1111741504 13:92211344-92211366 ATGAGGAAGAGCAAGATGGATGG - Intronic
1112207306 13:97337448-97337470 ATATGGAAGAGGAAAATGGTGGG - Intronic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1112920529 13:104606051-104606073 AAATGGAAGAGAAGAGTGGATGG + Intergenic
1113662746 13:112118236-112118258 GTGTGGTAGAGGAGAGAGGACGG + Intergenic
1114297222 14:21340822-21340844 TAGTGGAATAGGAGAATGCATGG - Intronic
1114388735 14:22283018-22283040 ATGTGGAAGAGGGTAAGGGGAGG + Intergenic
1114615967 14:24068638-24068660 ATGGGGAAGAGGAGAAGGAGGGG + Exonic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1117130366 14:52680400-52680422 ATTTGGAAAAGAAGATTGGAGGG - Intronic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1119092695 14:71799452-71799474 ATCTGGAAAATGAGACTGGATGG + Intergenic
1119112873 14:71991337-71991359 ATGTGGAAGATGAGGAGAGAGGG - Intronic
1119825516 14:77654234-77654256 ATGTGGCAAAGGAGAAGAGAGGG - Intergenic
1120281612 14:82445879-82445901 ATCTGGAAGAAGAAAAAGGATGG + Intergenic
1120484787 14:85099388-85099410 AAGAGAAAGAAGAGAATGGAAGG + Intergenic
1120929236 14:89831660-89831682 ATGGTGAAGGGAAGAATGGAAGG + Intronic
1121169536 14:91841955-91841977 AGGTGGAAGGGAAGGATGGATGG - Intronic
1122589487 14:102836992-102837014 AAGAGCAAGGGGAGAATGGAAGG - Intronic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124096000 15:26649288-26649310 ATATGGAAGAGGAGACAGAAGGG - Intronic
1124868814 15:33520450-33520472 ATGAGGAGGAGGAGTATGGGTGG + Intronic
1125240123 15:37564902-37564924 ACGGGGAAGAGGATAAGGGAGGG - Intergenic
1125254899 15:37752353-37752375 ATGTGGTAAAATAGAATGGAAGG + Intergenic
1125467100 15:39964612-39964634 ATGGGGTAAAGGAGAATAGAGGG + Intronic
1125673704 15:41491366-41491388 ATGTGAATGAGGAGGATAGATGG + Intergenic
1125893281 15:43281735-43281757 ATGAGGAAGAGGTGATTCGATGG + Intronic
1126193443 15:45903541-45903563 AAGGAGAAGAGGAGAAAGGAAGG - Intergenic
1126556005 15:49988419-49988441 ACGTGAAAGAACAGAATGGAGGG + Intronic
1126684161 15:51232793-51232815 AGGTGCAAGAGGACAAGGGATGG - Intronic
1127269127 15:57385192-57385214 ATGTTAAACAGGAAAATGGATGG - Intronic
1127637723 15:60887643-60887665 ATTTGGACGGGCAGAATGGAGGG + Intronic
1127980193 15:64029377-64029399 ATGTGGAGAAGGTGAAGGGATGG - Intronic
1128271213 15:66311555-66311577 ATGTGGTAGTAGAGAATGAATGG + Intronic
1129012400 15:72433273-72433295 TGGGGGAAGTGGAGAATGGAGGG - Intergenic
1129665356 15:77576502-77576524 AGCTGGAAGGGGAGAAAGGAAGG + Intergenic
1129787327 15:78318508-78318530 ATGTGGAGGAGGAAATTGAAAGG + Intergenic
1129917101 15:79283363-79283385 TTGTGGGAGACGGGAATGGAAGG + Intergenic
1130070953 15:80646518-80646540 ATGTGACAGAGGGGAATGGAGGG - Intergenic
1130924672 15:88375956-88375978 ATGAGGAAGAGAAGGAAGGAGGG - Intergenic
1132115558 15:99133024-99133046 ATGAGGAGGAGGAGAATGATGGG + Exonic
1133394896 16:5439016-5439038 ATGTGGTAGAGAATAATGGGGGG + Intergenic
1133543927 16:6786617-6786639 AAGGGGATGAGGAGAATGGATGG + Intronic
1133980725 16:10631421-10631443 CTGTGTAAGATGAGATTGGAAGG + Intronic
1134381191 16:13727948-13727970 ATGTGGTACAGGAGAACTGAGGG + Intergenic
1135934808 16:26770636-26770658 AGGTGGAGGAGGAGAAGGGCAGG + Intergenic
1136618456 16:31412631-31412653 ATGTAGGAGTGGAGATTGGAAGG - Intronic
1136628122 16:31473880-31473902 CGCTGGAAGAGGAGAATGGAGGG - Exonic
1136852191 16:33621065-33621087 AAAGGGAAGAGGAGAAGGGAAGG - Intergenic
1137284619 16:47004876-47004898 ATGTGGTAAAAGAGATTGGAAGG + Intergenic
1137394975 16:48110595-48110617 ATGTGGAAGATGAGCCTGGTGGG - Intronic
1137715096 16:50593672-50593694 ATGTGGGTGAGAGGAATGGAGGG + Intronic
1138272575 16:55706348-55706370 CTATGGAAAAGGAGATTGGAAGG + Intergenic
1138965040 16:62074016-62074038 ATGACAAAGTGGAGAATGGAAGG - Intergenic
1139047630 16:63081901-63081923 AAGTGGAAGGGAAGAATGGAAGG - Intergenic
1139206745 16:65036418-65036440 CTGTGGAAGAGGAACATGGCAGG - Intronic
1139431323 16:66912429-66912451 ATCTGGAGGAGGAGGAGGGATGG + Exonic
1139751849 16:69113709-69113731 ATGTGGAAGAAGAGCAAGAAAGG - Intronic
1140220569 16:73040657-73040679 ATGGGGAAGAAGAGAATTGCTGG + Intronic
1140914298 16:79480901-79480923 ATGTGGATGAGGAGATGGGTGGG + Intergenic
1141068728 16:80934274-80934296 ATGTGGAAGATGGGTTTGGAGGG - Intergenic
1141265730 16:82495259-82495281 ATATGGAAGAGAAGAAAGGAAGG - Intergenic
1141436940 16:84005177-84005199 ATGGGGAAGAGGAAAAGGGGAGG + Intergenic
1141664131 16:85457193-85457215 ATAAGGATGAGGAGAGTGGAAGG + Intergenic
1141673422 16:85504977-85504999 ATGCTGACGAGGAGAATGGTTGG - Intergenic
1141776406 16:86125870-86125892 GTATGGAACAGGAGACTGGATGG + Intergenic
1142218693 16:88842293-88842315 GTGAGGAAGAGGAGAAGGCAGGG - Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1143114731 17:4576119-4576141 ATGATGAAGAGGAGAAGGGAGGG - Intergenic
1143186448 17:5013265-5013287 ATAGGGAAGAAGAGAATGCAGGG + Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143391489 17:6561519-6561541 ATGAGGAAGAGGAGGAGGGGAGG - Intergenic
1143818378 17:9539246-9539268 ATGAGGAAGAAGAGAAAAGAGGG + Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1144072276 17:11685374-11685396 AAGCAGGAGAGGAGAATGGAGGG + Intronic
1144348916 17:14375570-14375592 AGGAAGAGGAGGAGAATGGAGGG - Intergenic
1144726394 17:17504671-17504693 AGGTGGAAGAGGAGAGGGGCTGG + Intergenic
1144812608 17:18010233-18010255 CTGTGGCAGAGGAGAATGCAGGG + Intronic
1145835041 17:27948505-27948527 TTGTCTATGAGGAGAATGGAGGG - Intergenic
1145935595 17:28712909-28712931 ATGAAGAGGAGGAGAAAGGATGG + Intergenic
1146424047 17:32719053-32719075 ATGTGGAACAGGAGTAAAGATGG - Intronic
1146487909 17:33259014-33259036 GTGGGGAAGAGCAGAAAGGAAGG + Intronic
1146556789 17:33831826-33831848 ATCTTGAAGAGGAGAGAGGAGGG + Intronic
1146824051 17:36008287-36008309 ATGGGGAGCTGGAGAATGGATGG - Intergenic
1147286812 17:39408902-39408924 ATGAGGAAGAGGAGGAAGAATGG + Exonic
1147298465 17:39504170-39504192 AGATGGAAGAGTAGGATGGATGG + Intronic
1147782361 17:42952758-42952780 CAGAGGAAGAGGAAAATGGACGG + Intronic
1147811874 17:43176857-43176879 ATGAGGGGGGGGAGAATGGAGGG - Intronic
1147897461 17:43759933-43759955 AGGTGCAAGAAGAGAAAGGAAGG + Intergenic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148394200 17:47295398-47295420 GAGTGGAAGAGGAGAAAGGGAGG - Intronic
1148481854 17:47965102-47965124 ATGGAAAAGAGGTGAATGGATGG + Intergenic
1148550179 17:48545472-48545494 CTGGGGAAGGGGAGAAGGGAAGG - Intergenic
1148733250 17:49850642-49850664 ATCTGCATCAGGAGAATGGAAGG - Intergenic
1148739010 17:49881300-49881322 ATGAGGGAGGGGAGAAGGGAGGG - Intergenic
1148816124 17:50329385-50329407 AAGTGGGAGAGGAGAAGGGAGGG - Intergenic
1149534430 17:57421533-57421555 AGGAGGAGGAGGAGAATGAATGG - Intronic
1149690043 17:58567877-58567899 AAATGGAGGAGGTGAATGGAAGG + Intronic
1149919793 17:60646552-60646574 ATGTGGAAGAGGAGACAGAAAGG - Intronic
1150848425 17:68682342-68682364 ACATGGAAGAGGAGACTGGTAGG - Intergenic
1151098404 17:71526644-71526666 ATGCGTTAGAGGAGAATAGATGG + Intergenic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1152240285 17:79157355-79157377 CTGTGGAAGGGGTGCATGGACGG - Intronic
1152466905 17:80471654-80471676 AAGGGGAAGAGGAGCAAGGAGGG - Intronic
1152686128 17:81694640-81694662 ATCTGGAAGAGGAGAAAAGATGG + Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1153166747 18:2270202-2270224 ATGTGGGAGCTTAGAATGGAGGG - Intergenic
1153219971 18:2853019-2853041 CTGAGGAAGAGGAGAAGGAAAGG + Intronic
1153579901 18:6562482-6562504 ATGTGGTAGAGGAAACTTGAAGG - Intronic
1154306590 18:13234856-13234878 ATTTGGGAGGAGAGAATGGAAGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155094667 18:22544299-22544321 ATGAGGAAGAGGCAAATGAAAGG - Intergenic
1155208268 18:23579111-23579133 ATGTGGGAGAGAAGGAAGGAAGG - Intronic
1155705695 18:28808870-28808892 ATGTGGAAGGAGAGAAGAGAAGG - Intergenic
1155984902 18:32219546-32219568 AGGTGGAAGAGTAGAAGGGCAGG + Intronic
1156202864 18:34854141-34854163 ATGGGGAGTAGGAGAATGGAGGG + Intronic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157951432 18:52042837-52042859 ATGTGGCAGAGCAGAATACAGGG + Intergenic
1158321706 18:56270676-56270698 AAATGGAAGAGGGGAAGGGAAGG + Intergenic
1158450681 18:57561732-57561754 ATGTGGTAGCAGGGAATGGAGGG - Intronic
1158519983 18:58163887-58163909 ATGTCGAAGAGAACAATGGCAGG - Intronic
1158898878 18:61942349-61942371 AGGTGGGAGAAGAGAAGGGAGGG - Intergenic
1158917914 18:62154776-62154798 ATGGGGAAGAGAAAAATGGGAGG + Intronic
1159243447 18:65774436-65774458 ATGTGGAAGATCTGAAGGGAAGG - Intronic
1159243786 18:65778443-65778465 TTGCAGAAGAGGAGAATTGAAGG - Intronic
1159556233 18:69947948-69947970 AGGAGGAAGAGGTGAAAGGAAGG - Intronic
1160410103 18:78669752-78669774 ATGTCGAAGAAGAGAATTTATGG - Intergenic
1160532435 18:79573425-79573447 ATCTAGAAGAGGAGGCTGGAAGG + Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161735116 19:5987356-5987378 AAGGGGAGGAGGAGAAGGGAAGG + Intergenic
1162365350 19:10245379-10245401 AAGGGGAACAGGAGAATGGAAGG + Intergenic
1163748417 19:19061413-19061435 AAGAGGTAGAGGAGACTGGAGGG + Intergenic
1164250010 19:23468037-23468059 AAGTGGAAGAGGAGAGGAGAAGG - Intergenic
1164638893 19:29811225-29811247 ATATGGAAGGGGCGCATGGAAGG + Intergenic
1164662929 19:29994315-29994337 ATGTGAATGAGGGGAAGGGAAGG - Intronic
1164741053 19:30575885-30575907 ATGTAGAAGAGGGGGAGGGACGG + Intronic
1164857700 19:31537849-31537871 TTCTGGAAGAAGAGAATGGAAGG - Intergenic
1165333965 19:35156199-35156221 CTGTGTCAGAGGAGAATGGGTGG + Intronic
1166386256 19:42383225-42383247 GTGTTGAAGAGGAGAGTGGCTGG + Intergenic
1166536771 19:43579592-43579614 ATGTGGATGAGTAAAATGAAAGG + Intronic
1166672446 19:44719008-44719030 AGGTGGAGGAGGAGGAGGGATGG + Intergenic
1166827404 19:45617926-45617948 ATTTAGAAGAGGAGTAAGGAGGG - Intronic
1167101380 19:47406260-47406282 ACATGGAGGAGGAGGATGGATGG + Intronic
1167191605 19:47993950-47993972 ATGTTAAAGGGGAGAATGGGTGG - Intergenic
1167775472 19:51551815-51551837 GTGAGGAAGAGGAGGAAGGAAGG - Intergenic
1167971717 19:53192091-53192113 AAGTGGAAGAGAAGGATAGAGGG - Intronic
1168142488 19:54398261-54398283 AAGTGGAGGATGAGAATGGAAGG + Intergenic
1168333339 19:55582195-55582217 CTGTAGAAGAGAAAAATGGAAGG + Intergenic
1168517254 19:57018061-57018083 ATGTAGAAGAGGAGATGAGATGG - Intergenic
925171109 2:1750748-1750770 ATGGGGATGGGGAGAAGGGAGGG - Intergenic
926419484 2:12682524-12682546 GTGGGGAAGAGGGGAAGGGAGGG + Intergenic
926660020 2:15454751-15454773 ATTGGGAAGTGGAGAAAGGAGGG - Intronic
926784440 2:16506693-16506715 CTGAGGGAGAGGAGTATGGAGGG - Intergenic
927927980 2:27026392-27026414 ATGTGGGAGTGGAGCAGGGAGGG - Exonic
927959403 2:27231447-27231469 ACCTGGAAGAACAGAATGGAAGG - Exonic
928101429 2:28439787-28439809 GTGTGGCAGAGGAGTGTGGAGGG - Intergenic
928752993 2:34492737-34492759 ATTTGGAAGAAGCTAATGGAGGG + Intergenic
928996967 2:37303195-37303217 ATGTGGGAGAGGGGACGGGACGG - Intronic
929755499 2:44760877-44760899 ATGGAGAAGAGGACAATGAATGG + Intronic
929821748 2:45279811-45279833 GTGTGGAAGAGAGGAAGGGAGGG - Intergenic
930231905 2:48851848-48851870 AGGTGGAAGAGGGAAATGGAAGG - Intergenic
930472391 2:51835047-51835069 ATGAGGAAGAAAGGAATGGAAGG - Intergenic
930788251 2:55294799-55294821 ATGTGAAGGAGGAGCATGTATGG + Intronic
931216070 2:60245975-60245997 AAGTGGAAGAGGAGACTGGCAGG + Intergenic
931667151 2:64617699-64617721 TTTTGGAAGGGGAGATTGGAGGG - Intergenic
931907921 2:66862704-66862726 ATGCTGAAGATGAGACTGGATGG - Intergenic
931911282 2:66902808-66902830 ATTTGGAAGGGGAGAATACAAGG + Intergenic
932360205 2:71098671-71098693 ATTTGTAAGTGGATAATGGAGGG + Intergenic
932460121 2:71876506-71876528 ATGTGGGAGAGGAGGAAGGTGGG - Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
933359281 2:81258292-81258314 ATGTGAAAGAGGACATTTGAAGG - Intergenic
933383271 2:81578314-81578336 ATTAGAAAGAGGAGTATGGATGG + Intergenic
933399026 2:81767617-81767639 ATGTGGTAGTGGAGAAGGCACGG + Intergenic
934053643 2:88233031-88233053 AAGTGGAAGAGAAAATTGGAAGG + Intergenic
934559087 2:95303036-95303058 ATGTGGCAGAGGTGACTGGGGGG - Intronic
934637805 2:96007044-96007066 ATGGGGAGGGGGAGAATGGAAGG - Intergenic
934795855 2:97098367-97098389 ATGGGGAGGGGGAGAATGGAAGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935116776 2:100143752-100143774 GTTTGGATGAGGATAATGGAGGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
936765663 2:115845547-115845569 ATGGGGAAGAGGAAAATAGAAGG - Intronic
937397981 2:121555499-121555521 ATTTTGAGGAGGAGGATGGAGGG + Intronic
937486231 2:122317723-122317745 ATGAGGAAGAGAAGAAGTGAAGG + Intergenic
937642747 2:124231871-124231893 ATGAGGAGGAGGAGAAGGAAAGG + Intronic
937836132 2:126471949-126471971 ATGGGGAAGATGAGGATGGGGGG - Intergenic
938189154 2:129258805-129258827 ATGTAGAGGAGGAGTGTGGAGGG + Intergenic
938197243 2:129339210-129339232 ATGTGGAACAGAAGCATGGCAGG - Intergenic
938588524 2:132715184-132715206 ATGTGCAAGAGGAAAAAGCAAGG - Intronic
938751890 2:134340032-134340054 GTGTGGAAGAGAAGAATTAATGG + Intronic
939890034 2:147725600-147725622 AGGTGGAAGAAGAGACAGGAGGG + Intergenic
940624795 2:156160220-156160242 ATCTGGAAGAGGATGATGAAGGG + Intergenic
940849278 2:158672803-158672825 AAGTGGAGGAGGACAAGGGAGGG - Intronic
941071000 2:160954366-160954388 ATGTGGAAAAGGAGTAAAGAAGG - Intergenic
941343698 2:164339909-164339931 ATGTGGAAAAGGAAAATGAAGGG + Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
942275959 2:174324040-174324062 ATAAGGAAGAGGGAAATGGATGG + Intergenic
942518539 2:176778936-176778958 ATGTGGAAAATGAGAATGTAAGG - Intergenic
942887915 2:180951117-180951139 TTCTAGAAGAAGAGAATGGAGGG - Intergenic
943328852 2:186534805-186534827 AAGTGAAAGAAGAGAAGGGAAGG - Intergenic
944349403 2:198709165-198709187 AAGAGAAAGAGGAAAATGGAAGG - Intergenic
944525769 2:200617961-200617983 AGGGGGAAGAGGAGAACTGAGGG + Intronic
944614125 2:201442609-201442631 ATGTTTAAGAGGATAATGGGGGG - Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946029542 2:216693661-216693683 GTGGGGAAGAGTAGAAAGGAAGG - Intronic
946035710 2:216740619-216740641 ATTTGGATGTGGGGAATGGATGG - Intergenic
946175714 2:217920994-217921016 AGAGGGAAGAGGAGAGTGGAGGG + Intronic
947190954 2:227504089-227504111 AGGAGGAAGAGGAGGAGGGAGGG + Intronic
947347941 2:229212855-229212877 GTGTGGGACAGGAGAATGGCTGG - Intronic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
948091900 2:235302098-235302120 GTGGGGAGGAGGGGAATGGAAGG - Intergenic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169163726 20:3405471-3405493 ATGTAGAAGTGGGGAAAGGAGGG + Intronic
1169269010 20:4185187-4185209 AGGAGAAAGAGGAGAATGGTTGG + Intronic
1169270056 20:4192349-4192371 TTTTGGAATGGGAGAATGGAGGG - Intergenic
1170126610 20:12970759-12970781 CTGAGGAAGGGGAGAAAGGATGG - Intergenic
1170336586 20:15276770-15276792 ATGTGGAAGAGAAGAGGTGATGG + Intronic
1170706502 20:18749020-18749042 AGGAGGAAGAGGGCAATGGAGGG + Intronic
1172791203 20:37506679-37506701 ATGGGGCAGAGGAAAATGAAAGG - Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1172847384 20:37938063-37938085 TTGTGGAAGAAGAGGCTGGAAGG + Intronic
1172876923 20:38170038-38170060 ATGTGGAAGATGCGATTGAAGGG - Intergenic
1173183027 20:40818923-40818945 GGGTGGAAGAGGAGAGAGGATGG - Intergenic
1173738631 20:45380022-45380044 AGAGGGAAGAGGAGAATGAATGG + Intronic
1174409244 20:50322827-50322849 AGGAGGAATAGAAGAATGGATGG - Intergenic
1175486315 20:59349065-59349087 ATGAGGCACAGGAGAGTGGAGGG + Intergenic
1175492223 20:59386986-59387008 TTGTGTTTGAGGAGAATGGATGG - Intergenic
1175616648 20:60405391-60405413 AAGTGGCAGAGGAGAAGGGAGGG + Intergenic
1175891491 20:62317969-62317991 GTGGGGAAGAAGAGAAAGGAAGG + Intronic
1176079069 20:63262615-63262637 CTGCAGAATAGGAGAATGGATGG - Intronic
1176754282 21:10714266-10714288 ATGGAAAAGAGTAGAATGGAGGG - Intergenic
1177201782 21:17965435-17965457 AGGAGGAGGAGGAGGATGGAAGG - Intronic
1177900500 21:26909032-26909054 AAGAGGAAGAGGAGAAGGGAGGG - Intergenic
1178319407 21:31593891-31593913 ATGTGGAAAAGGAAAAAGAAAGG - Intergenic
1179303829 21:40136817-40136839 ATGAGGAAGAGGAGCCTGGTGGG + Intronic
1179897991 21:44373892-44373914 ATGTGGTACTGGAGACTGGAGGG - Intronic
1180228875 21:46414478-46414500 AGGAGGAAGAGGAGAGTGGGCGG - Intronic
1181375176 22:22452383-22452405 ATGTGGAAGGGGAGAGGGTAAGG - Intergenic
1181860299 22:25812952-25812974 AAGAGAAAGAGGAGAAAGGAGGG - Intronic
1182118199 22:27769973-27769995 ATGAGGAAAAGGAGAGTCGATGG + Intronic
1182287429 22:29256671-29256693 ATGGGGTAGGGGAGCATGGAAGG + Intronic
1182627169 22:31655955-31655977 ATGTGGATGATGAGAAAGAAAGG - Intronic
1182761280 22:32724208-32724230 TATTGGAAGAGGTGAATGGATGG - Intronic
1184306535 22:43606874-43606896 ATGTGGGAAATGAGAGTGGACGG - Intronic
1184307657 22:43617521-43617543 ATGAGGAAGGGGAAAATGGATGG - Intronic
1184345744 22:43911625-43911647 TTAGGGAAGAGGAGAATGGTGGG - Intergenic
1184414145 22:44342356-44342378 CTTTGGAAGAGGAGAAAGGAAGG + Intergenic
1184600226 22:45539097-45539119 GAGGGGAAGAGGAGAAGGGAGGG - Intronic
949249167 3:1962077-1962099 ATCTGGGAGAGAATAATGGATGG - Intergenic
949306344 3:2645751-2645773 ATGATGAAGAGGTTAATGGATGG + Intronic
949741603 3:7240694-7240716 ATGTGGAAGAGGGGGAGGGAAGG - Intronic
949940177 3:9148724-9148746 ATGGGGTAGTGGAGAAAGGATGG - Intronic
950867170 3:16198495-16198517 CAGTGGAAGGGGAGAATGAATGG + Intronic
951128624 3:19014347-19014369 AGATGGAGGAGGAGAATGGTAGG - Intergenic
951369357 3:21826244-21826266 ATATGGGAGAGGGGAATGGCTGG + Intronic
952443244 3:33354841-33354863 ATGTGGAAAATCAGAATGAATGG + Intronic
952831880 3:37571797-37571819 AGGTGGCAGGGGAGCATGGAAGG + Intronic
953060641 3:39426128-39426150 AGAAGGAAGAGGAGAAAGGAAGG - Intergenic
953090826 3:39724461-39724483 AGGGAGATGAGGAGAATGGAAGG - Intergenic
953624691 3:44561257-44561279 TTGTGGCAGAAGAGAATGCAGGG + Intronic
954154431 3:48677463-48677485 AAGGGGAAGAGAAAAATGGAAGG - Intronic
954471086 3:50695912-50695934 ATGTGGTAGAGGAGGATTTATGG + Intronic
954751687 3:52817615-52817637 GTGTGGATGAGGGGAATGGCAGG - Intronic
955056166 3:55457810-55457832 AATGGGAAGAGGAAAATGGAAGG - Intergenic
955144238 3:56300193-56300215 AGGGAGCAGAGGAGAATGGAGGG + Intronic
955148543 3:56344313-56344335 ATGAGGAGGAGGAGGAGGGAAGG - Intronic
956374735 3:68602365-68602387 ATGTTGAAGATGAGACTTGATGG - Intergenic
956507522 3:69958486-69958508 AGGTGGAACCGGTGAATGGAGGG - Intronic
956514671 3:70033716-70033738 ATGAGGAAGAGGAGACTGCTTGG + Intergenic
957024001 3:75159143-75159165 ATGGTAAAGAGGAGAATGGATGG - Intergenic
957548617 3:81674143-81674165 ATGAGAAAGAGGAGAATTTAGGG - Intronic
957748308 3:84374719-84374741 AGGTGGAGGAGGAGAAAGGGAGG + Intergenic
957839083 3:85642456-85642478 AGGAGGAAGAATAGAATGGAAGG + Intronic
957852019 3:85820448-85820470 ATGAGGATGATGAGAATAGATGG + Intronic
958061258 3:88484500-88484522 ATATGGGAGTGGAGGATGGATGG + Intergenic
958094672 3:88928675-88928697 TTGTGGAAGAGGAGCAAGGTAGG - Intergenic
958404609 3:93738487-93738509 ATCTGGAAGAGGACATTTGAAGG - Intergenic
958883197 3:99696530-99696552 AGATGGAAGAGCAGATTGGAGGG + Intronic
959172273 3:102857907-102857929 AGGAGGAAGAGGAGGAGGGATGG - Intergenic
959197481 3:103203083-103203105 AGATGAAAGAGGAGAAAGGAAGG - Intergenic
959659104 3:108845373-108845395 ATGTGGGCTAGGAAAATGGATGG + Intronic
959837668 3:110939505-110939527 ATGAGGAAGAGAAAAATGAAGGG + Intergenic
959922883 3:111888923-111888945 ATGTGGAAGAGAACAATGAAGGG - Intronic
960088313 3:113613983-113614005 ATGGGGTAGAGGGGAATGAAAGG + Intronic
960231709 3:115235704-115235726 AAGTGGAAGAGGATAAAGAAAGG - Intergenic
960305882 3:116060147-116060169 AGGGGGAAGAGGAGAAATGAAGG - Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960696098 3:120398086-120398108 TGGAGGAAGATGAGAATGGAGGG + Intronic
960715349 3:120569521-120569543 ATGAGGAACAGGAGAGTTGATGG + Intergenic
961212465 3:125136341-125136363 ATGTGGGAGAAGAGTCTGGAAGG - Intronic
961772103 3:129257606-129257628 AGCTGGAAGAGGAGGATGGCAGG + Exonic
962012154 3:131402268-131402290 ATGTGGAAGAGGTGGATGAGTGG + Intergenic
962030047 3:131590096-131590118 AATTGGGAGAGGGGAATGGAAGG - Intronic
962081660 3:132145719-132145741 ATGTGAGAGATGAGACTGGAAGG + Intronic
962270274 3:133973065-133973087 AAGTGGAAGATGAGAGAGGATGG + Intronic
962398237 3:135036040-135036062 ATGTGGAAATAGTGAATGGATGG - Intronic
963194122 3:142507412-142507434 TTGTGGAGGAGGAGTTTGGAAGG - Intronic
963624348 3:147652029-147652051 GGGAGGAAGAGGAGAAGGGAGGG + Intergenic
963676758 3:148322018-148322040 ATATGGAAGAGGGGAATAAAAGG + Intergenic
963932971 3:151023457-151023479 AGGAGAAAGAGGAGAAAGGAAGG + Intergenic
964568156 3:158081029-158081051 GTGAGGATGAGGAGAAGGGAAGG + Intergenic
964663484 3:159147366-159147388 ATGAGGAAGAGGAGAAGCAAAGG - Intronic
965403228 3:168238570-168238592 ATGTGGAACAGGAGAATCCATGG + Intergenic
965680188 3:171242310-171242332 ATGAGGAAGAGGAGGAAGGAAGG - Intronic
966065050 3:175810722-175810744 ATGTTCAAGAAAAGAATGGAAGG - Intergenic
967151446 3:186654222-186654244 ATTGGGAGGAGGAGATTGGAAGG - Intergenic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967413267 3:189188520-189188542 ATGTGGAGGAGGAAAAGGGAAGG - Intronic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
968035559 3:195544681-195544703 ATGTGGATGGAGATAATGGAGGG + Intergenic
968259800 3:197311416-197311438 ACTGGGAAGAGGAGAATGAAAGG + Intergenic
968331977 3:197878577-197878599 AGGTGGAAGGGGAGAAGGAAGGG - Intronic
969073541 4:4558846-4558868 ATGGGGCAGAGCAGGATGGAGGG - Intergenic
969197192 4:5572461-5572483 ATGTGGCAGAGGGGATGGGAAGG - Intronic
969226317 4:5800728-5800750 ATGGGGCAGAGGAGAAGGAAAGG + Intronic
970028197 4:11646947-11646969 AAGAGGAAGAGGAGAAAGGAAGG + Intergenic
970126273 4:12815671-12815693 ATGTTGGAGAGGAGAAATGAAGG + Intergenic
970646557 4:18128179-18128201 AAAAGGAAGAAGAGAATGGATGG - Intergenic
971374375 4:26044972-26044994 ATGGGAAAGAGGGGAGTGGATGG - Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971566848 4:28155473-28155495 ATGTTGAAGAGTGGAATTGATGG + Intergenic
971626620 4:28928694-28928716 ATAAGGAAGATGAGAAAGGAAGG - Intergenic
972098711 4:35383639-35383661 AAATGGAAGAGGAGAAGGAAGGG - Intergenic
972229525 4:37055014-37055036 AGGTGAAAGAGGACACTGGAGGG - Intergenic
972605776 4:40612181-40612203 ATGTGGATGTGGAGAATTAATGG + Intronic
972828666 4:42788957-42788979 ATGGGGAAGAGGCATATGGATGG + Intergenic
973163668 4:47050844-47050866 ATATGGAAAAAGAGAGTGGAAGG - Intronic
973849301 4:54945520-54945542 ATCTGGCAGAGGAGGAGGGAGGG + Intergenic
973856208 4:55012725-55012747 ATGTGGAAGAAAAGCATGTAGGG - Intergenic
974667672 4:64986110-64986132 AAGTGGAAAAGGATAAGGGAAGG + Intergenic
975073754 4:70178389-70178411 AGGGAGGAGAGGAGAATGGAGGG - Intergenic
975771822 4:77732797-77732819 ATGTGTTAGAAAAGAATGGAAGG + Intronic
975858513 4:78650663-78650685 ATCTGGAAGAGCAGAAAGCATGG - Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976239764 4:82942813-82942835 ATGTGTATGAGGAGAAGGCAGGG - Intronic
976374184 4:84325346-84325368 ATGAGGAAGGGGAGCATGGGTGG + Intergenic
976777161 4:88719480-88719502 AGGAGGAGGAGGAGAAGGGAAGG - Intergenic
976892858 4:90071611-90071633 ATATGGGAGAGGAGAGTGGATGG - Intergenic
976962023 4:90989237-90989259 ATGTTTAAGAGGAGACTGAAAGG - Intronic
977406906 4:96610987-96611009 ATGTGCAGGAAGAGAATGAAAGG + Intergenic
977444427 4:97111393-97111415 ATGTGGAACAGAAAAATGGAAGG - Intergenic
977521386 4:98088806-98088828 GGGTGGAAGAGAAGAATGGTTGG - Intronic
979663343 4:123283977-123283999 AAGAGGAAGAGAAGAAGGGAAGG - Intronic
980146003 4:128985136-128985158 TTGTGGAAGTAGAGAATTGAAGG - Intronic
980190698 4:129520562-129520584 AGGAGGAAGAGGGGAAAGGAGGG + Intergenic
980768496 4:137339961-137339983 ATAGGAAAGAGAAGAATGGACGG - Intergenic
980792346 4:137635603-137635625 AGGAGGAAGAGGAGGAGGGAAGG + Intergenic
980981426 4:139657580-139657602 AAGAGGAGGAGGAGAAGGGAGGG + Intergenic
981033747 4:140151224-140151246 AGGAGGAAGAGGAGGAGGGAAGG + Intronic
981122613 4:141070057-141070079 ATGTGGCAGAGCAGAACTGAAGG - Intronic
981344077 4:143655008-143655030 GTGTGGAAATGGAGGATGGAGGG - Intronic
981829083 4:148979610-148979632 TTGGGGAGGAGGAGAAAGGAAGG - Intergenic
981849742 4:149216216-149216238 ATGAGGAACAGGAGAAAGCAAGG + Intergenic
981982843 4:150816142-150816164 AGGTGGAACAGCAGAATAGAAGG + Intronic
982240646 4:153296256-153296278 AAGAGGAAGAAGAGAAAGGAGGG - Intronic
982245816 4:153349316-153349338 ATGTGGAAGAGAAGATGGAAGGG - Intronic
982373981 4:154667308-154667330 AGGAGGAGGAGGAGAATGGGAGG + Intronic
983288905 4:165775930-165775952 TTGTGGAAGAGGACTATGTAAGG - Intergenic
983973424 4:173902049-173902071 ATGTGAAAGATGAGAGTGGATGG + Intergenic
985026488 4:185744068-185744090 AAGTGGAAGAGGAGGAGGAAAGG - Intronic
986879104 5:12147873-12147895 AGGAGGAGGAGGAGGATGGATGG - Intergenic
987148131 5:15012446-15012468 TTGGGGAAGTGGAGGATGGAGGG + Intergenic
987692284 5:21282687-21282709 CCGTGGAACAGGAGACTGGAGGG - Intergenic
988015484 5:25552592-25552614 ATATGAAAGCAGAGAATGGATGG - Intergenic
988032402 5:25780322-25780344 ATGAGTAAAAGAAGAATGGATGG + Intergenic
988528251 5:32005043-32005065 ATGTGGATGAGGACCTTGGATGG - Intronic
988616877 5:32783204-32783226 TTGTGGAAGAGAAGACTGGAAGG - Intronic
988894456 5:35657030-35657052 CTGGAGGAGAGGAGAATGGATGG - Intronic
989546800 5:42683695-42683717 AGGTGGAAGGGAAGAAAGGAAGG + Intronic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990729303 5:58790936-58790958 AGGAGGAACAAGAGAATGGAAGG - Intronic
991196286 5:63936364-63936386 ATGTAGAAGAGGAGAAGGTGGGG + Intergenic
991221216 5:64221214-64221236 TTGAGGAAGAGGAGAATGAATGG - Intronic
991308103 5:65202954-65202976 ATGTGGAGGAAGAGAAGAGAAGG - Intronic
993041122 5:82816001-82816023 GTGTGGAAGAGGAGAAAGAGTGG - Intergenic
993234686 5:85289304-85289326 GTGGGGAAGAGGAGGAAGGAAGG + Intergenic
994243433 5:97450501-97450523 ATGAGCATGAGGAAAATGGAAGG - Intergenic
995299426 5:110560230-110560252 GTATGGAAGAGGAGAATGACTGG - Intronic
995337987 5:111024551-111024573 ATGGGGCAGAAGAGAAAGGAAGG - Intergenic
995714411 5:115068191-115068213 ATCTGGAAGATGAGAATCAAAGG + Intergenic
996409049 5:123137034-123137056 ATGTGAAATAGGTTAATGGATGG + Intronic
997384070 5:133458772-133458794 AGGTGGGAGAGGAGGAGGGAAGG + Intronic
998566094 5:143217171-143217193 ATAAGGAAGAGGAAAAGGGAGGG + Intronic
998908183 5:146929140-146929162 ATGTGGAAGAAGAGAGAGGTAGG - Intronic
999679944 5:154047430-154047452 GTGGGGAAGAGTAGAAAGGAAGG + Intronic
999943201 5:156567276-156567298 GTGTGGAGGGGGTGAATGGATGG + Intronic
1000209797 5:159098551-159098573 AGGAGAAAGAGGAGAAAGGAGGG + Intronic
1000486483 5:161850619-161850641 AAGGGAAAGTGGAGAATGGATGG + Intronic
1000752460 5:165113876-165113898 AGGTGGAAGGGGAGCCTGGAGGG - Intergenic
1000944332 5:167401869-167401891 AAGTGACAGAGGAGAAAGGAAGG + Intronic
1001473790 5:172034998-172035020 AGGTGAAGGAGGATAATGGAGGG + Intergenic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001783724 5:174393448-174393470 AGGATGAAGAGGAAAATGGAAGG + Intergenic
1002331194 5:178442121-178442143 AAGGGGAAGAGGAGAAAGCAGGG - Intronic
1002453207 5:179331310-179331332 ATGAGGGAGAAGAGAAGGGAGGG + Intronic
1002844886 6:937360-937382 AGGAGGAGGAGGAGGATGGAGGG - Intergenic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1005361408 6:25034871-25034893 ATGGGAAACTGGAGAATGGAAGG - Intronic
1005361870 6:25038562-25038584 ATGTGGCAGAGAACAATGGGTGG + Intronic
1005461126 6:26071255-26071277 ATATGGAAGTGGGGAAGGGAAGG + Intergenic
1005605969 6:27477787-27477809 AAGAGGAAGAGGAGAAACGAAGG - Intergenic
1005765403 6:29006321-29006343 AAGACGAAGAGGAGGATGGAAGG - Intergenic
1006489709 6:34376736-34376758 ATGTGTGAGAGTAGAATGCAGGG - Intronic
1006976501 6:38107325-38107347 ATGTGGAAGAGGTGAAGTGGAGG + Intronic
1007563691 6:42831672-42831694 ATGTGGAGGAGGAGAAAGGCAGG - Intronic
1008075601 6:47142514-47142536 GAGTGGAAGAGGAGTAAGGAAGG - Intergenic
1008165727 6:48135880-48135902 ATGTGGAAGGGGATTATGCAAGG + Intergenic
1008870350 6:56265454-56265476 AAGTGGAATAGGAGGAAGGACGG - Intronic
1010368010 6:75075116-75075138 ATGTGGAGGAGGAAAATGAAGGG - Intergenic
1010960835 6:82143961-82143983 AAGTGGAAGAGCAGAGGGGAGGG + Intergenic
1011840649 6:91493887-91493909 AAGTGGAAGAGAATAATGCATGG + Intergenic
1012150963 6:95751869-95751891 ATGTGGAAGAGGAGAAGATAGGG + Intergenic
1012797694 6:103783971-103783993 ATGAGGAAGAGGTGAGTTGAGGG + Intergenic
1013050322 6:106527699-106527721 ATTTGGAAGATGGGAATAGAAGG - Intronic
1013381781 6:109579891-109579913 ATGTTGAAAAGGCAAATGGAAGG + Intronic
1013639628 6:112060507-112060529 GTGTGGAAGAGCAGAGTGGAAGG + Intronic
1013661869 6:112306244-112306266 AAGAGGAAGAGGAGAAGAGATGG - Intergenic
1014298498 6:119650754-119650776 ATGTGGAAAAGAAGAATGTAAGG - Intergenic
1014820393 6:125982791-125982813 CTGAGGAAAAGGAGGATGGATGG - Intergenic
1015526043 6:134175870-134175892 ACTTGGAAGAGGAGGAAGGAAGG + Intronic
1015592617 6:134836984-134837006 ATGTGGAAGAAGAGGAGTGAAGG - Intergenic
1015689387 6:135904505-135904527 ATTTGGAAATGGAGAAAGGATGG - Intronic
1015836531 6:137426240-137426262 TTGTAGAAGATGAGAATGGAAGG + Intergenic
1016307173 6:142696527-142696549 AGGCAGAAGAGGAGAGTGGAGGG - Intergenic
1016683954 6:146860695-146860717 CTGTGGAAAAAGAGAATGCATGG - Intergenic
1016779597 6:147943467-147943489 AGGAGGAGGAGGAGGATGGAAGG - Intergenic
1017520063 6:155194259-155194281 ATGGGGAAGAGGAGAAGGTAGGG + Intronic
1017561689 6:155635086-155635108 ATGCAGAAAAGGAGAAAGGAAGG + Intergenic
1017665118 6:156712564-156712586 AAGAGGAAGAGGAGGAAGGAAGG + Intergenic
1018182071 6:161232750-161232772 ATCTGGAGGAGGAGAATGAGAGG - Intronic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018583227 6:165326152-165326174 GTGTGGAAGGAAAGAATGGAAGG - Intergenic
1019772807 7:2894407-2894429 AAGAGGAAGAGGAGGAGGGACGG - Intergenic
1019834751 7:3371636-3371658 AAATAGAAGAGGAGTATGGATGG + Intronic
1021629814 7:22633653-22633675 ATGATGAAGAGGAGAGGGGATGG + Intergenic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022299962 7:29093778-29093800 TTATGGATGAGGAAAATGGAAGG + Intronic
1022547619 7:31203398-31203420 ATGTGGAAGGGAGGCATGGAGGG + Intergenic
1023348551 7:39296422-39296444 GAGAGGAAGAGGAGAAGGGATGG - Intronic
1023444234 7:40215440-40215462 ATGTTCAAGAGGAGAGTGGGTGG - Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024677252 7:51647775-51647797 ATGAGGAGGAGGAGGAAGGAGGG - Intergenic
1024785351 7:52901164-52901186 ATATGGAGGAACAGAATGGAGGG + Intergenic
1026023731 7:66729430-66729452 AGGTTGGAGAGGAGAATAGACGG - Intronic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026491730 7:70869491-70869513 ATGTGGAAGATGAGATTGCTTGG - Intergenic
1028112252 7:86955488-86955510 GGCTGGAAGAGGAGAAAGGAAGG + Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028447924 7:90945931-90945953 ATATGGAAGAGGAGTAGGAAGGG + Intronic
1029275238 7:99400026-99400048 CTCTGGAAGAGGGGAATGGAGGG + Intronic
1030039823 7:105439611-105439633 TGGTGGAAGAGGAGAATAGGAGG + Intergenic
1030240108 7:107313234-107313256 AAGTAAAAGAGGAGAATGAAAGG + Intronic
1030341388 7:108384532-108384554 ATTTGGCAGAGGAGATTTGAAGG + Intronic
1030593483 7:111508750-111508772 ATGTGAAATAGGTGAATGGTGGG + Intronic
1030644527 7:112045115-112045137 ATGAGGAAGGGGAAAATGGCAGG - Intronic
1031072772 7:117180296-117180318 ATGTGGAAGAGGGGAACAGGTGG + Intronic
1031921112 7:127601240-127601262 ATGTCGGAGATGAGATTGGATGG - Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032606486 7:133360336-133360358 ATGTGGGAAAAGAGAATGGTTGG + Intronic
1032874951 7:136028201-136028223 TTGTGCAAGAAGAGAAAGGAAGG - Intergenic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033460152 7:141539853-141539875 CTATGGAAGAGGAAAATGGCTGG + Intergenic
1034099343 7:148437713-148437735 ATATGGAAGTGGGGAATGGAAGG - Intergenic
1034336213 7:150325148-150325170 AAGTGGAAGAGGAGGAATGATGG - Intronic
1034350675 7:150412868-150412890 ATAAGGAAGAGGAGCAGGGAAGG - Intergenic
1034906813 7:154956349-154956371 TTCTGGAAGTGGGGAATGGAAGG + Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1034979987 7:155469564-155469586 CTGAGAAAGAGGAGAATGGCTGG - Intergenic
1036091434 8:5669847-5669869 ATATAGAGGAGGAGAATGGCGGG - Intergenic
1036459277 8:8937587-8937609 AGGTGGAAGAGGTGGAAGGAAGG + Intergenic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037654198 8:20868873-20868895 AGGTGGGAAGGGAGAATGGATGG - Intergenic
1037743895 8:21628403-21628425 ATGAGGAAGAGAAGAAGAGAAGG + Intergenic
1038302003 8:26360226-26360248 ACTTGAAAGAGGAGGATGGAAGG + Exonic
1038476951 8:27875258-27875280 ATGTAGAAGGGAAGAAAGGAAGG - Intronic
1038660682 8:29494053-29494075 ATTTGAATGAGGAGAAAGGATGG - Intergenic
1038682665 8:29683775-29683797 GTGTGGAAGAGTGGAATGGATGG + Intergenic
1038764517 8:30414899-30414921 AAGGGGAAAAGGAGAATGTAGGG - Intronic
1038900841 8:31841990-31842012 ATGGGGAGGAGGAGGAGGGAAGG - Intronic
1039364575 8:36916385-36916407 ATGAGGAAGGGGAGAAAGAAAGG + Intronic
1039798350 8:40933951-40933973 ATGTGTAGGAGGAGATTTGAAGG + Intergenic
1040615112 8:49027484-49027506 ATGTGGAACAACAGAATGGCAGG - Intergenic
1041031464 8:53739996-53740018 ATGTGGAAGGGGAGAAACGCTGG + Intronic
1042877656 8:73454619-73454641 GTGTTGAAGAAGAGAGTGGATGG - Intronic
1043108948 8:76152871-76152893 ATGAGGAAAAGAGGAATGGAAGG + Intergenic
1043394326 8:79822010-79822032 TTTTGGAAGAGCAGAGTGGAGGG - Intergenic
1043427072 8:80158238-80158260 GTGGGGAGGAGGAGAATGGGAGG - Intronic
1043563694 8:81524061-81524083 ATGACGAAGAGGACAATGGAAGG - Intergenic
1043637081 8:82399170-82399192 CAGTGGAAGAGGAGAATGTCAGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044160851 8:88913180-88913202 AACTGGAAGAGAAGAAAGGAGGG + Intergenic
1044256663 8:90071406-90071428 AGGGGGAAGAGGAGAAGGGAGGG + Intronic
1044275358 8:90293105-90293127 ATGTGGATCAGGATAATGTAGGG - Intergenic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1044983235 8:97736360-97736382 AGGGGGAGGAGGAGAAGGGAGGG + Intergenic
1046013288 8:108575804-108575826 AAATGAAAGAAGAGAATGGAAGG - Intergenic
1046143330 8:110122898-110122920 ATGTGAAAGAGGTGAAAGGAGGG + Intergenic
1046522759 8:115346340-115346362 ATTTGGCAGAGGTGAGTGGAAGG + Intergenic
1046526649 8:115389500-115389522 TTGTGGAAGAGCAGAGTAGATGG - Intergenic
1047309909 8:123683241-123683263 TTGTGGAGGAGGAGAAAGGAGGG + Intronic
1047708335 8:127524824-127524846 AAATGGGAGAGGATAATGGAGGG + Intergenic
1048301547 8:133254926-133254948 TTTTAGAAGAGGTGAATGGATGG - Intronic
1048317305 8:133371684-133371706 ATGAGGAAGAGCAGAAAGGAAGG + Intergenic
1048535445 8:135290276-135290298 ATGGGGAAGAGAAGAAAGGCTGG - Intergenic
1048774938 8:137935304-137935326 AGGTAGTAGAGTAGAATGGAAGG + Intergenic
1048811736 8:138294235-138294257 ATCAGAAAGAGGAGAGTGGAAGG + Intronic
1048866969 8:138768389-138768411 TTGGCGGAGAGGAGAATGGAAGG - Intronic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049035521 8:140072554-140072576 AGGAGGAGGAGGAGAAAGGAAGG + Intronic
1049035527 8:140072574-140072596 AGGAGGAGGAGGAGAAGGGAAGG + Intronic
1049258476 8:141626256-141626278 ATGAGGAAGGGGTGGATGGATGG + Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1050253704 9:3772268-3772290 AGGTGGAAGAGGAGGTGGGAAGG + Intergenic
1051496686 9:17731380-17731402 AAGAGGAAGAGGAAAAGGGAGGG + Intronic
1051950715 9:22628830-22628852 ATGAGGAGGAAAAGAATGGAAGG - Intergenic
1052805823 9:33012402-33012424 ATGTGGAAGGGGACTATGGAAGG - Intronic
1052915596 9:33922600-33922622 CTGAGGAAGAGGAGAAGGGAAGG + Intronic
1052986564 9:34492190-34492212 ATGTGGAATAGGAGACTGGGGGG + Intronic
1052998779 9:34565907-34565929 GGGTGGGAGAGGAGAAGGGAAGG + Intronic
1053125381 9:35576632-35576654 CTGTGGAAGAGAGGAAGGGAAGG - Intergenic
1053239030 9:36481360-36481382 AGGTGGAAGAGTAGAATGATGGG - Intronic
1054841496 9:69746057-69746079 TTGTGAAAGAGGAGAAGAGAAGG - Intronic
1054924328 9:70574281-70574303 ATGTGCAAGGAGAGAATGGTAGG - Intronic
1055337594 9:75248226-75248248 AGGAGGAAGAGAAGAATGGTAGG - Intergenic
1055420527 9:76136331-76136353 TTGGGGAAGTGGAGAATGCAGGG + Intronic
1055652419 9:78419335-78419357 AAGTGGCAAAGGAGGATGGATGG + Intergenic
1056688036 9:88782861-88782883 ATGGGGAAGGGAAGAGTGGAGGG + Intergenic
1056942505 9:90967400-90967422 ATGTGTAAAAGGAGAAAGGGAGG - Intergenic
1057931304 9:99195909-99195931 GTGGGGAAGAGCAGAATGGAAGG - Intergenic
1057947821 9:99344973-99344995 ATGAGGAAGAGAGGAGTGGATGG + Intergenic
1058345707 9:103958652-103958674 ATGTGGAAGAGCATAAAGGCGGG - Intergenic
1058985846 9:110207777-110207799 ATGTGGGGGAGGAGAAAGGTGGG + Exonic
1059335362 9:113565418-113565440 AGGAGGAAGAGGAGGAGGGACGG + Intronic
1059438919 9:114291860-114291882 TTGTGGGAGAGGAGAGGGGAAGG + Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1060146913 9:121260885-121260907 AAGGGGAGGAGGAGAAAGGAGGG + Intronic
1060225303 9:121786661-121786683 ATGTGGAGGATGAGCAGGGAAGG - Intergenic
1060452393 9:123755489-123755511 AGGTGGAAGAGGAGGAAGGGAGG - Intronic
1060828749 9:126700926-126700948 AGGTGGAAGGTGAGAGTGGAGGG - Exonic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061842438 9:133367130-133367152 CTGGAGAAGAGGGGAATGGAGGG + Intronic
1062163909 9:135096143-135096165 AGGAGGAAGAGGAGGATGAAGGG - Intronic
1062302016 9:135879087-135879109 ATGAGGAGGAGGGGAGTGGAGGG + Intronic
1062683689 9:137799041-137799063 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1062683708 9:137799121-137799143 GTGTGGAAGAGGACGCTGGAGGG - Intronic
1203726758 Un_GL000216v2:56069-56091 ATGGAGAGGAAGAGAATGGAAGG - Intergenic
1185701215 X:2231822-2231844 ATGAGAAAGAGGAGAAAGAAAGG - Intronic
1185714465 X:2330137-2330159 AGGAGGAGGAGGAGAAAGGAAGG + Intronic
1185770136 X:2759735-2759757 ATGAGAAAGAGGAAAATGGCTGG - Intronic
1186125553 X:6409980-6410002 AGGTGGAAGAGGAGGAAGAAAGG + Intergenic
1186211535 X:7254970-7254992 ATGAGGAGTAAGAGAATGGAAGG - Intronic
1186246617 X:7622486-7622508 AGGAGGAAGAGGGGGATGGAGGG - Intergenic
1186363746 X:8870391-8870413 ATGTGGAGGAGGAGCAGGAAAGG + Intergenic
1186953190 X:14650888-14650910 ATCTGGAATAAGTGAATGGAGGG + Intronic
1186976841 X:14916923-14916945 ATGTAGAAAAGGAGAATAGAAGG + Intronic
1188006462 X:25019138-25019160 ACCTAGAAGAGGAGAGTGGAAGG + Intergenic
1188673657 X:32912074-32912096 AGGAGGAAGAGGAGAAGGAATGG + Intronic
1188832339 X:34914475-34914497 ATGTGGAATAGGAAAATTTAAGG + Intergenic
1189075221 X:37907266-37907288 TTGTGGGAGAGAAAAATGGATGG + Intronic
1189256323 X:39642508-39642530 ATGAGGAGGAGGAGTAGGGAGGG + Intergenic
1189634520 X:42991677-42991699 ATGTGCACAAGGAGAATGCATGG + Intergenic
1189758441 X:44296212-44296234 ATGTGGAAAAGGAGAAAGCTGGG + Intronic
1189784713 X:44549108-44549130 AATTGGAAGAGTAAAATGGAGGG + Intergenic
1189856784 X:45231634-45231656 ATGAGGAAGAGGAGCTTGTAGGG + Intergenic
1189863634 X:45300318-45300340 AAGGGGAAGAGCAGACTGGAGGG - Intergenic
1190246076 X:48691235-48691257 GCCTGGAAGAGGAGAGTGGAGGG - Exonic
1190591130 X:52002422-52002444 ATGTGGAAGAGAGGAATCCAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191006089 X:55712837-55712859 AGGTGGAGGAGGAGAAGGGCAGG + Intergenic
1191791572 X:64976937-64976959 GTGGGGAAGAGGAGGATGGGAGG + Intronic
1191832748 X:65432504-65432526 ATGTGGAAGAGAAACTTGGAGGG + Intronic
1191967790 X:66779194-66779216 ATCTGGAAGGGGAGAAAAGAGGG + Intergenic
1192248441 X:69391698-69391720 ATGTGGAAGAGGGGAGAGCAGGG - Intergenic
1192330178 X:70169162-70169184 ATTTGGAAGAGGAGAATGCTAGG + Intergenic
1192345438 X:70300084-70300106 TTGTGCAAGAGAAGAAGGGAAGG - Intronic
1192424040 X:71060070-71060092 ATGGGGGAAAGGAGAATGGAAGG + Exonic
1192831817 X:74758156-74758178 TTGGGGAAGAGGAGAGTGGGTGG + Intronic
1193178695 X:78427320-78427342 AGGTGGAAGAGGAGTATGGGGGG + Intergenic
1194380609 X:93186530-93186552 ATGTGGGAAAGGAGTATGCAAGG + Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195676991 X:107514183-107514205 AAGAGGAAGAGTAGCATGGAGGG + Intergenic
1196034854 X:111132987-111133009 AGGTGGAAAAGAAGAATGAATGG - Intronic
1196077959 X:111598200-111598222 AAGGAGAAGAGGAGAATGGCTGG - Intergenic
1198093863 X:133358857-133358879 AAATGTAAGAGGATAATGGAGGG - Intronic
1198126140 X:133645823-133645845 ATGTGGAAGATGAGAGTGGGTGG + Intronic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1198218430 X:134578044-134578066 AGGTGGCAGGGGAGAAGGGAGGG + Intronic
1198671356 X:139084206-139084228 ATGGGGAAGAGGAGAAGGAGTGG + Intronic
1198810782 X:140534176-140534198 AGGTGGAAGAAGAGGAAGGAGGG + Intergenic
1198867017 X:141133908-141133930 TTGAGGAAGAGGAGACTGGAGGG + Intergenic
1199204633 X:145134452-145134474 ATAGGGAAGAGGGGAAAGGAGGG + Intergenic
1199348787 X:146775102-146775124 ATGTGTCAGAGAAGAATAGATGG + Intergenic
1199681559 X:150228136-150228158 ATGTGGGAGTGGAGGATGGGAGG - Intergenic
1201300388 Y:12499737-12499759 ATGAGAAAGAGGAAAATGGCTGG + Intergenic
1201475492 Y:14376852-14376874 AGGAGGAAGAGAAGAATGGAGGG + Intergenic
1201607119 Y:15799342-15799364 ATGTGGAAGAGGAGGAGGAAGGG + Intergenic
1201644230 Y:16210327-16210349 ACATGGAAGAAGAGAATGAATGG - Intergenic
1201658585 Y:16374994-16375016 ACATGGAAGAAGAGAATGAATGG + Intergenic