ID: 1143823690

View in Genome Browser
Species Human (GRCh38)
Location 17:9586644-9586666
Sequence GGAGGCATTAAAAGCATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143823690_1143823691 -9 Left 1143823690 17:9586644-9586666 CCTCAGATGCTTTTAATGCCTCC 0: 1
1: 0
2: 0
3: 22
4: 263
Right 1143823691 17:9586658-9586680 AATGCCTCCCTATGATCTGACGG 0: 1
1: 0
2: 0
3: 15
4: 104
1143823690_1143823699 26 Left 1143823690 17:9586644-9586666 CCTCAGATGCTTTTAATGCCTCC 0: 1
1: 0
2: 0
3: 22
4: 263
Right 1143823699 17:9586693-9586715 CCCAGGCAGACATCATTTTGTGG 0: 1
1: 0
2: 0
3: 12
4: 144
1143823690_1143823701 27 Left 1143823690 17:9586644-9586666 CCTCAGATGCTTTTAATGCCTCC 0: 1
1: 0
2: 0
3: 22
4: 263
Right 1143823701 17:9586694-9586716 CCAGGCAGACATCATTTTGTGGG 0: 1
1: 0
2: 2
3: 11
4: 170
1143823690_1143823695 9 Left 1143823690 17:9586644-9586666 CCTCAGATGCTTTTAATGCCTCC 0: 1
1: 0
2: 0
3: 22
4: 263
Right 1143823695 17:9586676-9586698 GACGGTGTGTTCTTGCCCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143823690 Original CRISPR GGAGGCATTAAAAGCATCTG AGG (reversed) Intronic
901186593 1:7377366-7377388 GGAGGCATTGAAAGAATCGCAGG - Intronic
901274549 1:7981007-7981029 GGAGGAATTAAAAGATTATGGGG - Intronic
902241549 1:15093431-15093453 GGAGGCCTCAAAATCATCTTCGG - Intronic
908420993 1:63958313-63958335 GGAGGCATGGAGAGTATCTGCGG - Intronic
908452248 1:64267539-64267561 GGAGCAATTAAAAGCTTCAGAGG + Intergenic
910419291 1:87039967-87039989 GTAGGCTTTAAAAAAATCTGAGG + Intronic
911605380 1:99898859-99898881 GGAGGAAGTAGAACCATCTGTGG - Intronic
912968034 1:114253610-114253632 GGAGCCATTAAAATAATCTTGGG + Intergenic
914089957 1:144487532-144487554 AGAGGCATTCCAAGCATGTGAGG + Intergenic
914308650 1:146446684-146446706 AGAGGCATTCCAAGCATGTGAGG - Intergenic
914512669 1:148347713-148347735 AGAGGCATTCCAAGCATGTGAGG + Intergenic
914593459 1:149126447-149126469 AGAGGCATTCCAAGCATGTGAGG + Intergenic
915378818 1:155422478-155422500 AGAGGCATGTAAATCATCTGAGG - Intronic
916018538 1:160772859-160772881 GGAGGTTTTACAAGGATCTGGGG - Intergenic
916345234 1:163782062-163782084 GGAGGCAGTAAAAATATCAGTGG + Intergenic
916837352 1:168560842-168560864 GGAGGCAGTAAAAAGATCAGCGG + Intergenic
918233755 1:182559007-182559029 GGAGGCAATAATCGCATCAGAGG - Intronic
918389295 1:184041049-184041071 GGAGGAAATAAATGCCTCTGGGG + Intergenic
918389454 1:184043085-184043107 GGAGGAAATAAATGCCTCTGGGG + Intergenic
918646565 1:186912485-186912507 GGAGACAGTAAAAGTATCAGTGG - Intronic
919184423 1:194126458-194126480 GGAATAATTAAAAACATCTGAGG + Intergenic
921373244 1:214447270-214447292 GGAGGTTTTAGCAGCATCTGAGG - Intronic
922872958 1:228917847-228917869 GGATCCATTAGAAACATCTGTGG - Intergenic
923813571 1:237347862-237347884 TGAGGCATTAGAAACTTCTGAGG + Intronic
924479301 1:244413315-244413337 GGAGGAATTAAGAGAATCAGTGG + Intronic
924886934 1:248229041-248229063 GGAGGCATGAACATCAACTGGGG + Intergenic
1062905316 10:1175832-1175854 GGAGGCATCAGAATCTTCTGGGG + Intergenic
1063853148 10:10216126-10216148 GGAGGCAGTAAAATGATCAGTGG - Intergenic
1064064014 10:12165021-12165043 GGAGGCCTTAGAAGCAGTTGTGG - Intronic
1065583077 10:27191262-27191284 AGAGACAGTAAAAGGATCTGTGG + Intergenic
1065806995 10:29403185-29403207 GGAGGCAGTAAAAAAATCCGTGG + Intergenic
1067959257 10:50829513-50829535 GCAGTCAGTAAAAGCATCCGTGG + Intronic
1069529850 10:69209102-69209124 GGAGGGAGTAAATGCATATGAGG - Intergenic
1070215830 10:74379624-74379646 GGAGCAATGCAAAGCATCTGAGG - Intronic
1078092244 11:8271288-8271310 GGTGGCATTAACAGCAGCTCGGG + Intergenic
1079699808 11:23530643-23530665 GGATGCATTACAAGGATATGGGG - Intergenic
1081470693 11:43367481-43367503 GGAGGGATTAGAACCAGCTGTGG + Intronic
1081693954 11:45096597-45096619 GGAGGCTTTAGGAACATCTGAGG - Intronic
1084492338 11:69485722-69485744 GGAGGCAAGTACAGCATCTGTGG + Intergenic
1086445169 11:86863619-86863641 GCAGGCATTTAAAGCTGCTGTGG - Intronic
1086497667 11:87421065-87421087 GGATGTATTAGAATCATCTGAGG + Intergenic
1086661400 11:89423439-89423461 GGTGGCATTACAAGCTTATGAGG - Intronic
1087152951 11:94874799-94874821 TGGGGCATTAAAAGCTTTTGAGG + Exonic
1090002963 11:122977841-122977863 TGAAGCATAAAAAGCAACTGCGG - Exonic
1090858829 11:130634940-130634962 GGAGGACCTAAAAGAATCTGGGG + Intergenic
1093855319 12:24094737-24094759 GGTGGCATTAAAAGCCGGTGGGG - Intergenic
1095449137 12:42311150-42311172 GATGGCATTAAAAGCACTTGTGG - Intronic
1099283039 12:80676736-80676758 TGAGGCACTAAAAGTATCTTAGG - Intronic
1099909516 12:88812341-88812363 GGAGGCAATAACAGAATTTGAGG - Intergenic
1100703402 12:97174068-97174090 GGAGGCTTTGGAAGCAACTGGGG - Intergenic
1101432672 12:104639703-104639725 GGTGGCATTAACATGATCTGAGG + Intronic
1102213854 12:111146373-111146395 GGAGGCAGTAAAATGATCAGTGG - Intronic
1103008266 12:117438933-117438955 GGTGCCCCTAAAAGCATCTGTGG + Intronic
1106192989 13:27470423-27470445 GGAGGCAGTAAAAGGATCAGTGG + Intergenic
1106939293 13:34759405-34759427 GTAGGCAGTAAAAGAATCAGTGG - Intergenic
1108031631 13:46237182-46237204 AAAGGCAGTAAAAGTATCTGTGG + Intronic
1108580747 13:51826293-51826315 GGAGGGATCAGAATCATCTGGGG + Intergenic
1109501479 13:63241511-63241533 GGAGACAGTAAAAACATCAGAGG + Intergenic
1109723500 13:66308109-66308131 GGTGTCATTAAAATGATCTGGGG + Intronic
1110034891 13:70670902-70670924 TGAGGCACTATAATCATCTGTGG + Intergenic
1110187192 13:72689082-72689104 CAGGGCCTTAAAAGCATCTGGGG + Intergenic
1112762499 13:102706983-102707005 GGAGACAGTAAAAGGATCAGTGG + Intergenic
1112935204 13:104788720-104788742 TGAGGCATTAGAAATATCTGAGG + Intergenic
1113707134 13:112442220-112442242 GGCGGGATGAAAAGCATTTGAGG + Intergenic
1113821953 13:113221025-113221047 GGTGGCATGTGAAGCATCTGGGG + Intronic
1114212734 14:20629255-20629277 GTAGACAGTAAAAGCATCAGCGG - Intergenic
1114744735 14:25135270-25135292 GGAATCATTAAAAGAAGCTGAGG - Intergenic
1115047921 14:29020707-29020729 AAAGTCTTTAAAAGCATCTGTGG - Intergenic
1115865376 14:37741096-37741118 GGAGGCAGTAAAACAAACTGTGG + Intronic
1118498490 14:66333219-66333241 GGAAACATTAAAAGTAGCTGGGG + Intergenic
1122381790 14:101313001-101313023 GGAGACAGTAAAAAGATCTGTGG + Intergenic
1124347845 15:28934281-28934303 GGAGGCAGGACAAGCAGCTGTGG + Intronic
1125868974 15:43080391-43080413 GGAGGCAATAAAAAAATCAGTGG - Intronic
1126243018 15:46467267-46467289 GGAGCCATTATCAGAATCTGGGG + Intergenic
1127477442 15:59348078-59348100 CGAGGCATCAAAACCACCTGAGG - Intronic
1128025651 15:64434531-64434553 TGAGGCATTAACATGATCTGAGG + Intronic
1129136544 15:73557368-73557390 GGAGGGATTAAAAGAAAATGTGG - Intronic
1130041551 15:80409261-80409283 GGAGACAGTAAAAACATCAGTGG - Intronic
1130295236 15:82642834-82642856 GGAGGCAGTAAAAGAATCATGGG - Intronic
1131523379 15:93133752-93133774 GGAGGAAAGAAAAGTATCTGTGG - Intergenic
1132257540 15:100389759-100389781 TGAGACAGTAAAAGGATCTGTGG + Intergenic
1132458904 16:39724-39746 GGCGGCGGTAAAAGCATGTGTGG + Intergenic
1132609503 16:808251-808273 GGAGGCCTCAAAACCATCTCTGG - Intronic
1133379264 16:5316216-5316238 TGAGTCACAAAAAGCATCTGAGG - Intergenic
1133418275 16:5623646-5623668 AGAGACATTACAAGCAGCTGGGG - Intergenic
1136032847 16:27516095-27516117 AGAGGCATTACAAACATCAGTGG + Intronic
1136048254 16:27632486-27632508 GGCGGCATTAGCAGGATCTGAGG + Intronic
1137402865 16:48167423-48167445 GGAGGACTCAAAGGCATCTGGGG + Intronic
1137956672 16:52838396-52838418 GGAGGCAATAAAAAGATCAGTGG - Intergenic
1139270194 16:65674746-65674768 AGTGGCTTTAAAAGCATCTGAGG + Intergenic
1141686026 16:85570468-85570490 AGAGTCATGAAAAGCATGTGCGG + Intergenic
1141744007 16:85913869-85913891 GGGGGCATTTCAAGCAGCTGGGG - Intronic
1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG + Intergenic
1143823690 17:9586644-9586666 GGAGGCATTAAAAGCATCTGAGG - Intronic
1144393140 17:14814674-14814696 GGAGGCAGTAAAAAGATCCGTGG - Intergenic
1144625252 17:16841089-16841111 GGAGGCACTCACAGCACCTGGGG - Intergenic
1144881177 17:18431632-18431654 GGAGGCACTCACAGCACCTGGGG + Intergenic
1145151055 17:20512754-20512776 GGAGGCACTCACAGCACCTGGGG - Intergenic
1145737436 17:27242874-27242896 GGAGCCATTGAAATAATCTGGGG - Intergenic
1147579407 17:41619788-41619810 GGAGGCACTCACAGCACCTGGGG - Intronic
1147722237 17:42546520-42546542 GGAGGCTTTACAAGCAGATGTGG - Intergenic
1147723421 17:42552690-42552712 GGAGGCTTTACAAGCAGGTGTGG - Exonic
1150591098 17:66563355-66563377 GGAGGCAATAGAAGGATCAGGGG - Intronic
1152326557 17:79644719-79644741 GAAGAAATTAAAAGCATCTCTGG + Intergenic
1152773630 17:82186472-82186494 GGAGGCACCTAAAGCCTCTGCGG - Intronic
1155564395 18:27117575-27117597 GGAGACAGTAAAAACATCAGTGG - Intronic
1159151107 18:64524544-64524566 GGAGGAATTACAAGTATTTGTGG + Intergenic
1162041479 19:7973532-7973554 GATGGCATTAAAAGAAGCTGGGG - Intronic
1163647376 19:18497328-18497350 GGAGACAGTAAGAGCATCGGTGG + Intronic
1165126793 19:33603754-33603776 GGAGGCGTGAGAGGCATCTGTGG + Intergenic
1165527275 19:36366704-36366726 GGAGTGACTGAAAGCATCTGAGG + Intronic
1167220050 19:48193387-48193409 GGTAGCATTCAAAGCATCAGGGG + Intronic
1168518069 19:57025095-57025117 GGAGACAGTAAAAAGATCTGTGG - Intergenic
925224281 2:2169491-2169513 GGAGGCTTTAAAAACATCTACGG + Intronic
925657698 2:6167058-6167080 AGAGGCATTAAAAGCAAGTTGGG - Intergenic
925669738 2:6298162-6298184 GGAGGCAGTAAAATAATCAGTGG + Intergenic
926147095 2:10403191-10403213 GGAGGCTTCCAAAGCACCTGAGG - Intronic
928443642 2:31314066-31314088 GGAGACAGTAGAAGCATCAGTGG - Intergenic
928608387 2:32965509-32965531 GGAGACAGTAAAAGGATCAGTGG - Intronic
929066988 2:37987497-37987519 GGAGACAGTAAAAGGATCAGTGG + Intronic
929541286 2:42824437-42824459 GGAGTCATGAAAGGCTTCTGAGG - Intergenic
930047519 2:47186223-47186245 GGATGCATTAAAAGTCTCTGAGG - Intergenic
931619606 2:64196521-64196543 GGAGGCACGAAAATCATTTGAGG + Intergenic
931992202 2:67801955-67801977 GCATGCTTTAAAATCATCTGGGG - Intergenic
932471318 2:71961375-71961397 GGAGGCATTTGAGGCCTCTGGGG + Intergenic
932837484 2:75050950-75050972 GGGGGAATTAAAAACTTCTGTGG - Intronic
936165016 2:110113833-110113855 GCAGGCATTACCAGCAGCTGAGG + Intronic
936895978 2:117428173-117428195 GGAGACATTAAAAAGATCAGTGG + Intergenic
936934042 2:117820644-117820666 GAAGGCATCAAAATCACCTGGGG - Intronic
940875304 2:158892175-158892197 GGAGGCGCAAAAAGCATGTGGGG - Intergenic
941783408 2:169473780-169473802 GAAGGCAGTAAAAAGATCTGTGG + Intergenic
944572293 2:201056732-201056754 GGTGGTATTCAAAGCGTCTGTGG + Intronic
945011232 2:205466032-205466054 GGATGCATTCAAATCACCTGGGG + Intronic
945863750 2:215153586-215153608 GGAGACAGTAAAAACATCAGTGG - Intergenic
946112416 2:217431621-217431643 GCAGGCATTGAAAGCTGCTGTGG + Intronic
947196415 2:227572641-227572663 GGAGACAGTAAAAGGATCAGTGG + Intergenic
947238783 2:227972010-227972032 GGAGGCATGAAAAGCAAGGGAGG - Intergenic
1169750581 20:8988750-8988772 GAAGGTCTTAAAAGCAGCTGGGG + Intergenic
1170689355 20:18598888-18598910 GGAGGCAGTAAAAAGATCAGTGG - Intronic
1171010894 20:21508936-21508958 GGAGTCAATAAAAGCGCCTGCGG - Intergenic
1171417938 20:24996112-24996134 GGATGCATTGGAAGGATCTGGGG + Intergenic
1172971776 20:38878938-38878960 AGAGGCATTCAGGGCATCTGGGG + Intronic
1175172067 20:57087715-57087737 AGAGTTATTAAAAGCATCTCTGG - Intergenic
1175569165 20:60006137-60006159 GGAGGCAAGCAAAGCACCTGGGG - Intronic
1176070786 20:63225232-63225254 GGAGCCCTCAAAAGCATCTTTGG - Intergenic
1177321518 21:19527171-19527193 GGAGACAGTAAAAGAATCAGTGG - Intergenic
1179636684 21:42715933-42715955 GGAGACAGTAAAAAGATCTGGGG - Intronic
1180248323 21:46563117-46563139 GGAGGCTCCAACAGCATCTGGGG + Intronic
1181331819 22:22098681-22098703 GGAGGCATGAAAAGGCCCTGAGG + Intergenic
1181959293 22:26611344-26611366 GGAGTAATGATAAGCATCTGTGG - Intronic
1182775289 22:32826990-32827012 GCAGGGATTGAAAGCATCTTGGG - Intronic
949258201 3:2075778-2075800 GGAGACAGTAAAAGTATCAGTGG + Intergenic
952418661 3:33112078-33112100 GGAGACAGTAAAAGGATCAGTGG - Intergenic
956273918 3:67477262-67477284 GTACACATTAGAAGCATCTGAGG - Intronic
956944255 3:74200914-74200936 GGAACTAATAAAAGCATCTGAGG + Intergenic
957609194 3:82445781-82445803 GGAGGCAGTAAAAGTATCAGTGG - Intergenic
961187109 3:124925277-124925299 GGAGACAGTAAAAAGATCTGTGG + Intronic
961743739 3:129050153-129050175 GGAGACAGTAAAAGGATCAGTGG + Intergenic
962338678 3:134562537-134562559 AGAGGCATTAAAAAAAACTGAGG - Exonic
962481154 3:135799876-135799898 GTAGGCATAAAAAGGATATGTGG + Intergenic
962563317 3:136631364-136631386 GGAGCCAGTAAAAGAATCGGTGG + Intronic
964096903 3:152942451-152942473 TGTGGCATAAAAAGCACCTGGGG + Intergenic
964234400 3:154507813-154507835 GGAGACAGTAAAAAGATCTGTGG - Intergenic
964625564 3:158755415-158755437 GGAGGCAGTAAAAGGATCAGTGG - Intronic
965459017 3:168938659-168938681 GGAGGCAATAAAAGAATCAGTGG + Intergenic
965641549 3:170833996-170834018 GGAGACAGTAAAAGGATCAGTGG - Intronic
966577449 3:181518591-181518613 GGAGGCATGAAAGGTTTCTGAGG - Intergenic
966869348 3:184279932-184279954 AGATGAATTAAGAGCATCTGCGG + Intronic
967234674 3:187372676-187372698 GGAGTCATTGCAAGCATTTGAGG + Intergenic
967479703 3:189959083-189959105 GGATTCATTAGAAGCATGTGAGG - Intronic
968200352 3:196748512-196748534 GGAGGTAGTAAAAGGATCAGCGG - Intronic
968227321 3:196981648-196981670 GGAGACATTAAAAAGATCAGTGG + Intergenic
969911912 4:10455214-10455236 GGAGGCATCAAAATCAACTAGGG - Intronic
970545107 4:17121403-17121425 GGAGACAGTAAAAGGATCAGTGG + Intergenic
971425914 4:26515238-26515260 GGAGGCAGTAAAACCATCAGTGG - Intergenic
972292405 4:37701895-37701917 GGTGGCATTAAAAGCACATGGGG - Intergenic
972945240 4:44246220-44246242 GCAGGAATTAAAAGCATTTGAGG - Intronic
975273274 4:72464258-72464280 GGAGGCAGGAAAAGATTCTGTGG - Intronic
976133388 4:81908757-81908779 GGAGACAGTAAAAACATCAGTGG + Intronic
976317468 4:83673809-83673831 GGAGGGATTAAATGCAACTGGGG - Intergenic
977839205 4:101681176-101681198 GGAGGCAGTAAAAAGATCAGTGG - Intronic
977841074 4:101705635-101705657 GCAGTCATTAAAAGGAACTGTGG - Intronic
977967209 4:103167353-103167375 AAAGGAATTAAAAGCATCTATGG - Intronic
978357002 4:107886721-107886743 GGAGCCAATAAAAGCCTCTTGGG - Intronic
978524134 4:109647367-109647389 GGAGACAGTAAAAGGATCAGTGG - Intronic
979996897 4:127442164-127442186 GGAGACAGTAAAAGGATCAGTGG + Intergenic
981577081 4:146216817-146216839 GGCTGCACTAAAAGCATCTCAGG + Intergenic
982404660 4:155006324-155006346 GGAGCCTGTAAAAGGATCTGGGG + Intergenic
983178942 4:164624087-164624109 GGAGGCATAAACAGCATCAGTGG - Intergenic
983686902 4:170421156-170421178 GGAGACAGTAAAAGGATCTGTGG + Intergenic
984117304 4:175697611-175697633 TAAGGGATTAAAAGCTTCTGGGG + Intronic
987948844 5:24650645-24650667 GAAGGAATTAAAAGCGACTGTGG + Intergenic
990343578 5:54849343-54849365 GGAGGCATTAAGTGCATCCTAGG + Intergenic
990500201 5:56389066-56389088 GGAAGCATTAGAATCCTCTGAGG - Intergenic
993775430 5:91989087-91989109 GGAGGCAGTAAAAAGATCAGTGG + Intergenic
993904630 5:93609274-93609296 GGAGGATTTGTAAGCATCTGAGG - Intergenic
994360946 5:98847674-98847696 GGAGACAGTAAAAGGATCAGGGG + Intergenic
995931557 5:117452598-117452620 GCAGGCATCAGAAGCACCTGGGG - Intergenic
997163010 5:131629176-131629198 GATGCCATTAAAACCATCTGTGG + Intronic
998430562 5:142066310-142066332 GGAGCATTTAAAAGCATCAGTGG - Intergenic
998503228 5:142651677-142651699 GGAGGCAGTAAAAATATCAGTGG - Intronic
998910528 5:146955213-146955235 GGATGCATAAGAATCATCTGGGG - Intronic
998962261 5:147501268-147501290 GGAGGCAGTAAAAAGATCAGTGG + Intronic
999117299 5:149175166-149175188 GGTGGTATAAAAAGTATCTGAGG - Intronic
999841163 5:155428660-155428682 GGAGACATTAAAAAGATCAGTGG - Intergenic
1001787306 5:174424888-174424910 GTAGGCATCAAAGGCATCTAAGG - Intergenic
1001960517 5:175877950-175877972 GGAGACATTATAATCTTCTGGGG - Intronic
1002030508 5:176425358-176425380 GGAGCCAATAAAAGCACCTTGGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1006528279 6:34627094-34627116 GGAGACAGTAAAAGCATCAGTGG - Intronic
1007779316 6:44243579-44243601 GGAGGAATAAAAGGGATCTGGGG + Intergenic
1007796780 6:44355191-44355213 GGAGACAGTAAAAATATCTGCGG - Intronic
1008146981 6:47903831-47903853 AGAGGGGTTAGAAGCATCTGGGG + Intronic
1008502111 6:52193674-52193696 GGATGCATCAAAATCAACTGGGG - Intergenic
1009792181 6:68417964-68417986 GGAGGCATTAGAGGCTTCTTTGG + Intergenic
1009840649 6:69069421-69069443 GGACACATTAAAAACATCTCAGG - Intronic
1010368578 6:75081074-75081096 GGAGGCATAAAAAGTCTCTGCGG + Intergenic
1011698374 6:89933346-89933368 GGAAGCAGTAAAAAGATCTGTGG + Intronic
1016145054 6:140660508-140660530 GGAGGCATTAAAATGATCAGTGG + Intergenic
1016437883 6:144056520-144056542 GGAGGCAATAAAAAGATCAGTGG - Intronic
1017562623 6:155645739-155645761 GGAAGCAGTTAAAGCATCTGAGG - Intergenic
1017847488 6:158271957-158271979 GGAGGGTTTAAAAGTATTTGCGG + Intronic
1017945684 6:159094693-159094715 GGAGGCACAAACAGCAGCTGGGG - Intergenic
1018546662 6:164944613-164944635 GGAGACAGTAAAAACATCAGTGG + Intergenic
1018646544 6:165953946-165953968 GGAGACATTAAAAAGATCAGTGG - Intronic
1019890824 7:3944841-3944863 GGAGGCATCACAACCACCTGGGG + Intronic
1020672242 7:11130860-11130882 GGAGACAGCAAAAGGATCTGTGG - Intronic
1021076547 7:16311368-16311390 GGAGGCATTAAAAGGATGAGTGG - Intronic
1021079015 7:16341054-16341076 GGAGACAGTAAAATCATCAGGGG + Intronic
1022297701 7:29071722-29071744 TGAGCAATTAAAACCATCTGGGG - Intronic
1023596874 7:41838821-41838843 GGAGACAATAAAAGGATCAGTGG - Intergenic
1023934147 7:44727210-44727232 GGAGGCATAAGCAGGATCTGGGG - Intergenic
1024535198 7:50424626-50424648 GGAGGCATTAGAAATATCAGTGG + Intergenic
1025618051 7:63141382-63141404 GGAGGCCTTAAAAGCGTCATGGG + Intergenic
1028042914 7:86079686-86079708 GGAGGCACTAAAAAAACCTGGGG - Intergenic
1028423075 7:90655016-90655038 GGAGACAGTAAAAGGATCAGTGG - Intronic
1028544971 7:91987763-91987785 GGAGGCAGAAAAATCATCAGTGG + Intronic
1032015344 7:128376564-128376586 GGAGGCAGTAAAAGGATCATTGG - Intergenic
1032520697 7:132541841-132541863 GCAGGCATTTAAGGCATCTCAGG + Intronic
1033127890 7:138720980-138721002 GGAGCCATTTATAGCATCTGTGG + Intronic
1035411403 7:158645588-158645610 GGATGAATTAAAGGCATGTGTGG - Exonic
1036192496 8:6683153-6683175 GGAGACAGTAAAAGGATCAGTGG - Intergenic
1036453348 8:8888667-8888689 GGAGACAGTAAAAAGATCTGTGG + Intronic
1036593418 8:10190374-10190396 GGAGGCCTTGGAATCATCTGCGG - Intronic
1037256004 8:16954585-16954607 GGAGACAGTAAAAACATCAGTGG + Intergenic
1037473086 8:19229647-19229669 GGAGGAAAAAAAAACATCTGGGG + Intergenic
1037916932 8:22778558-22778580 GAAGGCAGGAAAAGCATCTTGGG - Intronic
1038490761 8:27969460-27969482 GGAGGCAGTAAAAAGATCCGTGG + Intronic
1041404292 8:57480692-57480714 GGAGGAAGTAAATGCATATGTGG + Intergenic
1042459867 8:69052049-69052071 GGAGACCTTAAAAAGATCTGTGG + Intergenic
1044340869 8:91044906-91044928 GGAAGCATTACATGCCTCTGGGG - Intergenic
1044612357 8:94105617-94105639 GGAGATAGTAAAAGCATCAGTGG - Intergenic
1045430405 8:102108447-102108469 TGAGGCATTTAAAACACCTGAGG - Intronic
1046904741 8:119560327-119560349 GGAGGCATTACATCCACCTGGGG + Intronic
1047591408 8:126330919-126330941 GGTGGCATTAATACCATCTGTGG + Intergenic
1047771688 8:128035058-128035080 GGGGGCAATAAAAGCATTTGTGG + Intergenic
1051962036 9:22778392-22778414 GGAGACATTAAAAAGATCAGTGG + Intergenic
1055223154 9:73963474-73963496 GGAGACAGTAAAAGGATCAGTGG + Intergenic
1055913493 9:81376637-81376659 GGAGGTTTAATAAGCATCTGAGG - Intergenic
1056177166 9:84046001-84046023 GCTGGGATTATAAGCATCTGTGG + Intergenic
1056501907 9:87217876-87217898 GGAGACATTATAATCAGCTGTGG + Intergenic
1057108611 9:92445351-92445373 GAAGGCATTAAGAGCAGATGAGG - Intronic
1057143195 9:92739791-92739813 CGAGGCCTTAAAAGGAGCTGGGG + Intronic
1057264530 9:93605536-93605558 GGAGACAGTAAAAACATCAGTGG - Intronic
1057501930 9:95603034-95603056 GGAGGCACTACAAGGCTCTGGGG - Intergenic
1059685196 9:116628534-116628556 GGAGACAGTAAAAGGATCCGTGG + Intronic
1059894127 9:118841146-118841168 GGAGCCATGAAAAGTATTTGAGG + Intergenic
1060720987 9:125977251-125977273 GGAGACAATAAAAGGATCAGTGG - Intergenic
1060762566 9:126268163-126268185 GTAGGCATCAGAATCATCTGGGG - Intergenic
1062078900 9:134608364-134608386 GGAGGCAGTAAAAGGCTCAGTGG - Intergenic
1186186132 X:7021407-7021429 GGGTGCATTAAAGGCATTTGTGG - Intergenic
1186779548 X:12899178-12899200 GCAGGCATCAAAATCACCTGAGG + Intergenic
1187800561 X:23058019-23058041 GGAGGCAGTAAAAAGATCAGTGG + Intergenic
1188839233 X:34994810-34994832 GGAGGCAGTAAAAAGATCAGCGG - Intergenic
1192038052 X:67587217-67587239 GGAGGCAGGAAAATCAGCTGGGG + Intronic
1192769929 X:74178258-74178280 GAAGGAATTAAAAGCAAGTGTGG + Intergenic
1192801582 X:74470002-74470024 GGAGACAGTAAAAGGATCAGTGG - Intronic
1193146853 X:78085319-78085341 GGAGACAGTAAAAGGATCAGTGG + Intronic
1193856113 X:86604735-86604757 TGAGTCCTTAAAAGCATATGAGG + Intronic
1193884115 X:86963616-86963638 GGCTGCATTACAAGCAGCTGTGG - Intergenic
1198199372 X:134399968-134399990 GGAGACAGTAAAAGTATCAGTGG - Intronic
1198639711 X:138743343-138743365 GGAGGCAGTAAAAGGATCAGTGG + Intronic
1199013852 X:142789703-142789725 GGAGACAGTAAAAGGATCCGTGG - Intergenic
1200910769 Y:8529573-8529595 GGAGGCATTTAGAGACTCTGAGG - Intergenic
1200936700 Y:8744618-8744640 GGAGGCATTTCAAGACTCTGAGG + Intergenic
1201219386 Y:11753319-11753341 GGAAGAAATCAAAGCATCTGAGG - Intergenic