ID: 1143824187

View in Genome Browser
Species Human (GRCh38)
Location 17:9590846-9590868
Sequence CCACAGAGACTATCCAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143824187_1143824195 9 Left 1143824187 17:9590846-9590868 CCATCCCTGGATAGTCTCTGTGG 0: 1
1: 0
2: 3
3: 22
4: 212
Right 1143824195 17:9590878-9590900 TGGAGTTCTGCTGATTGGTTTGG 0: 1
1: 0
2: 4
3: 38
4: 362
1143824187_1143824198 20 Left 1143824187 17:9590846-9590868 CCATCCCTGGATAGTCTCTGTGG 0: 1
1: 0
2: 3
3: 22
4: 212
Right 1143824198 17:9590889-9590911 TGATTGGTTTGGAGAGTCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 194
1143824187_1143824194 4 Left 1143824187 17:9590846-9590868 CCATCCCTGGATAGTCTCTGTGG 0: 1
1: 0
2: 3
3: 22
4: 212
Right 1143824194 17:9590873-9590895 AAGGGTGGAGTTCTGCTGATTGG 0: 1
1: 0
2: 1
3: 25
4: 200
1143824187_1143824196 18 Left 1143824187 17:9590846-9590868 CCATCCCTGGATAGTCTCTGTGG 0: 1
1: 0
2: 3
3: 22
4: 212
Right 1143824196 17:9590887-9590909 GCTGATTGGTTTGGAGAGTCAGG 0: 1
1: 0
2: 1
3: 20
4: 159
1143824187_1143824197 19 Left 1143824187 17:9590846-9590868 CCATCCCTGGATAGTCTCTGTGG 0: 1
1: 0
2: 3
3: 22
4: 212
Right 1143824197 17:9590888-9590910 CTGATTGGTTTGGAGAGTCAGGG 0: 1
1: 0
2: 0
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143824187 Original CRISPR CCACAGAGACTATCCAGGGA TGG (reversed) Intronic
901038409 1:6349918-6349940 CAACAGTGACAATCCAAGGAGGG + Intronic
901504861 1:9678298-9678320 ACACAAAAACTATCCAGGCATGG + Intronic
901799736 1:11701117-11701139 AAACAGACACTAACCAGGGAGGG - Intronic
903852521 1:26316701-26316723 CCACAGAGGGTATCAAGTGAGGG + Intronic
904424497 1:30414754-30414776 CCACAGAGACTCTACAGGCTGGG + Intergenic
905127876 1:35728460-35728482 CTCCATTGACTATCCAGGGAAGG - Intronic
905630120 1:39513897-39513919 CCACAGAGACCAGCCAGGGAGGG + Intronic
905667639 1:39772293-39772315 CCACAGAGACCAGCCAGGGAGGG - Intronic
908112599 1:60912059-60912081 CCCCTGAGACTTTCCACGGATGG - Intronic
909731443 1:78896585-78896607 CCACAGACACTATCCTGAAACGG + Intronic
910088732 1:83436384-83436406 CCACAGAAAGTATTTAGGGAAGG - Intergenic
910916143 1:92291669-92291691 CACCAGAGACTTTCCAGGGTTGG + Intronic
912583506 1:110740633-110740655 CAACAGTGGCTATCCTGGGATGG - Intergenic
921005630 1:211090869-211090891 TCACAGTGACTATTCAGTGAGGG + Intronic
921366037 1:214374741-214374763 CCACAGAGAATACCAAGGAAGGG + Intronic
923373108 1:233332334-233332356 ACACAGGGGCTCTCCAGGGAAGG + Intronic
924291912 1:242545485-242545507 CCCCAGAGACTATTCAGGAAAGG - Intergenic
1063382847 10:5597101-5597123 CCACAGAAATTACCCAGGGCTGG + Intergenic
1063777238 10:9277616-9277638 ACACAGAGACTATCCAGAAACGG + Intergenic
1067184480 10:44015156-44015178 TCACAGTGACTGTCCAGGTAGGG + Intergenic
1067290480 10:44935920-44935942 CCACAGAGGCTGCCCAGGGGTGG + Exonic
1067457219 10:46427625-46427647 CCAAAGAGCCTCTCCGGGGAAGG + Intergenic
1067629982 10:47957013-47957035 CCAAAGAGCCTCTCCGGGGAAGG - Intergenic
1068654895 10:59564423-59564445 ACTCAGAGACTGTCCAAGGAAGG + Intergenic
1068838308 10:61580712-61580734 CTTCAGAGATTCTCCAGGGATGG - Intergenic
1070814969 10:79317268-79317290 CCACAGGGACTGTCCACAGAGGG + Intergenic
1071526238 10:86361144-86361166 CCACAGAGTACATCCAAGGAAGG + Intronic
1072718975 10:97769350-97769372 CCACAGAGATGATCCAGTCATGG + Intronic
1073372494 10:103003267-103003289 CCACAAAAATTATCCAGGTATGG - Intronic
1074564264 10:114562757-114562779 CCTCAGAGGCTCTCCTGGGATGG + Intronic
1075271880 10:121059496-121059518 CCAGGGAGACTCTGCAGGGATGG + Intergenic
1076631910 10:131856630-131856652 CCCCAGGGACTTTCCAGGCAGGG + Intergenic
1078160071 11:8832561-8832583 CCACTGAGACCAGCCATGGAAGG - Intronic
1078460324 11:11510381-11510403 TCACAGAGACGACCCAGGGTAGG - Intronic
1078664327 11:13311929-13311951 CTACAGAGTCTATCCAAGTATGG + Intronic
1078847035 11:15127660-15127682 CCTCAGAGAATATCCTGGGGAGG + Intronic
1080453540 11:32398395-32398417 AAACAGAGACTCTGCAGGGAAGG + Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1083683588 11:64362426-64362448 GCACACAGACTGTACAGGGACGG - Intronic
1083943866 11:65913178-65913200 CCAGAGGGTCTGTCCAGGGAAGG - Intergenic
1084201171 11:67559491-67559513 CCAAAGTGATTATTCAGGGAGGG - Intergenic
1085049766 11:73374342-73374364 CCACAGTGAGTAGACAGGGAAGG - Intergenic
1085682162 11:78586985-78587007 CAACAGTGACTTTCCAGAGAAGG - Intergenic
1086072532 11:82814907-82814929 GCAGAGGGACTATCCAGGGAAGG - Intergenic
1088452483 11:109997267-109997289 CCACAAAAATTATCCAGGCATGG - Intergenic
1088629558 11:111761667-111761689 CTACAGAGACTGGCCAGGCACGG + Intronic
1088741241 11:112769268-112769290 CCGCAGAGATGATCTAGGGATGG - Intergenic
1089676036 11:120090387-120090409 ACACAGACAGTATCCAAGGATGG + Intergenic
1089731247 11:120520457-120520479 CCATGGAGGCCATCCAGGGAAGG + Intronic
1090663568 11:128899884-128899906 CCACAGTGGCTCACCAGGGAGGG + Exonic
1091628376 12:2139896-2139918 GCACCGAGGCCATCCAGGGAAGG + Intronic
1092946802 12:13463858-13463880 CCACAGAGAATATTCCTGGAAGG + Intergenic
1093444025 12:19233777-19233799 CCACAGAAAAAATCCAGTGAGGG - Intronic
1095749912 12:45698442-45698464 CCACATAAACTGTCCAGTGATGG - Intergenic
1097026558 12:56060336-56060358 CCACAAATACTAGCCAGGTATGG + Intergenic
1102778934 12:115546736-115546758 CCTGAGAGACTCTCCAGGAAGGG + Intergenic
1102971349 12:117169991-117170013 CCACAGAGAAAAGCCAGGAATGG + Intronic
1104531008 12:129571151-129571173 CAACAGTGTCCATCCAGGGACGG - Intronic
1104642643 12:130477319-130477341 ACACAGAGACTGTCCAGGAAGGG - Intronic
1106890697 13:34242412-34242434 CCACAGAGACTTGCTGGGGAAGG - Intergenic
1109280503 13:60349986-60350008 CCACAAAGACTGTCCATGCACGG + Intergenic
1109634910 13:65102857-65102879 TCAATGAGACTATCCAGGGGTGG - Intergenic
1110136157 13:72069715-72069737 TCACACAGACTACCCAGGAAGGG + Intergenic
1110805825 13:79753069-79753091 CCAGAGAGCATTTCCAGGGAGGG + Intergenic
1110816981 13:79872530-79872552 CCACAGAAAGATTCCAGGGAGGG - Intergenic
1112319529 13:98394450-98394472 CCACAGGGGGTCTCCAGGGAAGG - Intronic
1113814310 13:113161090-113161112 CCACGGTGTCTCTCCAGGGAAGG + Intronic
1118505796 14:66410213-66410235 CAAAAGAGATTATCTAGGGAGGG - Intergenic
1118769106 14:68929738-68929760 CCTCAGAGACTCTGCAGGGCCGG - Intronic
1118819093 14:69333379-69333401 CCCCAGTGACTCTGCAGGGAGGG + Intronic
1118896765 14:69951968-69951990 CCACAAAGTCTAACCAAGGAAGG - Intronic
1118991931 14:70804937-70804959 CCACAGGGACTGAGCAGGGAAGG - Intronic
1120286725 14:82511714-82511736 CTACAGAGAATATGCAGTGAGGG + Intergenic
1121644203 14:95506770-95506792 TCACAGTGACTCTGCAGGGAAGG + Intergenic
1122317536 14:100835009-100835031 ACACAGAGGCCATCAAGGGATGG - Intergenic
1122411004 14:101526178-101526200 CCACAGAGAGCACCCAGGGTGGG + Intergenic
1123500818 15:20878839-20878861 CCACAGAGGCTCGCCAGGGCCGG - Intergenic
1123558069 15:21452534-21452556 CCACAGAGGCTCGCCAGGGCCGG - Intergenic
1123594297 15:21889815-21889837 CCACAGAGGCTCGCCAGGGCCGG - Intergenic
1124025793 15:25964366-25964388 CCCCAGATAACATCCAGGGAAGG + Intergenic
1124118462 15:26868091-26868113 CCACAGAGGCTCACCAGGGCCGG - Intronic
1124636916 15:31371405-31371427 CCAAAGTGACCAACCAGGGACGG - Intronic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1127485273 15:59412753-59412775 CAGCAGAGACAGTCCAGGGAGGG - Intronic
1130133207 15:81160736-81160758 GCACAGAGACGATGCAGGGATGG - Intronic
1131003781 15:88959417-88959439 CCACAAAAATTATCCAGGCACGG + Intergenic
1202966419 15_KI270727v1_random:179706-179728 CCACAGAGGCTCGCCAGGGCCGG - Intergenic
1132746743 16:1439388-1439410 CCACCGAGGCTGCCCAGGGAAGG + Intronic
1134205715 16:12236555-12236577 CCACAGAGTCTTTCCAGAGTAGG - Intronic
1137513729 16:49124347-49124369 GCACAGAGACCAGCCAGGAAGGG + Intergenic
1138007962 16:53355201-53355223 CCACAGACACCCACCAGGGAAGG - Intergenic
1138334513 16:56242045-56242067 CCCCAGAGACTGTCCTGGGCTGG - Intronic
1139295415 16:65896189-65896211 GCACTGAGACTATCAAGTGAAGG - Intergenic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1140529479 16:75651531-75651553 CTACAAAAACTATCCAGGCATGG + Intronic
1141137341 16:81474796-81474818 GCACAGAGACTGTCCTGGGCTGG - Intronic
1141144063 16:81516486-81516508 CCAGGGAGAGTGTCCAGGGAAGG - Intronic
1142969408 17:3601174-3601196 CCACAGAAACAGCCCAGGGAGGG - Intergenic
1143469743 17:7165159-7165181 CCACAGCCACTCTACAGGGAGGG - Intergenic
1143824187 17:9590846-9590868 CCACAGAGACTATCCAGGGATGG - Intronic
1144407505 17:14966469-14966491 CCCCAGCCACCATCCAGGGAGGG - Intergenic
1146924525 17:36735086-36735108 CCAGAGAGACCACCCACGGAGGG + Intergenic
1147451062 17:40504452-40504474 CCACAAAAACTAGCCAGGCATGG + Intergenic
1147580789 17:41626034-41626056 CCACACAGACTTTCCAAGGATGG - Intergenic
1147791348 17:43015931-43015953 CCACAGAGACCTTCGGGGGAGGG + Exonic
1147910908 17:43855395-43855417 CCACAGGGTCTTTCCAGGGCTGG - Intronic
1149457594 17:56800773-56800795 CCACACAGAATGACCAGGGAGGG - Intronic
1150666016 17:67139268-67139290 ATACACAGACTACCCAGGGAAGG + Intronic
1150847589 17:68675613-68675635 CCTCAGGAACTATCTAGGGAAGG + Intergenic
1152237328 17:79145400-79145422 CCTCAGACCCTCTCCAGGGAGGG - Intronic
1152501066 17:80709377-80709399 CCACAGAGGAGAGCCAGGGAAGG - Intronic
1152884949 17:82844358-82844380 CCACACTGACGATGCAGGGAGGG - Intronic
1152997545 18:422001-422023 CTACTGAGACTGTCCTGGGAAGG - Intronic
1153483471 18:5571715-5571737 CCACAGTGGCTATCCATTGAGGG + Intronic
1154295602 18:13144353-13144375 CCACAGATACCAACCAGGAAAGG - Intergenic
1155351284 18:24909782-24909804 CCACAGGGGCCATCCATGGAGGG + Intergenic
1157321484 18:46638066-46638088 CCACAGAGCCATTCCAAGGAGGG + Intronic
1157439633 18:47700706-47700728 CCACAGTGGTTGTCCAGGGATGG - Intergenic
1157464819 18:47933992-47934014 CTACAGAGACTGGCCTGGGATGG - Intergenic
1162872880 19:13599484-13599506 CAACAGAGATTAACCATGGATGG - Intronic
1164543822 19:29142623-29142645 CCACAGAGACAGTCCTGAGATGG - Intergenic
1164715642 19:30388492-30388514 CCACAGAGACCACCCAGCGGTGG + Intronic
1165912918 19:39240285-39240307 CAACTCAGACTTTCCAGGGATGG + Intergenic
1166545962 19:43635121-43635143 CCACGGAGACTAAGCAGGGTGGG + Intronic
1166718216 19:44982635-44982657 TGACAGAGACTGTCCAGGGAAGG - Intronic
1166819496 19:45568775-45568797 CCACAGAGACGGTGCTGGGATGG + Intronic
1168327555 19:55545995-55546017 CCACAGAGACGGGACAGGGAGGG - Intergenic
928170906 2:29002522-29002544 CCAGAGAGGCTGTACAGGGATGG - Exonic
928783266 2:34850261-34850283 CCACAAGGACTTTCCAGAGAAGG - Intergenic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
930011729 2:46942406-46942428 CCACAGAGAGGACTCAGGGAGGG - Intronic
933369191 2:81393776-81393798 CCATAGAGACCATCATGGGATGG - Intergenic
934526748 2:95056814-95056836 CCACAGGGACAATCAGGGGAGGG - Intergenic
935407734 2:102726682-102726704 CCTCAGAGACTTGCCAGGCACGG + Intronic
936017461 2:108970580-108970602 ACACAGAGAATAACCAGGGTGGG + Intronic
938741241 2:134234545-134234567 CCACAAAGACTGTCAAGGTAGGG - Intronic
938962537 2:136356244-136356266 CCACAGAGATCATCCAGTCAAGG - Intergenic
939541431 2:143498783-143498805 TCACAGAGACATTCCTGGGAGGG + Intronic
939583485 2:143979177-143979199 CCACTGAGCCCATCCAGTGAGGG - Intronic
939821479 2:146961768-146961790 CCACAGAAATTATCCAAGAAAGG + Intergenic
941962731 2:171269621-171269643 CCACAGAGCCTAGCCTGAGATGG + Intergenic
942666715 2:178327379-178327401 CCAGAGATATTATCCATGGATGG + Intronic
946389037 2:219404619-219404641 CCCCAGCCACTCTCCAGGGAAGG + Intergenic
948195191 2:236090480-236090502 CCAAAGAGACTGTGAAGGGAGGG + Intronic
948284331 2:236772115-236772137 CGAAAGAGACTATCCATGCAAGG + Intergenic
1170055748 20:12200837-12200859 CCACAGTGACTCTCCAGGAGAGG + Intergenic
1170627156 20:18038687-18038709 CCACAGAGTCCATCCAGGCAGGG + Intronic
1171119812 20:22558541-22558563 CCACACAGACTTTGCAGGCAGGG - Intergenic
1171454170 20:25257831-25257853 CCACAGGCACTGTCCAGGCAGGG - Intronic
1173327531 20:42047517-42047539 CCACAGAGAATCTGCATGGAAGG - Intergenic
1173437270 20:43044347-43044369 CCAGGGAGACTGGCCAGGGAAGG + Intronic
1175525305 20:59629538-59629560 CCACAGAGAGAGTCCTGGGACGG - Intronic
1176123315 20:63463940-63463962 CCACTGAGATGATTCAGGGATGG + Intronic
1177172907 21:17673356-17673378 CTAGAGACACTATCCAAGGATGG + Intergenic
1177972215 21:27804569-27804591 CCACAGAGTCAATTCAGGGAAGG + Intergenic
1183753477 22:39736485-39736507 CCACAGACACCATCCCTGGATGG + Intergenic
1184950044 22:47834518-47834540 CCACAATGACTATCCAGCCAAGG + Intergenic
949324736 3:2850511-2850533 CCACTGAGACTTTACATGGAGGG + Intronic
950267677 3:11587081-11587103 CCAAAGAGACTTTCAAGGCAAGG + Intronic
950936040 3:16840126-16840148 CCACAGATTCTATCCAGGATGGG - Intronic
951654659 3:24991998-24992020 CCAAACAGACTACCCAGGCAAGG - Intergenic
951809842 3:26686968-26686990 CCACAGAGACAATCCCCGAATGG + Intronic
954686050 3:52370841-52370863 CCCCAGAGACTGCACAGGGAGGG + Intronic
955331792 3:58053337-58053359 CCACAGAAATTAACCAGGCATGG - Intronic
956608500 3:71097702-71097724 CCACTGACACAATCCAGGGAGGG + Intronic
958843834 3:99241507-99241529 CCAAAGAGATAATCCAAGGATGG + Intergenic
963145974 3:141995107-141995129 CCACAGAGACTAACCAGTTCAGG - Exonic
963949500 3:151183256-151183278 CCACAGGGACAATCCAGGGAAGG - Intronic
966250807 3:177863396-177863418 CCCCAGAGCCTACACAGGGAAGG - Intergenic
968744574 4:2353023-2353045 CCACAGAGGCTGTCCCTGGAGGG + Intronic
969418626 4:7076956-7076978 CCACATAGCCTTTCCAGGGAAGG - Intergenic
969503823 4:7571248-7571270 CCACAGAGTCTAGCCAGACATGG + Intronic
970857172 4:20662235-20662257 GCACAGAGTATGTCCAGGGAGGG + Intergenic
970959118 4:21852192-21852214 CCAGAGAGTCTGTCCCGGGAAGG + Intronic
971382395 4:26110855-26110877 CCAGAGAGACTGTCCTGAGAAGG - Intergenic
972426023 4:38933784-38933806 CCCCTGAAAATATCCAGGGATGG + Intronic
976483419 4:85571242-85571264 CAACAGAGACTATTCACAGAAGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980002714 4:127509138-127509160 CTATAGAGCCTATCCAGTGAAGG - Intergenic
991590435 5:68246269-68246291 CAAAAGAGACTCTGCAGGGAAGG - Intronic
995853602 5:116572516-116572538 CCAGCGTGGCTATCCAGGGAGGG - Intronic
996396412 5:123018124-123018146 CCACATTGAGTACCCAGGGATGG + Intronic
997615088 5:135240674-135240696 CCAAAGAGCCTCTCCAGGAAAGG - Intronic
998539788 5:142969843-142969865 GCAAAGAGACTATGCAGGAAGGG - Intronic
1000026912 5:157367175-157367197 CCCCAGAGACCATCCAGGGTTGG + Intronic
1000044501 5:157510892-157510914 AACCTGAGACTATCCAGGGATGG - Intronic
1000200994 5:159011013-159011035 CCACAAAGACTTTGCGGGGAGGG + Intronic
1002064251 5:176644178-176644200 CCACAGAGCCTTCCCAGTGAAGG - Intronic
1002297869 5:178241395-178241417 CCAGAGAGACTCTTCTGGGAAGG + Intronic
1004376774 6:15097311-15097333 CCCCAGGGACTTTCCAGGGAGGG + Intergenic
1007734024 6:43969299-43969321 CAACCCTGACTATCCAGGGAAGG - Intergenic
1008533768 6:52490620-52490642 CAACAGAGACGATCCAGGAGGGG + Intronic
1013609713 6:111782977-111782999 CCACAGTGACTATCTTGGGAAGG + Intronic
1016973066 6:149783286-149783308 CTACAGAAATTATCCAGGCATGG - Intronic
1018662430 6:166100723-166100745 CACCAGAGCCTATACAGGGATGG + Intergenic
1019105228 6:169661689-169661711 CCACAGAGAGTAAGCAGGGTGGG - Intronic
1019772244 7:2891026-2891048 CCACAGAGCCTTTTTAGGGAAGG - Intergenic
1020051200 7:5082911-5082933 CCAGAGAGACCAGCTAGGGAGGG - Intergenic
1020129155 7:5549719-5549741 CCAAAGAGACAATTTAGGGAGGG + Intronic
1020468508 7:8508555-8508577 CCACAGTGTTTATCCAAGGATGG - Intronic
1023338852 7:39197582-39197604 GTAAGGAGACTATCCAGGGATGG + Intronic
1027305584 7:76892820-76892842 CCACAGAAAGTATTCAGGGAAGG - Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1032715487 7:134505669-134505691 CCACAGAGCCTTGCCAGGGAAGG - Intergenic
1033820524 7:145129438-145129460 TGAGAGAGACTATCCAGAGATGG + Intergenic
1034554849 7:151843887-151843909 CCTCAGAGCCCAGCCAGGGAAGG + Intronic
1035251554 7:157600562-157600584 ACACAGAAACTAGCCAGGCATGG - Intronic
1035299338 7:157887106-157887128 CCACAGAGCCAAACCAGAGAAGG + Intronic
1038081678 8:24144350-24144372 AGACAGAGACAATGCAGGGAAGG + Intergenic
1039000101 8:32970555-32970577 ACACAAAGCCTACCCAGGGAGGG + Intergenic
1043197496 8:77316061-77316083 CTACAGAGACTAGCCACTGATGG + Intergenic
1044473055 8:92594630-92594652 CAGCAGAGACAATGCAGGGAAGG + Intergenic
1044933672 8:97274402-97274424 CCACAGAGACAAACCAGAAACGG - Exonic
1045439913 8:102198987-102199009 ACACAGAGACTAGCCAGGAAAGG + Intergenic
1045634172 8:104163944-104163966 CCACAGAGACCCTCCAGGAAAGG + Intronic
1045664394 8:104469380-104469402 CCACAGTGATGATACAGGGATGG + Intergenic
1047051460 8:121117738-121117760 CTCCAGAGGCTATCCAGGGCAGG - Intergenic
1047329767 8:123876265-123876287 CCACAAAGAGTATCCAGGAAAGG - Intronic
1047761164 8:127955600-127955622 CGACAGAGACTGTCTCGGGAAGG - Intergenic
1048553705 8:135456492-135456514 CCTGAGAGGCTGTCCAGGGAAGG + Intergenic
1049483873 8:142841267-142841289 CCCCAGAAACTACCCAGGTAGGG - Intronic
1057184509 9:93049437-93049459 CCACAGAGATGAGCCAGGCATGG + Intergenic
1057794589 9:98146224-98146246 CCACAGAGTCACTCCAGGGAGGG - Intronic
1059663669 9:116425806-116425828 GCACAGAGACTCTCCATGGGAGG - Exonic
1060286795 9:122260682-122260704 CTACAGAGCCTAAACAGGGATGG + Intronic
1062295379 9:135822565-135822587 CCCCAGGGACCATCCACGGATGG - Exonic
1185960804 X:4544660-4544682 GCACAGAGACTAGGAAGGGACGG + Intergenic
1189012903 X:37064161-37064183 CCACAGAGTCTTCCCCGGGAGGG + Intergenic
1192192694 X:69001953-69001975 ACACAGAAAGTATCCAGGGAAGG + Intergenic
1194550694 X:95295055-95295077 CCACATAGTCTATCCAGCAAGGG + Intergenic
1194966917 X:100298682-100298704 ACACAGAGAGTTTGCAGGGAAGG - Intronic
1196217758 X:113073349-113073371 CCACAATGTCTACCCAGGGAAGG - Intergenic
1198028340 X:132730843-132730865 CCACAGAGACTGGCCAGCCAGGG + Intronic
1201744768 Y:17359827-17359849 GCACAGAAAATATTCAGGGACGG - Intergenic
1202274766 Y:23104988-23105010 CCACAAAGAAGATACAGGGATGG + Intergenic
1202291261 Y:23315700-23315722 CCACAAAGAAGATACAGGGATGG - Intergenic
1202427758 Y:24738722-24738744 CCACAAAGAAGATACAGGGATGG + Intergenic
1202443033 Y:24931368-24931390 CCACAAAGAAGATACAGGGATGG - Intergenic