ID: 1143825498

View in Genome Browser
Species Human (GRCh38)
Location 17:9603035-9603057
Sequence TGTTACATGGAGCTCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143825498_1143825501 -5 Left 1143825498 17:9603035-9603057 CCTCCAAAGAGCTCCATGTAACA 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1143825501 17:9603053-9603075 TAACACTACCTGAAAACTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143825498 Original CRISPR TGTTACATGGAGCTCTTTGG AGG (reversed) Intronic
901515020 1:9739513-9739535 TGTGCCATGGAGCCCTTGGGTGG - Intronic
902944781 1:19827067-19827089 TTTAACATGGAGGTCATTGGTGG + Intergenic
904630446 1:31838103-31838125 TGGTCCATGGAGCTCTCTGGAGG - Intergenic
909093110 1:71252273-71252295 TTTTACATAGACCTCTTTGCTGG + Intergenic
911151021 1:94596791-94596813 TCATATATGAAGCTCTTTGGGGG + Intergenic
911226062 1:95306969-95306991 TGTTACAAGGAGCTGTCTGGAGG + Intergenic
912680589 1:111726585-111726607 TGTTCAACGGAGGTCTTTGGGGG + Exonic
915265945 1:154717984-154718006 GGGTGCATGGAGCCCTTTGGAGG - Intronic
916354867 1:163893664-163893686 TGTTACATGAAGTTCTTTAAGGG + Intergenic
916361256 1:163971884-163971906 TGCTTCATGGGGCTCTGTGGAGG + Intergenic
918233281 1:182555027-182555049 TGTTACATGGATATATTGGGAGG + Intronic
918426645 1:184417356-184417378 TGACACATGGATGTCTTTGGGGG - Intronic
919081340 1:192870032-192870054 TGTTACATACAGATATTTGGTGG - Intergenic
920316270 1:205077571-205077593 GTTTCCATGGAGCTTTTTGGGGG - Exonic
924819268 1:247472753-247472775 TATCACATGCTGCTCTTTGGAGG - Intergenic
1063132404 10:3189417-3189439 TGTTCTATGGAGTTCTATGGAGG - Intergenic
1063340690 10:5260754-5260776 TGCTACATGGAGGTCGCTGGTGG - Intergenic
1063377925 10:5565226-5565248 AGTTACATGGTTCTCTTGGGTGG + Intergenic
1063515097 10:6687820-6687842 TGTCCCATGGGGCTCTTTGGAGG + Intergenic
1064293738 10:14058718-14058740 GGTTACATGAGGCCCTTTGGTGG + Intronic
1064722548 10:18244728-18244750 TGGAACATGGACATCTTTGGGGG - Intronic
1068444914 10:57108538-57108560 TGTTAAATTGATATCTTTGGGGG - Intergenic
1078544347 11:12235889-12235911 TGTTTCATGAAGATCTTTTGGGG + Intronic
1079087724 11:17458893-17458915 TGTTACATGTGACTCTTAGGAGG - Intronic
1080029592 11:27646827-27646849 TGTTAGATTGAGCTTTCTGGTGG + Intergenic
1080223947 11:29938772-29938794 TTTTACATTTAGCTCTTTGCAGG - Intergenic
1081417839 11:42837034-42837056 TATGACATGGACATCTTTGGGGG - Intergenic
1084143518 11:67250447-67250469 TGTCCCGTGGAGCTCTTTGGTGG - Exonic
1087143499 11:94789481-94789503 TGTTGCATGCAGGTGTTTGGAGG + Intronic
1087623036 11:100564328-100564350 TGTCACATGGAGGTCTTCGGGGG + Intergenic
1088187572 11:107189211-107189233 TGCTATTTGGAGGTCTTTGGTGG + Intergenic
1091430502 12:429753-429775 TTTTAAAAGCAGCTCTTTGGTGG - Intronic
1092937457 12:13377302-13377324 TGTTCCAGGGAGCTATCTGGAGG + Intronic
1093650516 12:21639024-21639046 TGTTTCTTGGAGACCTTTGGAGG + Intronic
1094332791 12:29314475-29314497 TATTCCAGGGAGCTCTTGGGAGG + Intronic
1094794724 12:33958152-33958174 TATTACTTGGAGCTCTTTAAGGG + Intergenic
1095132385 12:38559821-38559843 TGTTCCATGAAGCTTTTTGTGGG + Intergenic
1096738479 12:53674946-53674968 TGTAAAATGCAGCTCTTAGGGGG + Intronic
1100382668 12:94076119-94076141 TGAGACGTGAAGCTCTTTGGGGG - Intergenic
1100574533 12:95877554-95877576 TGTTAGATGGAGCTGGTTGTGGG + Intronic
1101769268 12:107733469-107733491 TGTAACGTGGAGATCTTTGTAGG - Exonic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1104043576 12:125145999-125146021 TGTCACATGCAGCTTTATGGGGG + Intergenic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1104517053 12:129437334-129437356 TCTGTCATGGAGCTGTTTGGGGG - Intronic
1105896037 13:24718195-24718217 TGTTACTTGGATCTATTTTGTGG - Intergenic
1108340225 13:49492220-49492242 TGTGAAATTTAGCTCTTTGGGGG - Exonic
1112837331 13:103532306-103532328 TGTTACATGTATCTCTTTCCAGG - Intergenic
1114213548 14:20637011-20637033 GGTTACATGAAGTTCTTTAGCGG - Intergenic
1114371099 14:22089456-22089478 TTTGACATGGACATCTTTGGGGG - Intergenic
1114640661 14:24217606-24217628 AGTTTCCTGGATCTCTTTGGGGG + Intronic
1115880246 14:37908514-37908536 TGTTATATGGAGCTTTTTAAAGG - Intronic
1117740100 14:58809161-58809183 TTTTCCATTGAGCTCTCTGGAGG + Intergenic
1117799787 14:59431378-59431400 TAAGACATGGACCTCTTTGGAGG - Intronic
1119549101 14:75495191-75495213 TGTATCATGGAGCTGTTTGGAGG - Intergenic
1121594410 14:95148678-95148700 TCTTATATGGAGATCTTTGATGG - Intronic
1123046466 14:105519302-105519324 TGGCACATGGATCACTTTGGGGG + Intergenic
1124190751 15:27574468-27574490 TGTTGCAGAAAGCTCTTTGGGGG - Intergenic
1125185958 15:36930350-36930372 TATTACTGGGAGTTCTTTGGTGG - Intronic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126044072 15:44621808-44621830 TGTTAAATTGGGCTCTGTGGTGG - Exonic
1127287925 15:57546835-57546857 TGTGACGTGGGGCTCTTTGCTGG + Intronic
1127444130 15:59042888-59042910 GTTTACATGGAGGTGTTTGGGGG + Intronic
1128658307 15:69478738-69478760 TGTTTCATGGGGCTCTCAGGAGG + Intergenic
1129783182 15:78288211-78288233 TGTTACAAGGAGCCCTAGGGAGG - Intronic
1130562216 15:84967675-84967697 TGCTACAGGGACCTCTCTGGGGG + Intergenic
1130761775 15:86828303-86828325 TGTGACATGGACATATTTGGGGG - Intronic
1130982036 15:88819279-88819301 TGTTAGAGGGAGGTCTTTGAGGG + Intronic
1131470708 15:92694197-92694219 TGCTACATTGAGCCCTCTGGTGG - Intronic
1131820059 15:96263366-96263388 TGTTACATGAACCTTTTTGCTGG + Intergenic
1131992040 15:98102059-98102081 TGTTACACTGAGCTCTCTAGAGG + Intergenic
1133844650 16:9442622-9442644 TATTTCATGGAGTTCTTTTGGGG + Intergenic
1135740608 16:24972113-24972135 TATCAGATGGAGCCCTTTGGAGG - Intronic
1136019384 16:27430302-27430324 TGTTTCATGGAGCCCTTTGGTGG - Intronic
1140258250 16:73355467-73355489 GGTGCCATGGAGCTTTTTGGTGG + Intergenic
1142833394 17:2566127-2566149 TGGGACATGGACATCTTTGGGGG - Intergenic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1144292816 17:13842762-13842784 TTTTACATAGAGCTCAATGGAGG - Intergenic
1144662678 17:17081516-17081538 AGTTATCTGGAGCTCTTGGGAGG - Intronic
1148582174 17:48751862-48751884 TGTTTCCTGGAGCTCTTCTGAGG + Intergenic
1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG + Intronic
1148976516 17:51534906-51534928 TGTAACAAAGAGTTCTTTGGTGG - Intergenic
1149268556 17:54953408-54953430 TGTAACCTGGGGCTCCTTGGGGG + Intronic
1152854295 17:82655359-82655381 TGTGACTCAGAGCTCTTTGGAGG - Exonic
1152987944 18:336437-336459 TGTTACATGGGCCTCTTTGTGGG - Intronic
1153246708 18:3079220-3079242 TATGTCATGGAGCTCTTTGATGG - Exonic
1153922719 18:9805622-9805644 TAGGACATGGACCTCTTTGGGGG + Intronic
1154063703 18:11087015-11087037 TGTTAGGTGGAGCTGTTGGGAGG + Intronic
1154125149 18:11685659-11685681 TGATAAATGGAGCTCTTTAGGGG - Intergenic
1155451755 18:25970746-25970768 GGTCCCATGGAGCTCTGTGGAGG - Intergenic
1155990860 18:32277856-32277878 AGTTACATGTAGATCTTTGGAGG + Intronic
1157511102 18:48275403-48275425 TGTTACATTGAGTTCCTTGTGGG + Intronic
1158177985 18:54679082-54679104 TATTTCATGGACATCTTTGGAGG - Intergenic
1164834033 19:31345595-31345617 TGTTCCGTGGAGTTCTTAGGTGG - Intronic
1168545063 19:57243287-57243309 TGTGACATGGAGGTGATTGGCGG + Intronic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
928632673 2:33209880-33209902 TTTTTCATGGAGCTCTTGAGTGG - Intronic
929259102 2:39844929-39844951 TGGAACATGGATCTCTTTTGGGG + Intergenic
929832666 2:45359587-45359609 TGTAACTTGGAGAACTTTGGTGG + Intergenic
932132136 2:69197283-69197305 TTTTACAAGGAGCACTGTGGTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933644333 2:84798518-84798540 TGTAACATGGAGAGCTTTGGGGG - Intronic
933663304 2:84944936-84944958 TGCGGGATGGAGCTCTTTGGTGG + Intergenic
933982916 2:87568156-87568178 TGTAACATGGTGTTCTATGGTGG + Intergenic
935253862 2:101290819-101290841 TGGGTCATGGACCTCTTTGGTGG + Intronic
936060729 2:109294081-109294103 TGTAAGATGGAGCTCTGTTGTGG + Intronic
936060743 2:109294191-109294213 TGTCACATACAGCTCCTTGGTGG + Intronic
939062501 2:137439966-137439988 TGTTCCACAGAGTTCTTTGGAGG + Intronic
939504941 2:143033556-143033578 TATTAAATGGAACTCTTTTGGGG + Intronic
942334294 2:174865487-174865509 ATTAACATGGAGATCTTTGGGGG - Intronic
942493036 2:176509016-176509038 TGGTACATGAACATCTTTGGAGG + Intergenic
943910077 2:193552874-193552896 TGTTACATGGATATATTTTGTGG - Intergenic
945750771 2:213779741-213779763 TCTTACCTGGAGCTCTTGGTAGG + Intronic
947227806 2:227857159-227857181 TTTTACATGAGGCTTTTTGGTGG - Intergenic
949007695 2:241659123-241659145 CGATACGTGGAGCTCCTTGGCGG + Exonic
1168957985 20:1848156-1848178 TGTGAGATGGAGGCCTTTGGAGG + Intergenic
1169067863 20:2704692-2704714 TTTTGCATGGACATCTTTGGGGG + Intronic
1169392533 20:5202266-5202288 TGTTTCATGGAGCTCATTTTAGG + Intergenic
1173797483 20:45872347-45872369 TGGTACAAGGAGCTTTGTGGTGG + Intronic
1174594438 20:51672427-51672449 TGTTACATGTAGAACTTTGAAGG + Intronic
1175515647 20:59568289-59568311 TGTGACTTTGAGCTCTATGGGGG + Intergenic
1176189798 20:63803013-63803035 TGTGGCATCGCGCTCTTTGGTGG - Intronic
1179458207 21:41514242-41514264 TGTGATATGGAGCTGTTTGCAGG - Intronic
1182864866 22:33595096-33595118 TGTGGCATGGAGTTCTTGGGAGG + Intronic
1183383502 22:37502334-37502356 TTTTGCATGGAGGTCTTTTGAGG - Intronic
949101296 3:148942-148964 CTTTAAATGGAGCTGTTTGGAGG - Intergenic
951115121 3:18852348-18852370 TGTTACTTGCAGCTTTGTGGTGG + Intergenic
954873628 3:53786253-53786275 TGGTATATGGAGCTTATTGGTGG + Intronic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
960967593 3:123116034-123116056 TGATACAGTAAGCTCTTTGGGGG + Intronic
960997109 3:123347580-123347602 TGTCCCATGGAGCTTTTTTGGGG - Intronic
961905316 3:130256977-130256999 TGTTTCATGGCAGTCTTTGGTGG + Intergenic
965138530 3:164805937-164805959 TGTTACATAAAGGTTTTTGGGGG - Intergenic
977970739 4:103211020-103211042 CGTAACATGGAGCTCTTTGCTGG + Intergenic
979265983 4:118703410-118703432 TGTTACGTGTATCTCTTTGTTGG - Intronic
979312153 4:119215697-119215719 TGTATCATGGACATCTTTGGTGG - Intronic
979672706 4:123377493-123377515 TAGGACATGGACCTCTTTGGGGG + Intergenic
980138678 4:128888813-128888835 TGTGACATGGAGATGTTTTGTGG + Intronic
980291770 4:130853986-130854008 TGTTACATGGAGATCTGCAGGGG - Intergenic
980633246 4:135466063-135466085 TGTTAAATGGAGCTTTTGTGAGG - Intergenic
982634107 4:157870451-157870473 TGGTACAAGGACATCTTTGGAGG + Intergenic
983165324 4:164469320-164469342 TGGTATATGGAGCTCTATGATGG + Intergenic
983331914 4:166340645-166340667 TGTTAGATGGATCTCTGTAGAGG - Intergenic
985019545 4:185673065-185673087 TGTAACATGGAGCAATCTGGAGG + Intronic
985371434 4:189289527-189289549 TGCTACATGGAGTTCCCTGGGGG - Intergenic
989500048 5:42156120-42156142 TGTTACATTAATCTCTTTAGAGG + Intergenic
990826919 5:59910791-59910813 TAAGACATGGAGTTCTTTGGGGG - Intronic
991313339 5:65270822-65270844 TTTTTCATGGAGGCCTTTGGAGG + Intronic
991580306 5:68147834-68147856 TGTAACATGCTGCACTTTGGTGG + Intergenic
995993420 5:118270163-118270185 TGCTACAAGGAGCTCTTCAGTGG - Intergenic
997762776 5:136465475-136465497 TGCTCCATGGAGCTATTTAGAGG - Intergenic
1000280157 5:159775014-159775036 TTTCACATGGAGCTCATTGAAGG - Intergenic
1007136005 6:39522448-39522470 TGTTAAATGGAGTTCCTTTGTGG - Intronic
1007958443 6:45937899-45937921 TGTTACATGGTTCTCCATGGTGG - Intronic
1008192662 6:48479048-48479070 TGTTTCATGGATCTGTTTGTAGG - Intergenic
1008710756 6:54224443-54224465 TGTGACTTGGAGCTTTTTGAGGG - Intronic
1012880621 6:104783582-104783604 TGTTACATGAAGCTAGCTGGAGG - Intronic
1013286760 6:108688796-108688818 GGTTACATGAAGTTCTTTAGTGG + Intergenic
1013470643 6:110460881-110460903 TGTCCCAAGGAGCACTTTGGTGG - Intronic
1013939096 6:115639098-115639120 TATTACTTGTAGCTCTTAGGTGG - Intergenic
1013954878 6:115830378-115830400 AGTTACTTGGAGCTCTATGCAGG + Intergenic
1016000499 6:139036388-139036410 TGGTACATGGATATCTTCGGGGG + Intronic
1017791085 6:157800001-157800023 TGTAAAATGGAGTTCTTAGGTGG - Intronic
1021078325 7:16332297-16332319 TGTTAAAAGGAGCTATTTAGAGG + Intronic
1021236256 7:18145935-18145957 TGTTCCATTGACCTCTTTTGTGG - Intronic
1022654172 7:32303869-32303891 TGTTATGGGGAGATCTTTGGGGG - Intergenic
1027344995 7:77250327-77250349 TGTTAAAGGAAGCTCTTTAGAGG - Intronic
1028197641 7:87926046-87926068 TTCTACATGATGCTCTTTGGAGG - Intergenic
1028817581 7:95164986-95165008 TGTGACATGGAGTTTTTTGGGGG - Intronic
1029677363 7:102079641-102079663 AGTTACAGGGAGCTCTCCGGAGG - Intronic
1034139948 7:148806122-148806144 TGGTACATTGAGCTCACTGGAGG + Intergenic
1036633085 8:10529127-10529149 TGGAACTTGGACCTCTTTGGGGG + Intronic
1040849759 8:51887227-51887249 TAGAACATGGACCTCTTTGGGGG + Intronic
1041132107 8:54712083-54712105 TGTCACATGAAGATCTTTAGGGG + Intergenic
1044342808 8:91067031-91067053 TGTTATATGGAGGTCTGTGAAGG + Intergenic
1045033439 8:98159220-98159242 TCTTACAAGGAGCCCTTTGTAGG + Exonic
1045416499 8:101972975-101972997 TTTTTCATGGAGCACTTTAGGGG - Intronic
1045918192 8:107498735-107498757 TTTTACAAGGATCTCTTTGGTGG + Intergenic
1046915167 8:119672038-119672060 TGCTACAAGGAGGTCTTCGGCGG + Intronic
1049383369 8:142328801-142328823 TGTGACAGGGAGGCCTTTGGGGG + Intronic
1049619557 8:143591923-143591945 TGGAACATGGAGTTCTTTGCGGG + Intronic
1050177348 9:2882194-2882216 TCATAGATGGACCTCTTTGGTGG - Intergenic
1051398460 9:16653544-16653566 TGTCACAAGGAGCACTCTGGGGG + Intronic
1052350959 9:27457736-27457758 TTCCACATGGATCTCTTTGGTGG - Intronic
1052879154 9:33589978-33590000 TATGACATGGAGCTCTATGATGG + Intergenic
1058674196 9:107386744-107386766 GGCTACATGGAGCTCTATGTTGG - Intergenic
1060685794 9:125610583-125610605 TCTCACATGTAGGTCTTTGGTGG - Intronic
1062475927 9:136727474-136727496 TGTGACAGTGAGCTTTTTGGTGG - Intergenic
1186223966 X:7377429-7377451 TGTTACATGGGGTTATTTTGTGG + Intergenic
1188985895 X:36768065-36768087 GGTTACAAGGAGCACATTGGTGG - Intergenic
1188994232 X:36862671-36862693 TGTTACACGAAGCACTTTGCAGG + Intergenic
1191180203 X:57554029-57554051 AGTTACATGGAGTTCTTTAGTGG - Intergenic
1193630358 X:83878620-83878642 TGTGATATGTAGCTCTTTAGAGG - Intronic
1194123500 X:89987884-89987906 AGTTAGATGTACCTCTTTGGAGG - Intergenic
1194934842 X:99936580-99936602 GGTTACGTGGAGTTCTTTCGTGG - Intergenic
1197283270 X:124563217-124563239 TGTTAAAGGAAGCTCCTTGGAGG + Intronic
1199659040 X:150028802-150028824 TGTTAAAAGGAGTTCTTTAGGGG - Intergenic
1200476385 Y:3645501-3645523 AGTTAGATGTACCTCTTTGGAGG - Intergenic
1200750396 Y:6939540-6939562 TGGGACATGGGGATCTTTGGGGG + Intronic