ID: 1143839158

View in Genome Browser
Species Human (GRCh38)
Location 17:9717836-9717858
Sequence TGCCAGGCTGAAGTGCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4691
Summary {0: 1, 1: 7, 2: 102, 3: 945, 4: 3636}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143839158 Original CRISPR TGCCAGGCTGAAGTGCAATG GGG Intronic
Too many off-targets to display for this crispr