ID: 1143845409

View in Genome Browser
Species Human (GRCh38)
Location 17:9769668-9769690
Sequence GCTCACCGAAGCAGCAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143845409_1143845414 11 Left 1143845409 17:9769668-9769690 CCTTGCCTGCTGCTTCGGTGAGC No data
Right 1143845414 17:9769702-9769724 GACCCGACATCCTGCCTCCACGG No data
1143845409_1143845417 18 Left 1143845409 17:9769668-9769690 CCTTGCCTGCTGCTTCGGTGAGC No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845409_1143845419 22 Left 1143845409 17:9769668-9769690 CCTTGCCTGCTGCTTCGGTGAGC No data
Right 1143845419 17:9769713-9769735 CTGCCTCCACGGTAGCAGGACGG No data
1143845409_1143845420 23 Left 1143845409 17:9769668-9769690 CCTTGCCTGCTGCTTCGGTGAGC No data
Right 1143845420 17:9769714-9769736 TGCCTCCACGGTAGCAGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143845409 Original CRISPR GCTCACCGAAGCAGCAGGCA AGG (reversed) Intergenic