ID: 1143845410

View in Genome Browser
Species Human (GRCh38)
Location 17:9769673-9769695
Sequence CAGGGGCTCACCGAAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143845410_1143845420 18 Left 1143845410 17:9769673-9769695 CCTGCTGCTTCGGTGAGCCCCTG No data
Right 1143845420 17:9769714-9769736 TGCCTCCACGGTAGCAGGACGGG No data
1143845410_1143845417 13 Left 1143845410 17:9769673-9769695 CCTGCTGCTTCGGTGAGCCCCTG No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845410_1143845419 17 Left 1143845410 17:9769673-9769695 CCTGCTGCTTCGGTGAGCCCCTG No data
Right 1143845419 17:9769713-9769735 CTGCCTCCACGGTAGCAGGACGG No data
1143845410_1143845414 6 Left 1143845410 17:9769673-9769695 CCTGCTGCTTCGGTGAGCCCCTG No data
Right 1143845414 17:9769702-9769724 GACCCGACATCCTGCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143845410 Original CRISPR CAGGGGCTCACCGAAGCAGC AGG (reversed) Intergenic