ID: 1143845412

View in Genome Browser
Species Human (GRCh38)
Location 17:9769691-9769713
Sequence GGATGTCGGGTCAGAACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143845412_1143845425 25 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845412_1143845420 0 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845420 17:9769714-9769736 TGCCTCCACGGTAGCAGGACGGG No data
1143845412_1143845419 -1 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845419 17:9769713-9769735 CTGCCTCCACGGTAGCAGGACGG No data
1143845412_1143845417 -5 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845412_1143845423 19 Left 1143845412 17:9769691-9769713 CCCTGAGTTCTGACCCGACATCC No data
Right 1143845423 17:9769733-9769755 CGGGACCACCAGCCTTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143845412 Original CRISPR GGATGTCGGGTCAGAACTCA GGG (reversed) Intergenic