ID: 1143845413

View in Genome Browser
Species Human (GRCh38)
Location 17:9769692-9769714
Sequence AGGATGTCGGGTCAGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143845413_1143845417 -6 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845417 17:9769709-9769731 CATCCTGCCTCCACGGTAGCAGG No data
1143845413_1143845423 18 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845423 17:9769733-9769755 CGGGACCACCAGCCTTGTCCTGG No data
1143845413_1143845420 -1 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845420 17:9769714-9769736 TGCCTCCACGGTAGCAGGACGGG No data
1143845413_1143845425 24 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845425 17:9769739-9769761 CACCAGCCTTGTCCTGGAGTAGG No data
1143845413_1143845419 -2 Left 1143845413 17:9769692-9769714 CCTGAGTTCTGACCCGACATCCT No data
Right 1143845419 17:9769713-9769735 CTGCCTCCACGGTAGCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143845413 Original CRISPR AGGATGTCGGGTCAGAACTC AGG (reversed) Intergenic